Incidental Mutation 'R9712:Dnah7a'
ID 730216
Institutional Source Beutler Lab
Gene Symbol Dnah7a
Ensembl Gene ENSMUSG00000096141
Gene Name dynein, axonemal, heavy chain 7A
Synonyms Dnahc7, LOC381341, Dnahc7a
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.147) question?
Stock # R9712 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 53436165-53745943 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 53598299 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 1412 (V1412E)
Ref Sequence ENSEMBL: ENSMUSP00000092571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094964]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000094964
AA Change: V1412E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000092571
Gene: ENSMUSG00000096141
AA Change: V1412E

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
coiled coil region 504 537 N/A INTRINSIC
Pfam:DHC_N2 756 1165 3.1e-149 PFAM
AAA 1320 1459 2.46e-1 SMART
Blast:AAA 1601 1879 1e-87 BLAST
AAA 1968 2116 5.39e-2 SMART
Pfam:AAA_8 2303 2574 6.9e-75 PFAM
Pfam:MT 2586 2936 2.1e-55 PFAM
Pfam:AAA_9 2957 3182 1.3e-98 PFAM
Pfam:Dynein_heavy 3318 4020 2.3e-287 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik A T 19: 3,765,784 (GRCm39) M20L probably benign Het
Aadacl4fm1 C T 4: 144,255,354 (GRCm39) A258V probably benign Het
Abca8b T A 11: 109,833,163 (GRCm39) D1241V probably benign Het
Adam20 G A 8: 41,248,490 (GRCm39) R200H probably benign Het
Adcy10 T C 1: 165,340,681 (GRCm39) F229L probably damaging Het
Adsl A T 15: 80,839,840 (GRCm39) N126I probably benign Het
Ahnak GATCTCTAT GAT 19: 8,984,393 (GRCm39) probably benign Het
Ahnak AGATCTC A 19: 8,984,392 (GRCm39) probably benign Het
Aktip G A 8: 91,856,355 (GRCm39) P41S probably damaging Het
Alkbh3 C A 2: 93,811,318 (GRCm39) R258L probably damaging Het
Arfgap3 A G 15: 83,197,734 (GRCm39) Y341H probably benign Het
Arhgef26 C T 3: 62,331,034 (GRCm39) L583F probably damaging Het
Arhgef40 T C 14: 52,226,415 (GRCm39) I153T probably damaging Het
Atp1a1 T C 3: 101,498,757 (GRCm39) S179G probably benign Het
Bok T C 1: 93,614,229 (GRCm39) S21P probably damaging Het
Ccdc136 A G 6: 29,417,441 (GRCm39) E754G probably benign Het
Cers3 A G 7: 66,423,378 (GRCm39) K108E probably benign Het
Cmya5 T C 13: 93,201,881 (GRCm39) probably null Het
Col19a1 T C 1: 24,367,148 (GRCm39) E478G possibly damaging Het
Colec10 T A 15: 54,323,180 (GRCm39) S134R possibly damaging Het
Ctnnb1 A T 9: 120,784,895 (GRCm39) I514F probably damaging Het
Cux1 C T 5: 136,338,673 (GRCm39) E664K probably benign Het
Dars1 T C 1: 128,333,199 (GRCm39) Q75R probably benign Het
Disp1 T A 1: 182,917,379 (GRCm39) S16C probably damaging Het
Ect2l C T 10: 18,044,182 (GRCm39) V226I probably benign Het
Ep400 T A 5: 110,904,509 (GRCm39) H30L unknown Het
Ephx4 A G 5: 107,567,647 (GRCm39) I202V probably benign Het
Exoc3 A T 13: 74,341,027 (GRCm39) F259Y probably damaging Het
Ezr T C 17: 7,020,394 (GRCm39) E229G probably damaging Het
Fat1 A T 8: 45,470,417 (GRCm39) I1472L probably benign Het
Fsd1l T G 4: 53,679,972 (GRCm39) D223E probably benign Het
Gata6 A T 18: 11,059,064 (GRCm39) D377V possibly damaging Het
Gm12185 A T 11: 48,798,216 (GRCm39) M759K probably benign Het
Gm9922 C T 14: 101,966,893 (GRCm39) A120T unknown Het
Hectd4 A T 5: 121,448,744 (GRCm39) Y364F probably benign Het
Hnrnph1 A G 11: 50,276,696 (GRCm39) S465G unknown Het
Ifi204 T C 1: 173,576,924 (GRCm39) Y559C probably damaging Het
Ift88 T C 14: 57,718,853 (GRCm39) S613P probably damaging Het
Kif21a G C 15: 90,869,528 (GRCm39) A441G probably damaging Het
Kif21a G T 15: 90,879,715 (GRCm39) T191K probably benign Het
Lrit1 T A 14: 36,782,084 (GRCm39) C252* probably null Het
Ncbp1 T A 4: 46,144,837 (GRCm39) D29E probably benign Het
Nlrp10 A T 7: 108,524,735 (GRCm39) D248E probably damaging Het
Nphp4 T G 4: 152,631,521 (GRCm39) V807G probably benign Het
Nsd1 T C 13: 55,393,856 (GRCm39) S589P possibly damaging Het
Oas1b T A 5: 120,952,550 (GRCm39) N80K probably damaging Het
Oprk1 T A 1: 5,669,096 (GRCm39) C181S probably damaging Het
Oprl1 T A 2: 181,360,212 (GRCm39) N89K probably damaging Het
Or5w12 A T 2: 87,502,105 (GRCm39) I202N probably benign Het
Or8k53 G A 2: 86,177,583 (GRCm39) H176Y probably benign Het
Pdcd11 A G 19: 47,117,741 (GRCm39) K1697E probably damaging Het
Pdp1 G A 4: 11,961,607 (GRCm39) H254Y probably benign Het
Pds5b A T 5: 150,729,128 (GRCm39) D1419V possibly damaging Het
Per1 G T 11: 68,991,475 (GRCm39) G3V probably benign Het
Pex16 C A 2: 92,206,988 (GRCm39) N55K probably damaging Het
Phldb2 C A 16: 45,595,340 (GRCm39) L862F probably benign Het
Pld5 T A 1: 175,791,572 (GRCm39) D478V probably benign Het
Pms2 T C 5: 143,851,614 (GRCm39) I177T probably damaging Het
Pou1f1 A T 16: 65,326,758 (GRCm39) E119D probably benign Het
Ppp2r1a A C 17: 21,179,058 (GRCm39) E295A probably damaging Het
Qrfprl A G 6: 65,433,124 (GRCm39) I315V probably benign Het
Rad51ap2 A T 12: 11,507,593 (GRCm39) N505I possibly damaging Het
Rasal3 A C 17: 32,615,536 (GRCm39) V434G probably damaging Het
Rasgrf2 C T 13: 92,136,092 (GRCm39) V6M Het
Rwdd1 A T 10: 33,877,152 (GRCm39) D197E Het
Scn11a A T 9: 119,619,076 (GRCm39) C755* probably null Het
Skil T C 3: 31,171,009 (GRCm39) S443P probably benign Het
Slc12a6 T C 2: 112,186,817 (GRCm39) C939R probably damaging Het
Slc25a36 A G 9: 96,961,230 (GRCm39) S269P probably benign Het
Srrm4 T A 5: 116,620,452 (GRCm39) H92L unknown Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Tbc1d4 A T 14: 101,744,846 (GRCm39) V260E probably benign Het
Tbc1d8 T C 1: 39,424,313 (GRCm39) N593D probably damaging Het
Trex1 C A 9: 108,887,805 (GRCm39) R62L probably damaging Het
Trpm3 A T 19: 22,692,716 (GRCm39) D269V possibly damaging Het
Trpv4 G T 5: 114,771,211 (GRCm39) Y439* probably null Het
Ttn G A 2: 76,564,592 (GRCm39) T28515I probably damaging Het
Ucn2 G A 9: 108,815,571 (GRCm39) G111D probably damaging Het
Uhrf2 A G 19: 30,033,881 (GRCm39) I212V possibly damaging Het
Usp24 T A 4: 106,204,564 (GRCm39) M261K probably benign Het
Vmn1r235 A T 17: 21,481,960 (GRCm39) D95V probably benign Het
Vwf G A 6: 125,601,536 (GRCm39) R826Q Het
Zfp1002 C T 2: 150,096,496 (GRCm39) R311Q probably benign Het
Zfp28 T C 7: 6,396,878 (GRCm39) C438R probably damaging Het
Other mutations in Dnah7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Dnah7a APN 1 53,458,843 (GRCm39) missense probably damaging 0.99
IGL00510:Dnah7a APN 1 53,540,701 (GRCm39) missense probably damaging 1.00
IGL00545:Dnah7a APN 1 53,496,905 (GRCm39) missense possibly damaging 0.87
IGL01320:Dnah7a APN 1 53,473,205 (GRCm39) missense probably benign 0.32
IGL01322:Dnah7a APN 1 53,473,205 (GRCm39) missense probably benign 0.32
IGL01357:Dnah7a APN 1 53,701,540 (GRCm39) missense probably benign
IGL01417:Dnah7a APN 1 53,623,759 (GRCm39) missense probably benign 0.01
IGL01508:Dnah7a APN 1 53,666,231 (GRCm39) missense probably benign 0.00
IGL01511:Dnah7a APN 1 53,458,754 (GRCm39) missense probably damaging 1.00
IGL01545:Dnah7a APN 1 53,557,941 (GRCm39) missense probably benign
IGL01575:Dnah7a APN 1 53,466,979 (GRCm39) splice site probably benign
IGL01667:Dnah7a APN 1 53,586,451 (GRCm39) missense probably damaging 1.00
IGL01712:Dnah7a APN 1 53,462,429 (GRCm39) missense probably benign 0.23
IGL01824:Dnah7a APN 1 53,543,429 (GRCm39) missense probably benign
IGL01829:Dnah7a APN 1 53,657,227 (GRCm39) missense possibly damaging 0.64
IGL01861:Dnah7a APN 1 53,623,608 (GRCm39) splice site probably benign
IGL01861:Dnah7a APN 1 53,679,508 (GRCm39) missense probably benign 0.01
IGL01984:Dnah7a APN 1 53,741,174 (GRCm39) splice site probably null
IGL02056:Dnah7a APN 1 53,543,501 (GRCm39) missense probably benign 0.17
IGL02069:Dnah7a APN 1 53,601,053 (GRCm39) splice site probably benign
IGL02072:Dnah7a APN 1 53,644,986 (GRCm39) missense probably damaging 1.00
IGL02110:Dnah7a APN 1 53,450,739 (GRCm39) missense possibly damaging 0.52
IGL02120:Dnah7a APN 1 53,534,876 (GRCm39) missense possibly damaging 0.46
IGL02128:Dnah7a APN 1 53,476,672 (GRCm39) missense probably damaging 1.00
IGL02135:Dnah7a APN 1 53,662,632 (GRCm39) missense probably benign 0.01
IGL02151:Dnah7a APN 1 53,512,023 (GRCm39) missense probably benign 0.08
IGL02156:Dnah7a APN 1 53,458,882 (GRCm39) missense probably benign 0.27
IGL02270:Dnah7a APN 1 53,512,052 (GRCm39) missense possibly damaging 0.93
IGL02282:Dnah7a APN 1 53,682,669 (GRCm39) missense possibly damaging 0.93
IGL02328:Dnah7a APN 1 53,564,096 (GRCm39) critical splice donor site probably null
IGL02370:Dnah7a APN 1 53,674,556 (GRCm39) missense probably benign 0.00
IGL02420:Dnah7a APN 1 53,725,702 (GRCm39) missense probably benign
IGL02458:Dnah7a APN 1 53,657,487 (GRCm39) nonsense probably null
IGL02489:Dnah7a APN 1 53,686,481 (GRCm39) missense possibly damaging 0.94
IGL02554:Dnah7a APN 1 53,657,205 (GRCm39) missense possibly damaging 0.93
IGL02578:Dnah7a APN 1 53,472,074 (GRCm39) missense probably benign 0.00
IGL02646:Dnah7a APN 1 53,564,194 (GRCm39) missense probably damaging 0.99
IGL02675:Dnah7a APN 1 53,543,183 (GRCm39) missense possibly damaging 0.96
IGL02688:Dnah7a APN 1 53,483,631 (GRCm39) missense possibly damaging 0.93
IGL02858:Dnah7a APN 1 53,512,118 (GRCm39) splice site probably benign
IGL02874:Dnah7a APN 1 53,644,973 (GRCm39) missense possibly damaging 0.70
IGL02887:Dnah7a APN 1 53,561,519 (GRCm39) missense possibly damaging 0.46
IGL02894:Dnah7a APN 1 53,616,487 (GRCm39) missense probably benign 0.27
IGL02926:Dnah7a APN 1 53,535,109 (GRCm39) missense possibly damaging 0.64
IGL03113:Dnah7a APN 1 53,472,163 (GRCm39) missense possibly damaging 0.64
IGL03156:Dnah7a APN 1 53,644,983 (GRCm39) missense probably damaging 0.97
IGL03195:Dnah7a APN 1 53,458,766 (GRCm39) missense probably damaging 1.00
IGL03209:Dnah7a APN 1 53,725,773 (GRCm39) splice site probably benign
IGL03214:Dnah7a APN 1 53,561,368 (GRCm39) critical splice donor site probably null
IGL03242:Dnah7a APN 1 53,659,882 (GRCm39) missense probably benign 0.02
IGL03251:Dnah7a APN 1 53,686,433 (GRCm39) missense probably benign
IGL03265:Dnah7a APN 1 53,568,007 (GRCm39) missense probably benign
IGL03277:Dnah7a APN 1 53,669,481 (GRCm39) missense probably benign 0.00
IGL03278:Dnah7a APN 1 53,536,124 (GRCm39) missense probably benign 0.07
IGL03356:Dnah7a APN 1 53,543,093 (GRCm39) missense probably benign 0.01
PIT4378001:Dnah7a UTSW 1 53,570,362 (GRCm39) missense probably damaging 0.99
R0046:Dnah7a UTSW 1 53,496,033 (GRCm39) splice site probably null
R0051:Dnah7a UTSW 1 53,560,245 (GRCm39) splice site probably benign
R0082:Dnah7a UTSW 1 53,557,867 (GRCm39) missense probably damaging 1.00
R0111:Dnah7a UTSW 1 53,507,843 (GRCm39) missense probably benign 0.03
R0122:Dnah7a UTSW 1 53,436,301 (GRCm39) missense probably damaging 1.00
R0245:Dnah7a UTSW 1 53,540,685 (GRCm39) missense probably damaging 1.00
R0278:Dnah7a UTSW 1 53,543,305 (GRCm39) missense probably benign 0.00
R0309:Dnah7a UTSW 1 53,444,849 (GRCm39) missense probably damaging 0.97
R0334:Dnah7a UTSW 1 53,472,213 (GRCm39) missense possibly damaging 0.61
R0392:Dnah7a UTSW 1 53,543,357 (GRCm39) missense probably damaging 0.97
R0452:Dnah7a UTSW 1 53,644,978 (GRCm39) missense probably benign 0.00
R0511:Dnah7a UTSW 1 53,536,285 (GRCm39) missense probably benign
R0576:Dnah7a UTSW 1 53,675,246 (GRCm39) missense probably benign 0.12
R0592:Dnah7a UTSW 1 53,495,771 (GRCm39) missense possibly damaging 0.91
R0628:Dnah7a UTSW 1 53,536,264 (GRCm39) missense probably benign 0.18
R0689:Dnah7a UTSW 1 53,659,840 (GRCm39) nonsense probably null
R0735:Dnah7a UTSW 1 53,583,670 (GRCm39) missense possibly damaging 0.70
R0800:Dnah7a UTSW 1 53,604,855 (GRCm39) missense probably damaging 1.00
R0829:Dnah7a UTSW 1 53,543,238 (GRCm39) missense probably benign 0.07
R0842:Dnah7a UTSW 1 53,540,833 (GRCm39) missense possibly damaging 0.88
R0879:Dnah7a UTSW 1 53,467,019 (GRCm39) missense possibly damaging 0.85
R1331:Dnah7a UTSW 1 53,507,828 (GRCm39) missense probably damaging 0.99
R1418:Dnah7a UTSW 1 53,686,395 (GRCm39) splice site probably benign
R1421:Dnah7a UTSW 1 53,580,032 (GRCm39) splice site probably benign
R1445:Dnah7a UTSW 1 53,567,956 (GRCm39) missense probably benign 0.02
R1473:Dnah7a UTSW 1 53,535,173 (GRCm39) missense probably benign 0.00
R1538:Dnah7a UTSW 1 53,535,148 (GRCm39) missense possibly damaging 0.71
R1742:Dnah7a UTSW 1 53,495,843 (GRCm39) missense probably benign 0.39
R1754:Dnah7a UTSW 1 53,601,059 (GRCm39) critical splice donor site probably null
R1754:Dnah7a UTSW 1 53,543,344 (GRCm39) missense probably benign 0.18
R1773:Dnah7a UTSW 1 53,472,046 (GRCm39) splice site probably null
R1779:Dnah7a UTSW 1 53,616,382 (GRCm39) missense probably benign
R1816:Dnah7a UTSW 1 53,670,901 (GRCm39) splice site probably benign
R1817:Dnah7a UTSW 1 53,598,307 (GRCm39) missense probably benign
R1818:Dnah7a UTSW 1 53,598,307 (GRCm39) missense probably benign
R1819:Dnah7a UTSW 1 53,598,307 (GRCm39) missense probably benign
R1873:Dnah7a UTSW 1 53,495,691 (GRCm39) splice site probably benign
R1875:Dnah7a UTSW 1 53,495,691 (GRCm39) splice site probably benign
R1884:Dnah7a UTSW 1 53,580,159 (GRCm39) missense probably damaging 0.99
R1902:Dnah7a UTSW 1 53,574,637 (GRCm39) missense probably damaging 1.00
R1903:Dnah7a UTSW 1 53,574,637 (GRCm39) missense probably damaging 1.00
R1908:Dnah7a UTSW 1 53,670,721 (GRCm39) missense probably benign
R1959:Dnah7a UTSW 1 53,724,142 (GRCm39) missense probably benign 0.00
R1960:Dnah7a UTSW 1 53,724,142 (GRCm39) missense probably benign 0.00
R1985:Dnah7a UTSW 1 53,543,093 (GRCm39) missense probably benign 0.01
R1992:Dnah7a UTSW 1 53,621,835 (GRCm39) missense possibly damaging 0.91
R2037:Dnah7a UTSW 1 53,621,741 (GRCm39) missense probably benign 0.00
R2074:Dnah7a UTSW 1 53,496,855 (GRCm39) missense probably benign 0.45
R2076:Dnah7a UTSW 1 53,542,968 (GRCm39) missense probably benign 0.01
R2124:Dnah7a UTSW 1 53,536,101 (GRCm39) missense possibly damaging 0.58
R2191:Dnah7a UTSW 1 53,645,034 (GRCm39) missense possibly damaging 0.54
R2211:Dnah7a UTSW 1 53,518,932 (GRCm39) missense probably benign 0.21
R2220:Dnah7a UTSW 1 53,560,333 (GRCm39) missense probably benign
R2355:Dnah7a UTSW 1 53,621,661 (GRCm39) missense probably benign 0.00
R2495:Dnah7a UTSW 1 53,645,040 (GRCm39) missense probably damaging 1.00
R2901:Dnah7a UTSW 1 53,467,031 (GRCm39) missense probably damaging 0.99
R2911:Dnah7a UTSW 1 53,466,983 (GRCm39) critical splice donor site probably null
R2993:Dnah7a UTSW 1 53,542,713 (GRCm39) missense probably damaging 1.00
R3522:Dnah7a UTSW 1 53,657,275 (GRCm39) missense probably damaging 1.00
R3683:Dnah7a UTSW 1 53,483,675 (GRCm39) missense probably benign
R3723:Dnah7a UTSW 1 53,486,505 (GRCm39) missense probably benign 0.04
R3847:Dnah7a UTSW 1 53,540,815 (GRCm39) missense probably benign 0.01
R4002:Dnah7a UTSW 1 53,670,840 (GRCm39) missense probably benign
R4009:Dnah7a UTSW 1 53,564,164 (GRCm39) missense probably damaging 1.00
R4063:Dnah7a UTSW 1 53,464,376 (GRCm39) missense probably benign
R4193:Dnah7a UTSW 1 53,486,493 (GRCm39) missense probably benign 0.00
R4236:Dnah7a UTSW 1 53,486,524 (GRCm39) missense probably benign 0.00
R4399:Dnah7a UTSW 1 53,557,886 (GRCm39) missense probably damaging 1.00
R4469:Dnah7a UTSW 1 53,483,685 (GRCm39) missense probably benign 0.01
R4494:Dnah7a UTSW 1 53,488,197 (GRCm39) missense probably benign 0.01
R4569:Dnah7a UTSW 1 53,450,818 (GRCm39) missense probably benign 0.01
R4609:Dnah7a UTSW 1 53,495,816 (GRCm39) missense possibly damaging 0.80
R4632:Dnah7a UTSW 1 53,467,110 (GRCm39) missense probably damaging 0.97
R4703:Dnah7a UTSW 1 53,486,476 (GRCm39) critical splice donor site probably null
R4781:Dnah7a UTSW 1 53,464,367 (GRCm39) missense probably benign 0.28
R4854:Dnah7a UTSW 1 53,745,888 (GRCm39) utr 5 prime probably benign
R4932:Dnah7a UTSW 1 53,542,737 (GRCm39) missense possibly damaging 0.90
R4976:Dnah7a UTSW 1 53,737,851 (GRCm39) missense probably benign
R5000:Dnah7a UTSW 1 53,606,201 (GRCm39) missense probably damaging 1.00
R5023:Dnah7a UTSW 1 53,686,407 (GRCm39) nonsense probably null
R5026:Dnah7a UTSW 1 53,701,657 (GRCm39) missense probably damaging 0.99
R5050:Dnah7a UTSW 1 53,536,255 (GRCm39) missense probably benign 0.01
R5119:Dnah7a UTSW 1 53,737,851 (GRCm39) missense probably benign
R5151:Dnah7a UTSW 1 53,659,929 (GRCm39) missense probably benign 0.00
R5155:Dnah7a UTSW 1 53,682,654 (GRCm39) missense probably benign 0.01
R5180:Dnah7a UTSW 1 53,462,446 (GRCm39) missense probably damaging 0.97
R5228:Dnah7a UTSW 1 53,476,768 (GRCm39) critical splice acceptor site probably null
R5237:Dnah7a UTSW 1 53,486,690 (GRCm39) splice site probably null
R5267:Dnah7a UTSW 1 53,518,851 (GRCm39) missense probably damaging 1.00
R5334:Dnah7a UTSW 1 53,542,805 (GRCm39) missense probably benign 0.00
R5358:Dnah7a UTSW 1 53,586,331 (GRCm39) missense probably damaging 1.00
R5401:Dnah7a UTSW 1 53,670,812 (GRCm39) missense probably benign 0.01
R5412:Dnah7a UTSW 1 53,674,503 (GRCm39) missense probably benign
R5496:Dnah7a UTSW 1 53,496,927 (GRCm39) missense probably benign
R5531:Dnah7a UTSW 1 53,458,907 (GRCm39) missense possibly damaging 0.50
R5536:Dnah7a UTSW 1 53,464,412 (GRCm39) missense probably benign
R5543:Dnah7a UTSW 1 53,543,228 (GRCm39) missense probably damaging 1.00
R5597:Dnah7a UTSW 1 53,573,611 (GRCm39) missense probably benign 0.00
R5609:Dnah7a UTSW 1 53,621,753 (GRCm39) missense probably benign 0.03
R5643:Dnah7a UTSW 1 53,444,866 (GRCm39) missense probably benign
R5644:Dnah7a UTSW 1 53,580,138 (GRCm39) missense probably benign 0.33
R5689:Dnah7a UTSW 1 53,444,857 (GRCm39) missense possibly damaging 0.87
R5715:Dnah7a UTSW 1 53,452,937 (GRCm39) missense probably damaging 1.00
R5780:Dnah7a UTSW 1 53,522,478 (GRCm39) missense probably benign 0.03
R5893:Dnah7a UTSW 1 53,496,944 (GRCm39) missense possibly damaging 0.66
R5946:Dnah7a UTSW 1 53,598,467 (GRCm39) missense probably damaging 1.00
R5995:Dnah7a UTSW 1 53,659,829 (GRCm39) missense probably benign 0.00
R6102:Dnah7a UTSW 1 53,598,299 (GRCm39) missense probably benign 0.00
R6108:Dnah7a UTSW 1 53,496,004 (GRCm39) missense probably damaging 1.00
R6133:Dnah7a UTSW 1 53,458,814 (GRCm39) missense probably benign 0.05
R6168:Dnah7a UTSW 1 53,450,727 (GRCm39) missense probably damaging 1.00
R6175:Dnah7a UTSW 1 53,472,181 (GRCm39) missense probably damaging 1.00
R6211:Dnah7a UTSW 1 53,458,795 (GRCm39) missense probably damaging 0.99
R6282:Dnah7a UTSW 1 53,542,760 (GRCm39) missense probably damaging 1.00
R6329:Dnah7a UTSW 1 53,580,273 (GRCm39) missense probably damaging 1.00
R6344:Dnah7a UTSW 1 53,436,349 (GRCm39) missense probably benign 0.02
R6530:Dnah7a UTSW 1 53,542,856 (GRCm39) missense probably benign 0.04
R6574:Dnah7a UTSW 1 53,495,693 (GRCm39) critical splice donor site probably null
R6608:Dnah7a UTSW 1 53,564,277 (GRCm39) missense probably benign
R6625:Dnah7a UTSW 1 53,604,916 (GRCm39) missense probably benign 0.05
R6661:Dnah7a UTSW 1 53,662,609 (GRCm39) missense probably benign 0.00
R6681:Dnah7a UTSW 1 53,560,385 (GRCm39) critical splice acceptor site probably null
R6747:Dnah7a UTSW 1 53,675,221 (GRCm39) missense probably benign 0.01
R6774:Dnah7a UTSW 1 53,737,810 (GRCm39) missense probably benign
R6823:Dnah7a UTSW 1 53,495,863 (GRCm39) missense probably benign
R6900:Dnah7a UTSW 1 53,701,510 (GRCm39) missense probably damaging 0.97
R6940:Dnah7a UTSW 1 53,670,836 (GRCm39) missense probably benign 0.09
R6956:Dnah7a UTSW 1 53,616,446 (GRCm39) missense probably benign 0.02
R6978:Dnah7a UTSW 1 53,701,526 (GRCm39) missense probably null
R6988:Dnah7a UTSW 1 53,621,784 (GRCm39) missense possibly damaging 0.62
R7026:Dnah7a UTSW 1 53,543,448 (GRCm39) missense probably benign
R7027:Dnah7a UTSW 1 53,670,665 (GRCm39) missense probably benign 0.01
R7033:Dnah7a UTSW 1 53,518,820 (GRCm39) missense probably damaging 1.00
R7072:Dnah7a UTSW 1 53,458,912 (GRCm39) missense probably benign 0.00
R7096:Dnah7a UTSW 1 53,522,599 (GRCm39) missense possibly damaging 0.90
R7142:Dnah7a UTSW 1 53,452,927 (GRCm39) nonsense probably null
R7144:Dnah7a UTSW 1 53,737,867 (GRCm39) splice site probably null
R7167:Dnah7a UTSW 1 53,542,935 (GRCm39) missense probably benign 0.00
R7182:Dnah7a UTSW 1 53,659,620 (GRCm39) splice site probably null
R7196:Dnah7a UTSW 1 53,724,000 (GRCm39) missense probably benign 0.00
R7206:Dnah7a UTSW 1 53,737,792 (GRCm39) nonsense probably null
R7215:Dnah7a UTSW 1 53,657,509 (GRCm39) missense probably damaging 0.99
R7224:Dnah7a UTSW 1 53,436,420 (GRCm39) missense probably benign 0.00
R7264:Dnah7a UTSW 1 53,557,973 (GRCm39) missense probably benign
R7282:Dnah7a UTSW 1 53,724,059 (GRCm39) critical splice acceptor site probably null
R7365:Dnah7a UTSW 1 53,536,297 (GRCm39) missense probably benign
R7392:Dnah7a UTSW 1 53,540,820 (GRCm39) missense probably benign 0.00
R7454:Dnah7a UTSW 1 53,557,923 (GRCm39) missense probably benign
R7471:Dnah7a UTSW 1 53,458,858 (GRCm39) missense probably damaging 1.00
R7547:Dnah7a UTSW 1 53,702,996 (GRCm39) missense probably benign 0.00
R7554:Dnah7a UTSW 1 53,567,857 (GRCm39) missense possibly damaging 0.87
R7655:Dnah7a UTSW 1 53,535,164 (GRCm39) missense possibly damaging 0.50
R7656:Dnah7a UTSW 1 53,535,164 (GRCm39) missense possibly damaging 0.50
R7666:Dnah7a UTSW 1 53,586,456 (GRCm39) missense probably benign 0.00
R7721:Dnah7a UTSW 1 53,670,842 (GRCm39) missense probably benign
R7813:Dnah7a UTSW 1 53,657,245 (GRCm39) missense probably benign
R7839:Dnah7a UTSW 1 53,606,334 (GRCm39) missense probably benign 0.08
R7959:Dnah7a UTSW 1 53,682,621 (GRCm39) missense probably benign 0.00
R7984:Dnah7a UTSW 1 53,543,377 (GRCm39) missense probably benign 0.01
R7985:Dnah7a UTSW 1 53,557,886 (GRCm39) missense probably damaging 1.00
R8116:Dnah7a UTSW 1 53,543,049 (GRCm39) missense probably benign
R8140:Dnah7a UTSW 1 53,540,748 (GRCm39) missense probably benign 0.02
R8184:Dnah7a UTSW 1 53,666,194 (GRCm39) missense probably benign 0.03
R8339:Dnah7a UTSW 1 53,724,178 (GRCm39) missense probably benign
R8352:Dnah7a UTSW 1 53,466,986 (GRCm39) missense probably null 0.01
R8423:Dnah7a UTSW 1 53,512,063 (GRCm39) missense possibly damaging 0.84
R8428:Dnah7a UTSW 1 53,512,112 (GRCm39) missense probably damaging 0.98
R8432:Dnah7a UTSW 1 53,657,195 (GRCm39) missense possibly damaging 0.46
R8452:Dnah7a UTSW 1 53,466,986 (GRCm39) missense probably null 0.01
R8458:Dnah7a UTSW 1 53,657,142 (GRCm39) missense probably benign 0.01
R8493:Dnah7a UTSW 1 53,512,067 (GRCm39) missense probably damaging 1.00
R8498:Dnah7a UTSW 1 53,657,139 (GRCm39) missense probably benign 0.01
R8502:Dnah7a UTSW 1 53,679,520 (GRCm39) missense probably benign 0.39
R8692:Dnah7a UTSW 1 53,472,175 (GRCm39) missense probably benign 0.00
R8700:Dnah7a UTSW 1 53,535,088 (GRCm39) missense possibly damaging 0.62
R8709:Dnah7a UTSW 1 53,674,476 (GRCm39) missense probably benign
R8856:Dnah7a UTSW 1 53,462,422 (GRCm39) missense probably damaging 1.00
R8875:Dnah7a UTSW 1 53,682,682 (GRCm39) missense probably benign 0.10
R8967:Dnah7a UTSW 1 53,682,594 (GRCm39) splice site probably benign
R8982:Dnah7a UTSW 1 53,570,301 (GRCm39) missense probably benign
R8984:Dnah7a UTSW 1 53,674,436 (GRCm39) nonsense probably null
R8993:Dnah7a UTSW 1 53,543,262 (GRCm39) missense probably damaging 1.00
R9008:Dnah7a UTSW 1 53,701,501 (GRCm39) missense possibly damaging 0.81
R9022:Dnah7a UTSW 1 53,512,116 (GRCm39) critical splice acceptor site probably null
R9028:Dnah7a UTSW 1 53,560,297 (GRCm39) missense probably benign 0.00
R9077:Dnah7a UTSW 1 53,741,218 (GRCm39) missense unknown
R9167:Dnah7a UTSW 1 53,657,370 (GRCm39) missense probably benign 0.00
R9206:Dnah7a UTSW 1 53,540,757 (GRCm39) missense probably benign 0.11
R9226:Dnah7a UTSW 1 53,560,326 (GRCm39) missense possibly damaging 0.93
R9251:Dnah7a UTSW 1 53,621,671 (GRCm39) missense probably damaging 1.00
R9265:Dnah7a UTSW 1 53,674,505 (GRCm39) missense probably benign
R9350:Dnah7a UTSW 1 53,436,307 (GRCm39) missense probably benign 0.19
R9369:Dnah7a UTSW 1 53,564,222 (GRCm39) missense possibly damaging 0.72
R9369:Dnah7a UTSW 1 53,543,421 (GRCm39) missense probably benign
R9372:Dnah7a UTSW 1 53,543,474 (GRCm39) missense probably benign
R9376:Dnah7a UTSW 1 53,568,058 (GRCm39) critical splice acceptor site probably null
R9378:Dnah7a UTSW 1 53,621,776 (GRCm39) missense probably benign 0.32
R9401:Dnah7a UTSW 1 53,568,026 (GRCm39) missense probably benign 0.01
R9431:Dnah7a UTSW 1 53,450,812 (GRCm39) missense possibly damaging 0.90
R9529:Dnah7a UTSW 1 53,561,495 (GRCm39) missense probably damaging 1.00
R9701:Dnah7a UTSW 1 53,561,388 (GRCm39) missense probably benign 0.03
R9799:Dnah7a UTSW 1 53,557,968 (GRCm39) missense probably benign 0.00
R9802:Dnah7a UTSW 1 53,561,388 (GRCm39) missense probably benign 0.03
X0027:Dnah7a UTSW 1 53,512,089 (GRCm39) missense probably damaging 1.00
Z1088:Dnah7a UTSW 1 53,507,802 (GRCm39) missense probably damaging 1.00
Z1176:Dnah7a UTSW 1 53,522,622 (GRCm39) missense probably damaging 1.00
Z1176:Dnah7a UTSW 1 53,458,858 (GRCm39) missense probably damaging 1.00
Z1177:Dnah7a UTSW 1 53,598,261 (GRCm39) missense probably benign 0.21
Z1177:Dnah7a UTSW 1 53,450,815 (GRCm39) missense probably benign 0.08
Z1177:Dnah7a UTSW 1 53,682,616 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGTCAGATTTGAGCCCTTTAAATGC -3'
(R):5'- TGGTTGCTCAACAAATCCTTACC -3'

Sequencing Primer
(F):5'- AAGAGATAGTGGGTATTTTTCCTGTC -3'
(R):5'- CCATCCAGAGAGGTAATGAGCTTGTC -3'
Posted On 2022-10-06