Incidental Mutation 'R9712:Pld5'
ID 730221
Institutional Source Beutler Lab
Gene Symbol Pld5
Ensembl Gene ENSMUSG00000055214
Gene Name phospholipase D family member 5
Synonyms B230365F16Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9712 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 175789872-176102878 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 175791572 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 478 (D478V)
Ref Sequence ENSEMBL: ENSMUSP00000069326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065967] [ENSMUST00000111167] [ENSMUST00000125404]
AlphaFold Q3UNN8
Predicted Effect probably benign
Transcript: ENSMUST00000065967
AA Change: D478V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000069326
Gene: ENSMUSG00000055214
AA Change: D478V

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
PLDc 215 242 3.62e-3 SMART
Pfam:PLDc_3 245 421 2e-101 PFAM
PLDc 434 460 6.11e0 SMART
low complexity region 511 521 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111167
AA Change: D416V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106797
Gene: ENSMUSG00000055214
AA Change: D416V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PLDc 153 180 3.62e-3 SMART
PLDc 372 398 6.11e0 SMART
low complexity region 449 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125404
SMART Domains Protein: ENSMUSP00000121428
Gene: ENSMUSG00000055214

DomainStartEndE-ValueType
transmembrane domain 69 91 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik A T 19: 3,765,784 (GRCm39) M20L probably benign Het
Aadacl4fm1 C T 4: 144,255,354 (GRCm39) A258V probably benign Het
Abca8b T A 11: 109,833,163 (GRCm39) D1241V probably benign Het
Adam20 G A 8: 41,248,490 (GRCm39) R200H probably benign Het
Adcy10 T C 1: 165,340,681 (GRCm39) F229L probably damaging Het
Adsl A T 15: 80,839,840 (GRCm39) N126I probably benign Het
Ahnak GATCTCTAT GAT 19: 8,984,393 (GRCm39) probably benign Het
Ahnak AGATCTC A 19: 8,984,392 (GRCm39) probably benign Het
Aktip G A 8: 91,856,355 (GRCm39) P41S probably damaging Het
Alkbh3 C A 2: 93,811,318 (GRCm39) R258L probably damaging Het
Arfgap3 A G 15: 83,197,734 (GRCm39) Y341H probably benign Het
Arhgef26 C T 3: 62,331,034 (GRCm39) L583F probably damaging Het
Arhgef40 T C 14: 52,226,415 (GRCm39) I153T probably damaging Het
Atp1a1 T C 3: 101,498,757 (GRCm39) S179G probably benign Het
Bok T C 1: 93,614,229 (GRCm39) S21P probably damaging Het
Ccdc136 A G 6: 29,417,441 (GRCm39) E754G probably benign Het
Cers3 A G 7: 66,423,378 (GRCm39) K108E probably benign Het
Cmya5 T C 13: 93,201,881 (GRCm39) probably null Het
Col19a1 T C 1: 24,367,148 (GRCm39) E478G possibly damaging Het
Colec10 T A 15: 54,323,180 (GRCm39) S134R possibly damaging Het
Ctnnb1 A T 9: 120,784,895 (GRCm39) I514F probably damaging Het
Cux1 C T 5: 136,338,673 (GRCm39) E664K probably benign Het
Dars1 T C 1: 128,333,199 (GRCm39) Q75R probably benign Het
Disp1 T A 1: 182,917,379 (GRCm39) S16C probably damaging Het
Dnah7a A T 1: 53,598,299 (GRCm39) V1412E probably benign Het
Ect2l C T 10: 18,044,182 (GRCm39) V226I probably benign Het
Ep400 T A 5: 110,904,509 (GRCm39) H30L unknown Het
Ephx4 A G 5: 107,567,647 (GRCm39) I202V probably benign Het
Exoc3 A T 13: 74,341,027 (GRCm39) F259Y probably damaging Het
Ezr T C 17: 7,020,394 (GRCm39) E229G probably damaging Het
Fat1 A T 8: 45,470,417 (GRCm39) I1472L probably benign Het
Fsd1l T G 4: 53,679,972 (GRCm39) D223E probably benign Het
Gata6 A T 18: 11,059,064 (GRCm39) D377V possibly damaging Het
Gm12185 A T 11: 48,798,216 (GRCm39) M759K probably benign Het
Gm9922 C T 14: 101,966,893 (GRCm39) A120T unknown Het
Hectd4 A T 5: 121,448,744 (GRCm39) Y364F probably benign Het
Hnrnph1 A G 11: 50,276,696 (GRCm39) S465G unknown Het
Ifi204 T C 1: 173,576,924 (GRCm39) Y559C probably damaging Het
Ift88 T C 14: 57,718,853 (GRCm39) S613P probably damaging Het
Kif21a G C 15: 90,869,528 (GRCm39) A441G probably damaging Het
Kif21a G T 15: 90,879,715 (GRCm39) T191K probably benign Het
Lrit1 T A 14: 36,782,084 (GRCm39) C252* probably null Het
Ncbp1 T A 4: 46,144,837 (GRCm39) D29E probably benign Het
Nlrp10 A T 7: 108,524,735 (GRCm39) D248E probably damaging Het
Nphp4 T G 4: 152,631,521 (GRCm39) V807G probably benign Het
Nsd1 T C 13: 55,393,856 (GRCm39) S589P possibly damaging Het
Oas1b T A 5: 120,952,550 (GRCm39) N80K probably damaging Het
Oprk1 T A 1: 5,669,096 (GRCm39) C181S probably damaging Het
Oprl1 T A 2: 181,360,212 (GRCm39) N89K probably damaging Het
Or5w12 A T 2: 87,502,105 (GRCm39) I202N probably benign Het
Or8k53 G A 2: 86,177,583 (GRCm39) H176Y probably benign Het
Pdcd11 A G 19: 47,117,741 (GRCm39) K1697E probably damaging Het
Pdp1 G A 4: 11,961,607 (GRCm39) H254Y probably benign Het
Pds5b A T 5: 150,729,128 (GRCm39) D1419V possibly damaging Het
Per1 G T 11: 68,991,475 (GRCm39) G3V probably benign Het
Pex16 C A 2: 92,206,988 (GRCm39) N55K probably damaging Het
Phldb2 C A 16: 45,595,340 (GRCm39) L862F probably benign Het
Pms2 T C 5: 143,851,614 (GRCm39) I177T probably damaging Het
Pou1f1 A T 16: 65,326,758 (GRCm39) E119D probably benign Het
Ppp2r1a A C 17: 21,179,058 (GRCm39) E295A probably damaging Het
Qrfprl A G 6: 65,433,124 (GRCm39) I315V probably benign Het
Rad51ap2 A T 12: 11,507,593 (GRCm39) N505I possibly damaging Het
Rasal3 A C 17: 32,615,536 (GRCm39) V434G probably damaging Het
Rasgrf2 C T 13: 92,136,092 (GRCm39) V6M Het
Rwdd1 A T 10: 33,877,152 (GRCm39) D197E Het
Scn11a A T 9: 119,619,076 (GRCm39) C755* probably null Het
Skil T C 3: 31,171,009 (GRCm39) S443P probably benign Het
Slc12a6 T C 2: 112,186,817 (GRCm39) C939R probably damaging Het
Slc25a36 A G 9: 96,961,230 (GRCm39) S269P probably benign Het
Srrm4 T A 5: 116,620,452 (GRCm39) H92L unknown Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Tbc1d4 A T 14: 101,744,846 (GRCm39) V260E probably benign Het
Tbc1d8 T C 1: 39,424,313 (GRCm39) N593D probably damaging Het
Trex1 C A 9: 108,887,805 (GRCm39) R62L probably damaging Het
Trpm3 A T 19: 22,692,716 (GRCm39) D269V possibly damaging Het
Trpv4 G T 5: 114,771,211 (GRCm39) Y439* probably null Het
Ttn G A 2: 76,564,592 (GRCm39) T28515I probably damaging Het
Ucn2 G A 9: 108,815,571 (GRCm39) G111D probably damaging Het
Uhrf2 A G 19: 30,033,881 (GRCm39) I212V possibly damaging Het
Usp24 T A 4: 106,204,564 (GRCm39) M261K probably benign Het
Vmn1r235 A T 17: 21,481,960 (GRCm39) D95V probably benign Het
Vwf G A 6: 125,601,536 (GRCm39) R826Q Het
Zfp1002 C T 2: 150,096,496 (GRCm39) R311Q probably benign Het
Zfp28 T C 7: 6,396,878 (GRCm39) C438R probably damaging Het
Other mutations in Pld5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Pld5 APN 1 175,967,585 (GRCm39) missense probably damaging 1.00
IGL00949:Pld5 APN 1 175,803,039 (GRCm39) missense probably damaging 1.00
IGL01067:Pld5 APN 1 176,102,445 (GRCm39) utr 5 prime probably benign
IGL02174:Pld5 APN 1 176,102,310 (GRCm39) missense possibly damaging 0.86
IGL02380:Pld5 APN 1 175,967,610 (GRCm39) missense probably damaging 0.97
IGL02879:Pld5 APN 1 175,798,157 (GRCm39) missense probably damaging 1.00
R0087:Pld5 UTSW 1 175,812,025 (GRCm39) missense probably damaging 0.98
R0135:Pld5 UTSW 1 175,798,155 (GRCm39) missense probably damaging 1.00
R0144:Pld5 UTSW 1 175,798,107 (GRCm39) missense probably benign 0.00
R0362:Pld5 UTSW 1 175,803,146 (GRCm39) nonsense probably null
R0453:Pld5 UTSW 1 175,917,522 (GRCm39) missense possibly damaging 0.75
R0454:Pld5 UTSW 1 176,102,295 (GRCm39) missense probably benign 0.00
R0722:Pld5 UTSW 1 175,803,081 (GRCm39) missense probably benign 0.34
R0751:Pld5 UTSW 1 175,872,462 (GRCm39) missense probably damaging 0.98
R0785:Pld5 UTSW 1 175,803,018 (GRCm39) splice site probably benign
R1184:Pld5 UTSW 1 175,872,462 (GRCm39) missense probably damaging 0.98
R1501:Pld5 UTSW 1 175,803,087 (GRCm39) missense probably benign 0.36
R1644:Pld5 UTSW 1 175,803,192 (GRCm39) missense possibly damaging 0.86
R2012:Pld5 UTSW 1 175,791,579 (GRCm39) missense probably benign 0.27
R2426:Pld5 UTSW 1 175,791,542 (GRCm39) missense probably benign
R3508:Pld5 UTSW 1 175,821,603 (GRCm39) missense probably damaging 1.00
R3917:Pld5 UTSW 1 175,791,504 (GRCm39) missense probably benign 0.00
R4207:Pld5 UTSW 1 175,821,441 (GRCm39) missense probably damaging 1.00
R4373:Pld5 UTSW 1 175,967,583 (GRCm39) missense probably damaging 1.00
R4828:Pld5 UTSW 1 176,102,433 (GRCm39) missense probably benign 0.06
R4831:Pld5 UTSW 1 176,102,450 (GRCm39) utr 5 prime probably benign
R5861:Pld5 UTSW 1 175,917,571 (GRCm39) missense probably damaging 1.00
R6182:Pld5 UTSW 1 175,872,420 (GRCm39) missense probably benign 0.35
R6191:Pld5 UTSW 1 175,798,100 (GRCm39) missense probably benign 0.04
R6246:Pld5 UTSW 1 175,791,475 (GRCm39) nonsense probably null
R6737:Pld5 UTSW 1 175,917,588 (GRCm39) missense probably damaging 1.00
R7082:Pld5 UTSW 1 175,917,442 (GRCm39) missense probably benign 0.21
R7164:Pld5 UTSW 1 176,041,187 (GRCm39) start codon destroyed probably null 0.00
R7237:Pld5 UTSW 1 176,102,301 (GRCm39) missense possibly damaging 0.79
R7635:Pld5 UTSW 1 175,821,416 (GRCm39) critical splice donor site probably null
R7805:Pld5 UTSW 1 175,872,480 (GRCm39) missense probably damaging 1.00
R7967:Pld5 UTSW 1 176,102,264 (GRCm39) missense probably benign 0.03
R8038:Pld5 UTSW 1 175,872,463 (GRCm39) missense probably benign 0.19
R8995:Pld5 UTSW 1 175,791,580 (GRCm39) missense probably benign 0.01
R9033:Pld5 UTSW 1 175,967,585 (GRCm39) missense probably damaging 0.99
R9067:Pld5 UTSW 1 175,917,474 (GRCm39) missense probably benign 0.00
R9156:Pld5 UTSW 1 175,902,003 (GRCm39) missense probably benign 0.05
R9156:Pld5 UTSW 1 175,803,104 (GRCm39) missense possibly damaging 0.73
X0004:Pld5 UTSW 1 176,089,088 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCATTTGGTCTGAAGCCTTG -3'
(R):5'- TGTCATCAGGATTCTGCCTC -3'

Sequencing Primer
(F):5'- TGTCTGTTAGTGAGCTATACGC -3'
(R):5'- GGATTCTGCCTCTCTTATTATTTTGG -3'
Posted On 2022-10-06