Incidental Mutation 'R9710:Crim1'
ID 730119
Institutional Source Beutler Lab
Gene Symbol Crim1
Ensembl Gene ENSMUSG00000024074
Gene Name cysteine rich transmembrane BMP regulator 1
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9710 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 78507677-78684021 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 78610504 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Stop codon at position 320 (G320*)
Ref Sequence ENSEMBL: ENSMUSP00000108117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112498]
AlphaFold Q9JLL0
Predicted Effect probably null
Transcript: ENSMUST00000112498
AA Change: G320*
SMART Domains Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074
AA Change: G320*

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
IB 35 111 1.87e-5 SMART
VWC 336 390 6.04e-13 SMART
VWC 403 456 1.15e-9 SMART
Pfam:Antistasin 469 498 4.5e-10 PFAM
Pfam:Antistasin 505 532 1.5e-8 PFAM
Pfam:Antistasin 539 564 5.7e-9 PFAM
Pfam:Antistasin 567 592 1.7e-10 PFAM
VWC 608 662 1.26e-10 SMART
VWC 679 734 1.37e-11 SMART
VWC 753 808 1.46e-11 SMART
VWC 819 873 1.01e-14 SMART
transmembrane domain 940 962 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T C 15: 81,946,852 (GRCm39) S250P probably benign Het
Ahcyl1 T A 3: 107,578,494 (GRCm39) I248F possibly damaging Het
Alpk2 T A 18: 65,482,646 (GRCm39) E454V probably damaging Het
Ank3 A T 10: 69,829,070 (GRCm39) T2580S Het
Anks1 G A 17: 28,128,571 (GRCm39) G46R possibly damaging Het
Arhgap45 A G 10: 79,857,635 (GRCm39) E322G probably damaging Het
Arhgef2 T C 3: 88,528,576 (GRCm39) I4T probably benign Het
C1qtnf4 T C 2: 90,720,351 (GRCm39) I208T probably damaging Het
Cachd1 T A 4: 100,832,092 (GRCm39) N751K probably benign Het
Cacna1a G T 8: 85,320,808 (GRCm39) V1589F possibly damaging Het
Cacnb1 T C 11: 97,902,197 (GRCm39) H205R probably benign Het
Castor1 A G 11: 4,169,015 (GRCm39) K61E probably benign Het
Ccdc9b G T 2: 118,591,077 (GRCm39) A152E probably benign Het
Clvs2 C A 10: 33,389,307 (GRCm39) R311L probably benign Het
Crtam A T 9: 40,895,671 (GRCm39) D218E probably benign Het
Cwc27 G A 13: 104,943,158 (GRCm39) T128I probably damaging Het
Cyp4a14 T A 4: 115,349,347 (GRCm39) I238F probably benign Het
D930020B18Rik A C 10: 121,503,563 (GRCm39) E246A probably benign Het
Dsg1c T A 18: 20,410,044 (GRCm39) V504E probably benign Het
Enpp6 T A 8: 47,518,948 (GRCm39) S239T probably damaging Het
Eri2 A T 7: 119,384,824 (GRCm39) I559N probably benign Het
Fbxo34 T C 14: 47,768,724 (GRCm39) Y746H probably damaging Het
Galr1 A T 18: 82,424,103 (GRCm39) L58Q probably damaging Het
Ghdc A G 11: 100,658,863 (GRCm39) V423A probably benign Het
Glt28d2 T C 3: 85,779,059 (GRCm39) D138G probably benign Het
Gm266 A T 12: 111,451,763 (GRCm39) C148S probably benign Het
Gnas C T 2: 174,141,132 (GRCm39) T493M unknown Het
Hivep2 T C 10: 14,015,203 (GRCm39) I1790T probably damaging Het
Impg1 A G 9: 80,287,276 (GRCm39) V390A probably benign Het
Isy1 A G 6: 87,796,574 (GRCm39) F239L possibly damaging Het
Itgb5 A G 16: 33,685,917 (GRCm39) T86A probably benign Het
Itpr1 T C 6: 108,382,481 (GRCm39) C1458R possibly damaging Het
Krt28 T C 11: 99,255,921 (GRCm39) E446G probably damaging Het
Lama1 A T 17: 68,129,404 (GRCm39) Q3071L Het
Lasp1 A G 11: 97,697,593 (GRCm39) probably benign Het
Lmf2 T C 15: 89,237,419 (GRCm39) K348E probably benign Het
Lrch3 G T 16: 32,796,108 (GRCm39) E331* probably null Het
Lzic T A 4: 149,573,141 (GRCm39) F98I probably damaging Het
Map7d1 C A 4: 126,127,440 (GRCm39) probably null Het
Marchf8 C T 6: 116,378,405 (GRCm39) T113I possibly damaging Het
Mgrn1 A T 16: 4,745,740 (GRCm39) K423* probably null Het
Muc20 G A 16: 32,615,266 (GRCm39) T37I possibly damaging Het
Myh15 A G 16: 48,959,044 (GRCm39) E972G probably damaging Het
Myocd T A 11: 65,087,167 (GRCm39) K253N probably damaging Het
Myod1 T G 7: 46,026,575 (GRCm39) L160R probably damaging Het
Nanog T C 6: 122,684,799 (GRCm39) S20P probably benign Het
Nat8f2 A T 6: 85,844,683 (GRCm39) Y226* probably null Het
Nsmf A G 2: 24,949,077 (GRCm39) K277R probably null Het
Nsrp1 C T 11: 76,967,503 (GRCm39) G30R probably damaging Het
Nsun6 C A 2: 15,003,009 (GRCm39) R389L probably benign Het
Obscn G A 11: 58,943,397 (GRCm39) R4251C probably benign Het
Or10g9 A T 9: 39,912,172 (GRCm39) M117K probably damaging Het
Or11h4 C T 14: 50,974,199 (GRCm39) C140Y probably benign Het
Or51h1 A G 7: 102,308,441 (GRCm39) T138A probably damaging Het
Or5w20 G A 2: 87,726,902 (GRCm39) D120N probably damaging Het
Pgm1 T C 4: 99,843,918 (GRCm39) L567P probably damaging Het
Polrmt G T 10: 79,576,535 (GRCm39) H474N probably benign Het
Ppfia2 A G 10: 106,664,885 (GRCm39) I374V probably benign Het
Pramel5 T A 4: 143,999,545 (GRCm39) I181F probably benign Het
Prpf4b T A 13: 35,083,870 (GRCm39) Y880N probably damaging Het
Ptpn3 G A 4: 57,249,957 (GRCm39) Q180* probably null Het
Ptprc T C 1: 138,008,627 (GRCm39) R687G probably damaging Het
Rnaseh2a T C 8: 85,684,638 (GRCm39) T241A probably damaging Het
Rnf148 T A 6: 23,654,802 (GRCm39) I65F possibly damaging Het
Rnf213 A G 11: 119,331,831 (GRCm39) I2348V Het
Rttn A G 18: 89,035,334 (GRCm39) N736S possibly damaging Het
Ryr3 A C 2: 112,633,534 (GRCm39) V2093G probably damaging Het
Selenof T A 3: 144,283,370 (GRCm39) F33L probably benign Het
Sh2d3c C T 2: 32,635,889 (GRCm39) R238* probably null Het
Slc23a4 T C 6: 34,923,235 (GRCm39) K543R probably benign Het
Smn1 A T 13: 100,272,210 (GRCm39) N278I possibly damaging Het
Sox7 G A 14: 64,185,509 (GRCm39) A182T probably benign Het
Spata31e5 T A 1: 28,817,120 (GRCm39) Y304F probably benign Het
Sptlc2 A T 12: 87,359,533 (GRCm39) I501N probably benign Het
Srf T C 17: 46,866,271 (GRCm39) T162A probably benign Het
Srm C T 4: 148,676,039 (GRCm39) probably benign Het
Stim1 CAGCGCCTGACGGAGC CAGC 7: 102,080,118 (GRCm39) probably benign Het
Taar8a T C 10: 23,952,714 (GRCm39) L106P probably damaging Het
Tcte1 A G 17: 45,850,798 (GRCm39) H358R possibly damaging Het
Tmem205 A G 9: 21,837,587 (GRCm39) S20P probably damaging Het
Trav16 T A 14: 53,980,910 (GRCm39) V33E possibly damaging Het
Trf T A 9: 103,103,217 (GRCm39) I149F probably damaging Het
Trmt2a C T 16: 18,070,041 (GRCm39) Q419* probably null Het
Ttc19 A G 11: 62,203,997 (GRCm39) I319M probably benign Het
Txndc16 T C 14: 45,400,467 (GRCm39) I345V probably benign Het
Ube3b T C 5: 114,553,370 (GRCm39) I914T probably benign Het
Ubr3 T C 2: 69,727,957 (GRCm39) F107L possibly damaging Het
Vmn1r73 T C 7: 11,490,407 (GRCm39) F75S possibly damaging Het
Vmn2r54 A T 7: 12,363,753 (GRCm39) M380K possibly damaging Het
Wdr7 T A 18: 63,927,317 (GRCm39) M989K possibly damaging Het
Zcchc3 A G 2: 152,256,385 (GRCm39) S105P probably benign Het
Zfp735 T A 11: 73,601,806 (GRCm39) V250E possibly damaging Het
Other mutations in Crim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Crim1 APN 17 78,677,520 (GRCm39) missense probably damaging 1.00
IGL01090:Crim1 APN 17 78,654,658 (GRCm39) missense probably damaging 0.97
IGL01490:Crim1 APN 17 78,642,725 (GRCm39) missense possibly damaging 0.94
IGL01686:Crim1 APN 17 78,651,863 (GRCm39) missense probably benign 0.09
IGL01769:Crim1 APN 17 78,620,664 (GRCm39) missense probably benign 0.02
IGL02004:Crim1 APN 17 78,680,004 (GRCm39) splice site probably benign
IGL02211:Crim1 APN 17 78,662,574 (GRCm39) missense probably damaging 1.00
IGL02275:Crim1 APN 17 78,677,427 (GRCm39) missense possibly damaging 0.56
IGL02408:Crim1 APN 17 78,623,083 (GRCm39) missense possibly damaging 0.78
IGL02411:Crim1 APN 17 78,642,763 (GRCm39) nonsense probably null
IGL02453:Crim1 APN 17 78,651,913 (GRCm39) missense probably damaging 1.00
IGL02481:Crim1 APN 17 78,658,227 (GRCm39) missense probably damaging 0.98
IGL02632:Crim1 APN 17 78,680,103 (GRCm39) missense probably benign 0.08
IGL02652:Crim1 APN 17 78,623,106 (GRCm39) missense probably damaging 1.00
IGL02696:Crim1 APN 17 78,587,402 (GRCm39) missense probably damaging 0.96
IGL02811:Crim1 APN 17 78,658,130 (GRCm39) missense possibly damaging 0.62
IGL03105:Crim1 APN 17 78,623,179 (GRCm39) splice site probably benign
IGL03349:Crim1 APN 17 78,662,579 (GRCm39) nonsense probably null
bugeye UTSW 17 78,588,776 (GRCm39) missense possibly damaging 0.94
IGL03097:Crim1 UTSW 17 78,675,227 (GRCm39) missense probably benign 0.00
R0227:Crim1 UTSW 17 78,651,938 (GRCm39) splice site probably benign
R0458:Crim1 UTSW 17 78,620,655 (GRCm39) missense probably damaging 0.98
R0482:Crim1 UTSW 17 78,680,008 (GRCm39) missense probably benign 0.00
R0989:Crim1 UTSW 17 78,508,373 (GRCm39) missense probably benign 0.21
R1266:Crim1 UTSW 17 78,508,262 (GRCm39) small deletion probably benign
R1529:Crim1 UTSW 17 78,675,383 (GRCm39) missense probably benign
R1679:Crim1 UTSW 17 78,508,228 (GRCm39) missense probably benign 0.27
R1909:Crim1 UTSW 17 78,620,556 (GRCm39) missense probably benign 0.26
R2273:Crim1 UTSW 17 78,662,608 (GRCm39) critical splice donor site probably null
R3899:Crim1 UTSW 17 78,588,783 (GRCm39) missense probably benign 0.00
R3909:Crim1 UTSW 17 78,588,668 (GRCm39) splice site probably benign
R4092:Crim1 UTSW 17 78,658,265 (GRCm39) missense probably damaging 1.00
R4154:Crim1 UTSW 17 78,545,272 (GRCm39) missense probably benign 0.01
R4687:Crim1 UTSW 17 78,610,454 (GRCm39) missense probably damaging 1.00
R5022:Crim1 UTSW 17 78,587,558 (GRCm39) missense possibly damaging 0.95
R5073:Crim1 UTSW 17 78,588,776 (GRCm39) missense possibly damaging 0.94
R5089:Crim1 UTSW 17 78,681,519 (GRCm39) missense probably damaging 1.00
R5284:Crim1 UTSW 17 78,620,695 (GRCm39) missense possibly damaging 0.83
R5461:Crim1 UTSW 17 78,545,236 (GRCm39) missense probably damaging 1.00
R5635:Crim1 UTSW 17 78,623,070 (GRCm39) missense probably damaging 1.00
R5686:Crim1 UTSW 17 78,681,512 (GRCm39) missense possibly damaging 0.63
R5956:Crim1 UTSW 17 78,623,146 (GRCm39) missense probably damaging 1.00
R6117:Crim1 UTSW 17 78,610,517 (GRCm39) missense probably damaging 1.00
R6129:Crim1 UTSW 17 78,588,738 (GRCm39) missense probably benign 0.17
R6265:Crim1 UTSW 17 78,677,514 (GRCm39) missense probably benign 0.01
R6812:Crim1 UTSW 17 78,623,029 (GRCm39) missense probably damaging 1.00
R6858:Crim1 UTSW 17 78,623,056 (GRCm39) missense probably damaging 1.00
R7920:Crim1 UTSW 17 78,610,493 (GRCm39) missense probably damaging 1.00
R8022:Crim1 UTSW 17 78,622,984 (GRCm39) missense possibly damaging 0.82
R8434:Crim1 UTSW 17 78,654,686 (GRCm39) missense probably benign 0.00
R8782:Crim1 UTSW 17 78,508,306 (GRCm39) missense probably damaging 1.00
R8961:Crim1 UTSW 17 78,680,117 (GRCm39) missense possibly damaging 0.65
R8971:Crim1 UTSW 17 78,653,409 (GRCm39) missense possibly damaging 0.89
R9245:Crim1 UTSW 17 78,651,871 (GRCm39) missense probably damaging 1.00
R9250:Crim1 UTSW 17 78,677,471 (GRCm39) missense probably benign
R9401:Crim1 UTSW 17 78,658,294 (GRCm39) frame shift probably null
R9402:Crim1 UTSW 17 78,658,294 (GRCm39) frame shift probably null
R9644:Crim1 UTSW 17 78,587,497 (GRCm39) missense probably damaging 1.00
R9702:Crim1 UTSW 17 78,681,516 (GRCm39) missense probably damaging 1.00
X0064:Crim1 UTSW 17 78,508,262 (GRCm39) small deletion probably benign
Z1088:Crim1 UTSW 17 78,675,264 (GRCm39) missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TTACTAGCACAACCGTTCCC -3'
(R):5'- AAGCAAACCTCCTCTCTGAGTG -3'

Sequencing Primer
(F):5'- TCACGTAGAGTAGGTACTTGCCAC -3'
(R):5'- AGTGATCTTCAGCATGGCCCTAAG -3'
Posted On 2022-10-06