Incidental Mutation 'R9710:Itgb5'
ID 730113
Institutional Source Beutler Lab
Gene Symbol Itgb5
Ensembl Gene ENSMUSG00000022817
Gene Name integrin beta 5
Synonyms ESTM23, [b]-5, beta-5, beta5, [b]5, [b]5A, [b]5B
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9710 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 33829665-33949338 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 33865547 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 86 (T86A)
Ref Sequence ENSEMBL: ENSMUSP00000069416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069345] [ENSMUST00000115028]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000069345
AA Change: T86A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000069416
Gene: ENSMUSG00000022817
AA Change: T86A

DomainStartEndE-ValueType
PSI 27 76 1.4e-7 SMART
INB 35 463 1.18e-284 SMART
VWA 137 372 5.95e-7 SMART
internal_repeat_1 492 549 3.16e-7 PROSPERO
EGF 554 586 1.95e1 SMART
Integrin_B_tail 635 719 1.56e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115028
AA Change: T86A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110680
Gene: ENSMUSG00000022817
AA Change: T86A

DomainStartEndE-ValueType
PSI 27 76 1.4e-7 SMART
INB 35 463 1.18e-284 SMART
VWA 137 372 5.95e-7 SMART
internal_repeat_1 492 549 3.16e-7 PROSPERO
EGF 554 586 1.95e1 SMART
Integrin_B_tail 635 719 1.56e-21 SMART
Integrin_b_cyt 743 790 5.97e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation do not appear to differ from normal in respect to development, reproduction, adenovirus infection, or wound healing. Mutant keratinocytes do show reduced migration on, and adhesion to, vitronectin in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T C 15: 82,062,651 S250P probably benign Het
A430105I19Rik G T 2: 118,760,596 A152E probably benign Het
Ahcyl1 T A 3: 107,671,178 I248F possibly damaging Het
Alpk2 T A 18: 65,349,575 E454V probably damaging Het
Ank3 A T 10: 69,993,240 T2580S Het
Anks1 G A 17: 27,909,597 G46R possibly damaging Het
Arhgap45 A G 10: 80,021,801 E322G probably damaging Het
Arhgef2 T C 3: 88,621,269 I4T probably benign Het
C1qtnf4 T C 2: 90,890,007 I208T probably damaging Het
Cachd1 T A 4: 100,974,895 N751K probably benign Het
Cacna1a G T 8: 84,594,179 V1589F possibly damaging Het
Cacnb1 T C 11: 98,011,371 H205R probably benign Het
Clvs2 C A 10: 33,513,311 R311L probably benign Het
Crim1 G T 17: 78,303,075 G320* probably null Het
Crtam A T 9: 40,984,375 D218E probably benign Het
Cwc27 G A 13: 104,806,650 T128I probably damaging Het
Cyp4a14 T A 4: 115,492,150 I238F probably benign Het
D930020B18Rik A C 10: 121,667,658 E246A probably benign Het
Dsg1c T A 18: 20,276,987 V504E probably benign Het
Enpp6 T A 8: 47,065,913 S239T probably damaging Het
Eri2 A T 7: 119,785,601 I559N probably benign Het
Fbxo34 T C 14: 47,531,267 Y746H probably damaging Het
Galr1 A T 18: 82,405,978 L58Q probably damaging Het
Gatsl3 A G 11: 4,219,015 K61E probably benign Het
Ghdc A G 11: 100,768,037 V423A probably benign Het
Glt28d2 T C 3: 85,871,752 D138G probably benign Het
Gm266 A T 12: 111,485,329 C148S probably benign Het
Gm597 T A 1: 28,778,039 Y304F probably benign Het
Gnas C T 2: 174,299,339 T493M unknown Het
Hivep2 T C 10: 14,139,459 I1790T probably damaging Het
Impg1 A G 9: 80,379,994 V390A probably benign Het
Isy1 A G 6: 87,819,592 F239L possibly damaging Het
Itpr1 T C 6: 108,405,520 C1458R possibly damaging Het
Krt28 T C 11: 99,365,095 E446G probably damaging Het
Lama1 A T 17: 67,822,409 Q3071L Het
Lasp1 A G 11: 97,806,767 probably benign Het
Lmf2 T C 15: 89,353,216 K348E probably benign Het
Lrch3 G T 16: 32,975,738 E331* probably null Het
Lzic T A 4: 149,488,684 F98I probably damaging Het
Map7d1 C A 4: 126,233,647 probably null Het
March8 C T 6: 116,401,444 T113I possibly damaging Het
Mgrn1 A T 16: 4,927,876 K423* probably null Het
Muc20 G A 16: 32,794,896 T37I possibly damaging Het
Myh15 A G 16: 49,138,681 E972G probably damaging Het
Myocd T A 11: 65,196,341 K253N probably damaging Het
Myod1 T G 7: 46,377,151 L160R probably damaging Het
Nanog T C 6: 122,707,840 S20P probably benign Het
Nat8f2 A T 6: 85,867,701 Y226* probably null Het
Nsmf A G 2: 25,059,065 K277R probably null Het
Nsrp1 C T 11: 77,076,677 G30R probably damaging Het
Nsun6 C A 2: 14,998,198 R389L probably benign Het
Obscn G A 11: 59,052,571 R4251C probably benign Het
Olfr1153 G A 2: 87,896,558 D120N probably damaging Het
Olfr555 A G 7: 102,659,234 T138A probably damaging Het
Olfr749 C T 14: 50,736,742 C140Y probably benign Het
Olfr979 A T 9: 40,000,876 M117K probably damaging Het
Pgm2 T C 4: 99,986,721 L567P probably damaging Het
Polrmt G T 10: 79,740,701 H474N probably benign Het
Ppfia2 A G 10: 106,829,024 I374V probably benign Het
Pramel5 T A 4: 144,272,975 I181F probably benign Het
Prpf4b T A 13: 34,899,887 Y880N probably damaging Het
Ptpn3 G A 4: 57,249,957 Q180* probably null Het
Ptprc T C 1: 138,080,889 R687G probably damaging Het
Rnaseh2a T C 8: 84,958,009 T241A probably damaging Het
Rnf148 T A 6: 23,654,803 I65F possibly damaging Het
Rnf213 A G 11: 119,441,005 I2348V Het
Rttn A G 18: 89,017,210 N736S possibly damaging Het
Ryr3 A C 2: 112,803,189 V2093G probably damaging Het
Selenof T A 3: 144,577,609 F33L probably benign Het
Sh2d3c C T 2: 32,745,877 R238* probably null Het
Slc23a4 T C 6: 34,946,300 K543R probably benign Het
Smn1 A T 13: 100,135,702 N278I possibly damaging Het
Sox7 G A 14: 63,948,060 A182T probably benign Het
Sptlc2 A T 12: 87,312,759 I501N probably benign Het
Srf T C 17: 46,555,345 T162A probably benign Het
Srm C T 4: 148,591,582 probably benign Het
Stim1 CAGCGCCTGACGGAGC CAGC 7: 102,430,911 probably benign Het
Taar8a T C 10: 24,076,816 L106P probably damaging Het
Tcte1 A G 17: 45,539,872 H358R possibly damaging Het
Tmem205 A G 9: 21,926,291 S20P probably damaging Het
Trav16 T A 14: 53,743,453 V33E possibly damaging Het
Trf T A 9: 103,226,018 I149F probably damaging Het
Trmt2a C T 16: 18,252,177 Q419* probably null Het
Ttc19 A G 11: 62,313,171 I319M probably benign Het
Txndc16 T C 14: 45,163,010 I345V probably benign Het
Ube3b T C 5: 114,415,309 I914T probably benign Het
Ubr3 T C 2: 69,897,613 F107L possibly damaging Het
Vmn1r73 T C 7: 11,756,480 F75S possibly damaging Het
Vmn2r54 A T 7: 12,629,826 M380K possibly damaging Het
Wdr7 T A 18: 63,794,246 M989K possibly damaging Het
Zcchc3 A G 2: 152,414,465 S105P probably benign Het
Zfp735 T A 11: 73,710,980 V250E possibly damaging Het
Other mutations in Itgb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Itgb5 APN 16 33884975 missense probably damaging 1.00
IGL01121:Itgb5 APN 16 33919989 missense probably benign 0.00
IGL01620:Itgb5 APN 16 33919798 missense probably damaging 1.00
IGL02332:Itgb5 APN 16 33920130 nonsense probably null
IGL02869:Itgb5 APN 16 33844992 missense possibly damaging 0.94
IGL02881:Itgb5 APN 16 33919905 missense probably benign 0.00
IGL02941:Itgb5 APN 16 33944095 splice site probably benign
IGL03216:Itgb5 APN 16 33902838 missense probably benign 0.38
IGL03351:Itgb5 APN 16 33910552 missense probably benign 0.00
PIT4812001:Itgb5 UTSW 16 33919987 missense probably damaging 1.00
R0744:Itgb5 UTSW 16 33900583 missense probably damaging 0.99
R0829:Itgb5 UTSW 16 33944201 missense probably benign 0.29
R0836:Itgb5 UTSW 16 33900583 missense probably damaging 0.99
R1387:Itgb5 UTSW 16 33900515 nonsense probably null
R1703:Itgb5 UTSW 16 33910500 missense probably benign 0.01
R1783:Itgb5 UTSW 16 33940562 missense probably benign 0.13
R1826:Itgb5 UTSW 16 33865560 missense possibly damaging 0.48
R1889:Itgb5 UTSW 16 33910469 missense probably damaging 1.00
R2374:Itgb5 UTSW 16 33919798 missense probably damaging 1.00
R4307:Itgb5 UTSW 16 33948732 missense possibly damaging 0.80
R4355:Itgb5 UTSW 16 33844997 missense probably damaging 0.98
R4796:Itgb5 UTSW 16 33885021 missense possibly damaging 0.83
R4879:Itgb5 UTSW 16 33875978 missense probably damaging 1.00
R6165:Itgb5 UTSW 16 33899242 missense probably benign 0.01
R6584:Itgb5 UTSW 16 33885030 missense probably damaging 1.00
R6617:Itgb5 UTSW 16 33946592 missense probably benign 0.01
R6748:Itgb5 UTSW 16 33899297 missense probably damaging 1.00
R6979:Itgb5 UTSW 16 33919986 missense probably damaging 1.00
R7090:Itgb5 UTSW 16 33885094 missense probably damaging 1.00
R7150:Itgb5 UTSW 16 33940643 missense probably benign 0.03
R7403:Itgb5 UTSW 16 33902793 critical splice acceptor site probably null
R7418:Itgb5 UTSW 16 33885094 missense probably damaging 1.00
R7719:Itgb5 UTSW 16 33920116 missense probably benign 0.01
R8309:Itgb5 UTSW 16 33865553 missense probably benign 0.00
R8347:Itgb5 UTSW 16 33940678 missense probably damaging 1.00
R8856:Itgb5 UTSW 16 33900592 missense probably damaging 1.00
R9100:Itgb5 UTSW 16 33920181 missense possibly damaging 0.91
R9194:Itgb5 UTSW 16 33900511 missense probably damaging 1.00
R9309:Itgb5 UTSW 16 33920046 missense probably benign 0.00
R9343:Itgb5 UTSW 16 33910456 splice site probably benign
R9629:Itgb5 UTSW 16 33875925 missense probably damaging 1.00
R9683:Itgb5 UTSW 16 33919965 missense probably damaging 0.97
X0022:Itgb5 UTSW 16 33845050 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TCATGTAGCATTTGGATCAGGG -3'
(R):5'- GCCCATCTTCCACATTAGCG -3'

Sequencing Primer
(F):5'- CACTTTCCAACTGTGACAATGGAGTG -3'
(R):5'- TTAGCGTATCACACCCATGGG -3'
Posted On 2022-10-06