Incidental Mutation 'R9711:Zfp442'
ID 730130
Institutional Source Beutler Lab
Gene Symbol Zfp442
Ensembl Gene ENSMUSG00000068130
Gene Name zinc finger protein 442
Synonyms OTTMUSG00000015730
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R9711 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 150407141-150451486 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 150408287 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 565 (H565L)
Ref Sequence ENSEMBL: ENSMUSP00000105542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109916] [ENSMUST00000185796]
AlphaFold A2AQA0
Predicted Effect possibly damaging
Transcript: ENSMUST00000109916
AA Change: H565L

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105542
Gene: ENSMUSG00000068130
AA Change: H565L

DomainStartEndE-ValueType
KRAB 4 66 3.27e-19 SMART
ZnF_C2H2 159 181 8.34e-3 SMART
ZnF_C2H2 211 233 9.58e-3 SMART
ZnF_C2H2 239 261 2.43e-4 SMART
ZnF_C2H2 267 289 1.38e-3 SMART
ZnF_C2H2 295 317 4.17e-3 SMART
ZnF_C2H2 323 345 3.16e-3 SMART
ZnF_C2H2 351 373 1.58e-3 SMART
ZnF_C2H2 379 401 9.58e-3 SMART
ZnF_C2H2 407 429 2.09e-3 SMART
ZnF_C2H2 435 457 2.2e-2 SMART
ZnF_C2H2 463 485 1.6e-4 SMART
ZnF_C2H2 491 513 1.82e-3 SMART
ZnF_C2H2 519 541 4.47e-3 SMART
ZnF_C2H2 547 569 3.63e-3 SMART
ZnF_C2H2 575 597 4.79e-3 SMART
ZnF_C2H2 603 625 8.47e-4 SMART
ZnF_C2H2 631 654 3.11e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185796
AA Change: H508L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140098
Gene: ENSMUSG00000068130
AA Change: H508L

DomainStartEndE-ValueType
KRAB 3 65 1.4e-21 SMART
ZnF_C2H2 158 180 3.4e-5 SMART
ZnF_C2H2 210 232 3.9e-5 SMART
ZnF_C2H2 238 260 1e-6 SMART
ZnF_C2H2 266 288 5.6e-6 SMART
ZnF_C2H2 294 316 1.8e-5 SMART
ZnF_C2H2 322 344 1.3e-5 SMART
ZnF_C2H2 350 372 6.7e-6 SMART
ZnF_C2H2 378 400 9.6e-5 SMART
ZnF_C2H2 406 428 6.9e-7 SMART
ZnF_C2H2 434 456 7.7e-6 SMART
ZnF_C2H2 462 484 1.9e-5 SMART
ZnF_C2H2 490 512 1.5e-5 SMART
ZnF_C2H2 518 540 2e-5 SMART
ZnF_C2H2 546 568 3.5e-6 SMART
ZnF_C2H2 574 597 1.3e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,548,759 D430G probably damaging Het
Adgrf1 T C 17: 43,310,689 S606P possibly damaging Het
Afap1 A G 5: 35,984,196 N475D probably damaging Het
Ahnak2 A G 12: 112,773,034 S1535P possibly damaging Het
Akt1 G T 12: 112,658,451 H194N possibly damaging Het
Api5 T A 2: 94,421,467 Q396L possibly damaging Het
Aplp2 T C 9: 31,172,007 N148S probably benign Het
Asb3 A G 11: 31,081,400 Y340C probably damaging Het
Bbox1 A T 2: 110,268,236 M332K probably damaging Het
Cabin1 A T 10: 75,743,256 S449T probably benign Het
Carns1 A G 19: 4,166,008 V725A possibly damaging Het
Ccdc129 T G 6: 55,887,033 S115A probably damaging Het
Cdkn1b A G 6: 134,921,095 K59R possibly damaging Het
Cdv3 A T 9: 103,356,340 I212K probably damaging Het
Clec14a T A 12: 58,267,646 I397F probably damaging Het
Cnnm1 A G 19: 43,495,030 I950V possibly damaging Het
Ddi2 A G 4: 141,695,423 M326T probably benign Het
Dhx30 T C 9: 110,085,035 T1065A probably benign Het
Eif3c A T 7: 126,547,502 M808K possibly damaging Het
Evi2 G T 11: 79,516,145 H201Q possibly damaging Het
Exoc4 A G 6: 33,476,056 T494A unknown Het
Fam208b A G 13: 3,599,667 V44A probably benign Het
Fam83f T A 15: 80,690,618 M242K probably damaging Het
Fat4 T C 3: 39,001,225 Y4198H probably benign Het
Fcgbp C A 7: 28,093,575 N1001K probably benign Het
Gda G T 19: 21,423,085 A164E probably damaging Het
Gm19410 T C 8: 35,812,339 V1786A possibly damaging Het
Gm45871 A G 18: 90,590,945 N82S probably benign Het
Gnas T A 2: 174,299,599 S580T unknown Het
Gprin1 G A 13: 54,738,901 P520L probably benign Het
Gramd4 C T 15: 86,130,550 R433C probably damaging Het
Ighv5-12 T A 12: 113,702,338 T47S probably benign Het
Kdm5a T A 6: 120,390,697 L451Q probably damaging Het
Kif12 T A 4: 63,165,889 R624S probably benign Het
Lepr T A 4: 101,735,654 Y155* probably null Het
Lnx2 T A 5: 147,024,566 I519F probably damaging Het
March7 T A 2: 60,229,831 S101T probably damaging Het
Miox A G 15: 89,336,582 D230G probably damaging Het
Morc2a T A 11: 3,650,381 M1K probably null Het
Mtus1 T C 8: 41,083,185 N498S probably damaging Het
Mxd1 T A 6: 86,668,572 R46W probably damaging Het
Ndufa11 G C 17: 56,717,843 A2P possibly damaging Het
Necab2 C T 8: 119,471,774 H362Y probably damaging Het
Nphp4 G A 4: 152,538,977 V703I possibly damaging Het
Nup54 T C 5: 92,434,359 N31S unknown Het
Olfr1378 T C 11: 50,969,489 L157P probably damaging Het
Olfr394 A T 11: 73,887,870 C167* probably null Het
Olfr537-ps1 T A 7: 140,538,584 S22R probably benign Het
Olfr878 A C 9: 37,918,770 T38P probably damaging Het
P2rx2 T C 5: 110,342,522 E109G possibly damaging Het
Pcdha7 T C 18: 36,974,356 S145P probably damaging Het
Pdlim5 A T 3: 142,242,768 V586E probably damaging Het
Pex5l T C 3: 33,082,055 E5G probably benign Het
Plch1 T A 3: 63,707,755 D774V probably damaging Het
Plekhg3 A T 12: 76,564,952 D335V possibly damaging Het
Pop1 A G 15: 34,530,081 H905R probably benign Het
Ppm1k T C 6: 57,515,735 T189A probably damaging Het
Pramef12 A G 4: 144,395,947 L9P probably damaging Het
Recql5 A G 11: 115,893,541 V911A probably damaging Het
Rnf145 T A 11: 44,525,003 L15* probably null Het
Rpl13a A G 7: 45,127,249 V29A probably benign Het
Rps6ka5 A G 12: 100,573,991 V491A probably benign Het
Setbp1 T C 18: 78,856,927 H1175R probably benign Het
Setd5 T C 6: 113,116,102 S372P probably damaging Het
Slc1a3 T C 15: 8,645,693 E276G probably damaging Het
Slc36a2 T C 11: 55,179,343 N136S probably benign Het
Spag1 G A 15: 36,190,537 probably null Het
Spon1 A C 7: 113,788,448 T81P probably damaging Het
Sv2b A T 7: 75,206,490 D17E probably benign Het
Tax1bp1 C T 6: 52,727,230 T65I probably damaging Het
Tenm2 C A 11: 36,024,514 K2065N probably damaging Het
Ticam2 T C 18: 46,560,591 D143G probably damaging Het
Tmem132d T C 5: 127,792,515 E585G possibly damaging Het
Tnfrsf8 C T 4: 145,293,098 probably null Het
Trim44 C T 2: 102,400,468 G73R unknown Het
Trpc3 C T 3: 36,638,564 D760N possibly damaging Het
Tspan9 T A 6: 127,965,752 M171L probably benign Het
Ugt2b37 A G 5: 87,254,673 F33S possibly damaging Het
Vav2 A T 2: 27,269,015 V734E probably damaging Het
Vmn1r214 A G 13: 23,034,338 M1V probably null Het
Vmn1r24 A T 6: 57,955,819 V238E probably damaging Het
Vmn2r107 A G 17: 20,357,000 Q420R probably damaging Het
Vmn2r31 G A 7: 7,384,086 P829S probably damaging Het
Xpo6 A G 7: 126,113,701 F703L probably benign Het
Zfp950 A T 19: 61,127,562 D2E probably damaging Het
Zfp992 T A 4: 146,466,888 S355R probably damaging Het
Zwilch A T 9: 64,156,021 F309Y probably damaging Het
Other mutations in Zfp442
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Zfp442 APN 2 150409347 nonsense probably null
IGL02566:Zfp442 APN 2 150409791 critical splice acceptor site probably null
IGL03217:Zfp442 APN 2 150409794 splice site probably benign
LCD18:Zfp442 UTSW 2 150419848 intron probably benign
PIT4812001:Zfp442 UTSW 2 150409741 nonsense probably null
R0219:Zfp442 UTSW 2 150411240 missense probably damaging 0.99
R0521:Zfp442 UTSW 2 150411249 missense possibly damaging 0.92
R1633:Zfp442 UTSW 2 150408340 nonsense probably null
R1702:Zfp442 UTSW 2 150409180 nonsense probably null
R1829:Zfp442 UTSW 2 150409063 missense probably damaging 0.99
R1868:Zfp442 UTSW 2 150408180 missense probably damaging 1.00
R1898:Zfp442 UTSW 2 150408662 missense probably damaging 1.00
R2030:Zfp442 UTSW 2 150408122 missense possibly damaging 0.58
R4676:Zfp442 UTSW 2 150409606 missense probably damaging 1.00
R4717:Zfp442 UTSW 2 150408229 missense probably damaging 1.00
R4894:Zfp442 UTSW 2 150411210 critical splice donor site probably null
R4932:Zfp442 UTSW 2 150409715 missense possibly damaging 0.53
R4963:Zfp442 UTSW 2 150408495 missense probably damaging 1.00
R5130:Zfp442 UTSW 2 150409610 missense possibly damaging 0.91
R5476:Zfp442 UTSW 2 150408159 missense probably damaging 1.00
R5986:Zfp442 UTSW 2 150408024 nonsense probably null
R6042:Zfp442 UTSW 2 150408096 missense probably damaging 0.97
R6383:Zfp442 UTSW 2 150451401 critical splice donor site probably null
R6452:Zfp442 UTSW 2 150408108 missense probably damaging 1.00
R6787:Zfp442 UTSW 2 150409579 missense possibly damaging 0.72
R6931:Zfp442 UTSW 2 150410940 critical splice donor site probably null
R7061:Zfp442 UTSW 2 150408017 missense probably benign 0.33
R7184:Zfp442 UTSW 2 150408136 missense possibly damaging 0.71
R7214:Zfp442 UTSW 2 150409281 missense probably benign 0.04
R7225:Zfp442 UTSW 2 150409005 missense probably benign 0.00
R7513:Zfp442 UTSW 2 150408756 missense unknown
R7591:Zfp442 UTSW 2 150408172 nonsense probably null
R7679:Zfp442 UTSW 2 150410997 nonsense probably null
R7768:Zfp442 UTSW 2 150408321 missense possibly damaging 0.53
R7801:Zfp442 UTSW 2 150409719 missense probably benign 0.28
R7814:Zfp442 UTSW 2 150409482 missense possibly damaging 0.92
R7848:Zfp442 UTSW 2 150411226 missense possibly damaging 0.71
R8158:Zfp442 UTSW 2 150409176 missense possibly damaging 0.83
R8192:Zfp442 UTSW 2 150408709 missense unknown
R8528:Zfp442 UTSW 2 150409042 missense probably damaging 1.00
R9110:Zfp442 UTSW 2 150408173 missense probably benign 0.30
R9269:Zfp442 UTSW 2 150409367 missense probably benign 0.19
R9371:Zfp442 UTSW 2 150408756 missense unknown
R9401:Zfp442 UTSW 2 150409695 missense possibly damaging 0.53
R9459:Zfp442 UTSW 2 150408748 missense unknown
Z1177:Zfp442 UTSW 2 150408479 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGAAATGTACAAAGGCTTCACCA -3'
(R):5'- GGGTTTCAAAGTGGTCTGCAAA -3'

Sequencing Primer
(F):5'- CACTTGAAGGGTTTACCACAGTGC -3'
(R):5'- TCAAAGTGGTCTGCAAAAGCATAAAC -3'
Posted On 2022-10-06