Incidental Mutation 'R9712:Adcy10'
ID 730219
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Name adenylate cyclase 10
Synonyms sAC, Sacy, soluble adenylyl cyclase
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock # R9712 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 165485183-165576774 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 165513112 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 229 (F229L)
Ref Sequence ENSEMBL: ENSMUSP00000027852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
AlphaFold Q8C0T9
Predicted Effect probably damaging
Transcript: ENSMUST00000027852
AA Change: F229L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: F229L

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111439
AA Change: F229L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: F229L

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111440
AA Change: F229L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: F229L

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148550
AA Change: F229L

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567
AA Change: F229L

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155216
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193149
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik A T 19: 3,715,784 M20L probably benign Het
9430007A20Rik C T 4: 144,528,784 A258V probably benign Het
Abca8b T A 11: 109,942,337 D1241V probably benign Het
Adam20 G A 8: 40,795,453 R200H probably benign Het
Adsl A T 15: 80,955,639 N126I probably benign Het
Ahnak AGATCTC A 19: 9,007,028 probably benign Het
Ahnak GATCTCTAT GAT 19: 9,007,029 probably benign Het
Aktip G A 8: 91,129,727 P41S probably damaging Het
Alkbh3 C A 2: 93,980,973 R258L probably damaging Het
Arfgap3 A G 15: 83,313,533 Y341H probably benign Het
Arhgef26 C T 3: 62,423,613 L583F probably damaging Het
Arhgef40 T C 14: 51,988,958 I153T probably damaging Het
Atp1a1 T C 3: 101,591,441 S179G probably benign Het
Bok T C 1: 93,686,507 S21P probably damaging Het
C130060K24Rik A G 6: 65,456,140 I315V probably benign Het
Ccdc136 A G 6: 29,417,442 E754G probably benign Het
Cers3 A G 7: 66,773,630 K108E probably benign Het
Cmya5 T C 13: 93,065,373 probably null Het
Col19a1 T C 1: 24,328,067 E478G possibly damaging Het
Colec10 T A 15: 54,459,784 S134R possibly damaging Het
Ctnnb1 A T 9: 120,955,829 I514F probably damaging Het
Cux1 C T 5: 136,309,819 E664K probably benign Het
Dars T C 1: 128,405,462 Q75R probably benign Het
Disp1 T A 1: 183,135,815 S16C probably damaging Het
Dnah7a A T 1: 53,559,140 V1412E probably benign Het
Ect2l C T 10: 18,168,434 V226I probably benign Het
Ep400 T A 5: 110,756,643 H30L unknown Het
Ephx4 A G 5: 107,419,781 I202V probably benign Het
Exoc3 A T 13: 74,192,908 F259Y probably damaging Het
Ezr T C 17: 6,752,995 E229G probably damaging Het
Fat1 A T 8: 45,017,380 I1472L probably benign Het
Fsd1l T G 4: 53,679,972 D223E probably benign Het
Gata6 A T 18: 11,059,064 D377V possibly damaging Het
Gm12185 A T 11: 48,907,389 M759K probably benign Het
Gm21994 C T 2: 150,254,576 R311Q probably benign Het
Gm9922 C T 14: 101,729,457 A120T unknown Het
Hectd4 A T 5: 121,310,681 Y364F probably benign Het
Hnrnph1 A G 11: 50,385,869 S465G unknown Het
Ifi204 T C 1: 173,749,358 Y559C probably damaging Het
Ift88 T C 14: 57,481,396 S613P probably damaging Het
Kif21a G C 15: 90,985,325 A441G probably damaging Het
Kif21a G T 15: 90,995,512 T191K probably benign Het
Lrit1 T A 14: 37,060,127 C252* probably null Het
Ncbp1 T A 4: 46,144,837 D29E probably benign Het
Nlrp10 A T 7: 108,925,528 D248E probably damaging Het
Nphp4 T G 4: 152,547,064 V807G probably benign Het
Nsd1 T C 13: 55,246,043 S589P possibly damaging Het
Oas1b T A 5: 120,814,485 N80K probably damaging Het
Olfr1055 G A 2: 86,347,239 H176Y probably benign Het
Olfr1135 A T 2: 87,671,761 I202N probably benign Het
Oprk1 T A 1: 5,598,873 C181S probably damaging Het
Oprl1 T A 2: 181,718,419 N89K probably damaging Het
Pdcd11 A G 19: 47,129,302 K1697E probably damaging Het
Pdp1 G A 4: 11,961,607 H254Y probably benign Het
Pds5b A T 5: 150,805,663 D1419V possibly damaging Het
Per1 G T 11: 69,100,649 G3V probably benign Het
Pex16 C A 2: 92,376,643 N55K probably damaging Het
Phldb2 C A 16: 45,774,977 L862F probably benign Het
Pld5 T A 1: 175,964,006 D478V probably benign Het
Pms2 T C 5: 143,914,796 I177T probably damaging Het
Pou1f1 A T 16: 65,529,872 E119D probably benign Het
Ppp2r1a A C 17: 20,958,796 E295A probably damaging Het
Rad51ap2 A T 12: 11,457,592 N505I possibly damaging Het
Rasal3 A C 17: 32,396,562 V434G probably damaging Het
Rasgrf2 C T 13: 91,987,973 V6M Het
Rwdd1 A T 10: 34,001,156 D197E Het
Scn11a A T 9: 119,790,010 C755* probably null Het
Skil T C 3: 31,116,860 S443P probably benign Het
Slc12a6 T C 2: 112,356,472 C939R probably damaging Het
Slc25a36 A G 9: 97,079,177 S269P probably benign Het
Srrm4 T A 5: 116,482,393 H92L unknown Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,301,649 probably benign Het
Tbc1d4 A T 14: 101,507,410 V260E probably benign Het
Tbc1d8 T C 1: 39,385,232 N593D probably damaging Het
Trex1 C A 9: 109,058,737 R62L probably damaging Het
Trpm3 A T 19: 22,715,352 D269V possibly damaging Het
Trpv4 G T 5: 114,633,150 Y439* probably null Het
Ttn G A 2: 76,734,248 T28515I probably damaging Het
Ucn2 G A 9: 108,986,503 G111D probably damaging Het
Uhrf2 A G 19: 30,056,481 I212V possibly damaging Het
Usp24 T A 4: 106,347,367 M261K probably benign Het
Vmn1r235 A T 17: 21,261,698 D95V probably benign Het
Vwf G A 6: 125,624,573 R826Q Het
Zfp28 T C 7: 6,393,879 C438R probably damaging Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165551914 missense probably benign 0.45
IGL00731:Adcy10 APN 1 165572614 missense probably benign
IGL01099:Adcy10 APN 1 165539842 missense probably benign 0.21
IGL01464:Adcy10 APN 1 165546587 missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165513168 critical splice donor site probably null
IGL02002:Adcy10 APN 1 165521843 missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165570620 missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165572543 missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165559128 missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165538380 missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165510408 missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165570744 missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165567726 missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165543233 missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165519518 missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165538475 nonsense probably null
Bugged UTSW 1 165564237 missense probably damaging 0.99
debye UTSW 1 165551361 critical splice donor site probably null
malaysian UTSW 1 165513127 missense probably benign 0.38
singaporean UTSW 1 165518312 missense probably damaging 0.98
PIT4514001:Adcy10 UTSW 1 165556791 missense probably benign 0.28
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165572591 missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165564249 missense probably benign 0.00
R0433:Adcy10 UTSW 1 165552022 missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165570728 missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165510390 missense probably damaging 1.00
R0513:Adcy10 UTSW 1 165519519 missense probably benign 0.04
R0533:Adcy10 UTSW 1 165564023 missense probably benign 0.05
R0550:Adcy10 UTSW 1 165565315 missense probably benign 0.00
R0554:Adcy10 UTSW 1 165513130 missense probably benign
R0597:Adcy10 UTSW 1 165525062 critical splice donor site probably null
R0629:Adcy10 UTSW 1 165543105 missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165563947 missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165515380 missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165518403 missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165518312 missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165525033 missense probably benign 0.02
R1690:Adcy10 UTSW 1 165519925 missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165503243 missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165521961 missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165570808 missense probably benign 0.02
R1929:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165525022 missense probably benign 0.02
R2211:Adcy10 UTSW 1 165518212 missense probably damaging 1.00
R2225:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165558597 missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165575727 missense probably benign 0.38
R4538:Adcy10 UTSW 1 165513127 missense probably benign 0.38
R4644:Adcy10 UTSW 1 165551361 critical splice donor site probably null
R4649:Adcy10 UTSW 1 165504049 missense probably damaging 1.00
R4832:Adcy10 UTSW 1 165506644 missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165548213 missense probably benign
R4916:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165563963 missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165556862 missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165519500 missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165519895 missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165513140 missense probably benign 0.43
R5692:Adcy10 UTSW 1 165515306 missense probably benign 0.36
R5949:Adcy10 UTSW 1 165539817 missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165541649 missense probably benign 0.19
R6238:Adcy10 UTSW 1 165575728 nonsense probably null
R6455:Adcy10 UTSW 1 165518374 missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165575658 missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165506635 missense probably benign 0.21
R6957:Adcy10 UTSW 1 165564285 missense probably damaging 1.00
R6970:Adcy10 UTSW 1 165556916 missense probably benign 0.02
R7027:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165539874 missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165538522 missense probably benign 0.27
R7130:Adcy10 UTSW 1 165504047 missense probably damaging 1.00
R7144:Adcy10 UTSW 1 165510370 missense probably benign 0.01
R7182:Adcy10 UTSW 1 165543470 splice site probably null
R7228:Adcy10 UTSW 1 165510272 missense probably damaging 1.00
R7384:Adcy10 UTSW 1 165576608 missense unknown
R7561:Adcy10 UTSW 1 165559172 missense possibly damaging 0.94
R7603:Adcy10 UTSW 1 165564237 missense probably damaging 0.99
R7693:Adcy10 UTSW 1 165570771 missense probably benign 0.01
R7812:Adcy10 UTSW 1 165515369 missense probably damaging 1.00
R7905:Adcy10 UTSW 1 165513168 critical splice donor site probably null
R8040:Adcy10 UTSW 1 165552024 missense probably damaging 1.00
R8242:Adcy10 UTSW 1 165546549 missense possibly damaging 0.82
R8278:Adcy10 UTSW 1 165503288 missense probably damaging 1.00
R8282:Adcy10 UTSW 1 165510337 missense probably benign 0.34
R8812:Adcy10 UTSW 1 165551298 missense probably damaging 0.98
R9039:Adcy10 UTSW 1 165518345 missense probably damaging 1.00
R9178:Adcy10 UTSW 1 165575649 missense possibly damaging 0.79
R9244:Adcy10 UTSW 1 165543110 missense probably benign 0.00
RF018:Adcy10 UTSW 1 165552109 missense probably damaging 1.00
Z1177:Adcy10 UTSW 1 165510276 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGCTTGAGCAAGACCCTATCTC -3'
(R):5'- ATGTCAAGGTCAAGGGCCAG -3'

Sequencing Primer
(F):5'- CATTCGGAACTATACGGTGAGATCC -3'
(R):5'- TCAAGGGCCAGAGCTGTG -3'
Posted On 2022-10-06