Incidental Mutation 'R9712:Skil'
ID 730231
Institutional Source Beutler Lab
Gene Symbol Skil
Ensembl Gene ENSMUSG00000027660
Gene Name SKI-like
Synonyms 9130011J04Rik, sno-dE3, SnoN, Skir, SnoN2
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9712 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 31149259-31176741 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 31171009 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 443 (S443P)
Ref Sequence ENSEMBL: ENSMUSP00000113256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029194] [ENSMUST00000117728] [ENSMUST00000118204] [ENSMUST00000118470]
AlphaFold Q60665
Predicted Effect probably benign
Transcript: ENSMUST00000029194
AA Change: S489P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029194
Gene: ENSMUSG00000027660
AA Change: S489P

DomainStartEndE-ValueType
Pfam:Ski_Sno 121 233 2e-46 PFAM
c-SKI_SMAD_bind 258 353 6.01e-64 SMART
low complexity region 419 437 N/A INTRINSIC
coiled coil region 526 670 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117728
AA Change: S363P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113054
Gene: ENSMUSG00000027660
AA Change: S363P

DomainStartEndE-ValueType
Pfam:Ski_Sno 41 153 1.5e-45 PFAM
c-SKI_SMAD_bind 178 273 6.01e-64 SMART
low complexity region 347 357 N/A INTRINSIC
coiled coil region 400 544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118204
AA Change: S489P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112413
Gene: ENSMUSG00000027660
AA Change: S489P

DomainStartEndE-ValueType
Pfam:Ski_Sno 125 232 2.7e-46 PFAM
c-SKI_SMAD_bind 258 353 6.01e-64 SMART
low complexity region 419 437 N/A INTRINSIC
coiled coil region 526 670 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118470
AA Change: S443P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113256
Gene: ENSMUSG00000027660
AA Change: S443P

DomainStartEndE-ValueType
Pfam:Ski_Sno 121 233 2e-46 PFAM
c-SKI_SMAD_bind 258 353 6.01e-64 SMART
low complexity region 427 437 N/A INTRINSIC
SCOP:d1eq1a_ 508 625 5e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a small family of proteins that play a key role in the response of cells to extracellular growth signals. The encoded protein regulates members of the transforming growth factor beta signaling pathway. It is highly expressed in certain cancer cells, where it may have both tumor-suppressing and tumor-promoting roles. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Heterozygotes for a null allele develop lymphomas and show increased incidence of chemically-induced tumors while homozygotes die before implantation. Homozygotes for a different null allele are viable but show defective T cell activation and impaired mammary gland alveologenesis and lactogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik A T 19: 3,765,784 (GRCm39) M20L probably benign Het
Aadacl4fm1 C T 4: 144,255,354 (GRCm39) A258V probably benign Het
Abca8b T A 11: 109,833,163 (GRCm39) D1241V probably benign Het
Adam20 G A 8: 41,248,490 (GRCm39) R200H probably benign Het
Adcy10 T C 1: 165,340,681 (GRCm39) F229L probably damaging Het
Adsl A T 15: 80,839,840 (GRCm39) N126I probably benign Het
Ahnak GATCTCTAT GAT 19: 8,984,393 (GRCm39) probably benign Het
Ahnak AGATCTC A 19: 8,984,392 (GRCm39) probably benign Het
Aktip G A 8: 91,856,355 (GRCm39) P41S probably damaging Het
Alkbh3 C A 2: 93,811,318 (GRCm39) R258L probably damaging Het
Arfgap3 A G 15: 83,197,734 (GRCm39) Y341H probably benign Het
Arhgef26 C T 3: 62,331,034 (GRCm39) L583F probably damaging Het
Arhgef40 T C 14: 52,226,415 (GRCm39) I153T probably damaging Het
Atp1a1 T C 3: 101,498,757 (GRCm39) S179G probably benign Het
Bok T C 1: 93,614,229 (GRCm39) S21P probably damaging Het
Ccdc136 A G 6: 29,417,441 (GRCm39) E754G probably benign Het
Cers3 A G 7: 66,423,378 (GRCm39) K108E probably benign Het
Cmya5 T C 13: 93,201,881 (GRCm39) probably null Het
Col19a1 T C 1: 24,367,148 (GRCm39) E478G possibly damaging Het
Colec10 T A 15: 54,323,180 (GRCm39) S134R possibly damaging Het
Ctnnb1 A T 9: 120,784,895 (GRCm39) I514F probably damaging Het
Cux1 C T 5: 136,338,673 (GRCm39) E664K probably benign Het
Dars1 T C 1: 128,333,199 (GRCm39) Q75R probably benign Het
Disp1 T A 1: 182,917,379 (GRCm39) S16C probably damaging Het
Dnah7a A T 1: 53,598,299 (GRCm39) V1412E probably benign Het
Ect2l C T 10: 18,044,182 (GRCm39) V226I probably benign Het
Ep400 T A 5: 110,904,509 (GRCm39) H30L unknown Het
Ephx4 A G 5: 107,567,647 (GRCm39) I202V probably benign Het
Exoc3 A T 13: 74,341,027 (GRCm39) F259Y probably damaging Het
Ezr T C 17: 7,020,394 (GRCm39) E229G probably damaging Het
Fat1 A T 8: 45,470,417 (GRCm39) I1472L probably benign Het
Fsd1l T G 4: 53,679,972 (GRCm39) D223E probably benign Het
Gata6 A T 18: 11,059,064 (GRCm39) D377V possibly damaging Het
Gm12185 A T 11: 48,798,216 (GRCm39) M759K probably benign Het
Gm9922 C T 14: 101,966,893 (GRCm39) A120T unknown Het
Hectd4 A T 5: 121,448,744 (GRCm39) Y364F probably benign Het
Hnrnph1 A G 11: 50,276,696 (GRCm39) S465G unknown Het
Ifi204 T C 1: 173,576,924 (GRCm39) Y559C probably damaging Het
Ift88 T C 14: 57,718,853 (GRCm39) S613P probably damaging Het
Kif21a G C 15: 90,869,528 (GRCm39) A441G probably damaging Het
Kif21a G T 15: 90,879,715 (GRCm39) T191K probably benign Het
Lrit1 T A 14: 36,782,084 (GRCm39) C252* probably null Het
Ncbp1 T A 4: 46,144,837 (GRCm39) D29E probably benign Het
Nlrp10 A T 7: 108,524,735 (GRCm39) D248E probably damaging Het
Nphp4 T G 4: 152,631,521 (GRCm39) V807G probably benign Het
Nsd1 T C 13: 55,393,856 (GRCm39) S589P possibly damaging Het
Oas1b T A 5: 120,952,550 (GRCm39) N80K probably damaging Het
Oprk1 T A 1: 5,669,096 (GRCm39) C181S probably damaging Het
Oprl1 T A 2: 181,360,212 (GRCm39) N89K probably damaging Het
Or5w12 A T 2: 87,502,105 (GRCm39) I202N probably benign Het
Or8k53 G A 2: 86,177,583 (GRCm39) H176Y probably benign Het
Pdcd11 A G 19: 47,117,741 (GRCm39) K1697E probably damaging Het
Pdp1 G A 4: 11,961,607 (GRCm39) H254Y probably benign Het
Pds5b A T 5: 150,729,128 (GRCm39) D1419V possibly damaging Het
Per1 G T 11: 68,991,475 (GRCm39) G3V probably benign Het
Pex16 C A 2: 92,206,988 (GRCm39) N55K probably damaging Het
Phldb2 C A 16: 45,595,340 (GRCm39) L862F probably benign Het
Pld5 T A 1: 175,791,572 (GRCm39) D478V probably benign Het
Pms2 T C 5: 143,851,614 (GRCm39) I177T probably damaging Het
Pou1f1 A T 16: 65,326,758 (GRCm39) E119D probably benign Het
Ppp2r1a A C 17: 21,179,058 (GRCm39) E295A probably damaging Het
Qrfprl A G 6: 65,433,124 (GRCm39) I315V probably benign Het
Rad51ap2 A T 12: 11,507,593 (GRCm39) N505I possibly damaging Het
Rasal3 A C 17: 32,615,536 (GRCm39) V434G probably damaging Het
Rasgrf2 C T 13: 92,136,092 (GRCm39) V6M Het
Rwdd1 A T 10: 33,877,152 (GRCm39) D197E Het
Scn11a A T 9: 119,619,076 (GRCm39) C755* probably null Het
Slc12a6 T C 2: 112,186,817 (GRCm39) C939R probably damaging Het
Slc25a36 A G 9: 96,961,230 (GRCm39) S269P probably benign Het
Srrm4 T A 5: 116,620,452 (GRCm39) H92L unknown Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Tbc1d4 A T 14: 101,744,846 (GRCm39) V260E probably benign Het
Tbc1d8 T C 1: 39,424,313 (GRCm39) N593D probably damaging Het
Trex1 C A 9: 108,887,805 (GRCm39) R62L probably damaging Het
Trpm3 A T 19: 22,692,716 (GRCm39) D269V possibly damaging Het
Trpv4 G T 5: 114,771,211 (GRCm39) Y439* probably null Het
Ttn G A 2: 76,564,592 (GRCm39) T28515I probably damaging Het
Ucn2 G A 9: 108,815,571 (GRCm39) G111D probably damaging Het
Uhrf2 A G 19: 30,033,881 (GRCm39) I212V possibly damaging Het
Usp24 T A 4: 106,204,564 (GRCm39) M261K probably benign Het
Vmn1r235 A T 17: 21,481,960 (GRCm39) D95V probably benign Het
Vwf G A 6: 125,601,536 (GRCm39) R826Q Het
Zfp1002 C T 2: 150,096,496 (GRCm39) R311Q probably benign Het
Zfp28 T C 7: 6,396,878 (GRCm39) C438R probably damaging Het
Other mutations in Skil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01940:Skil APN 3 31,165,793 (GRCm39) missense probably benign 0.01
IGL02149:Skil APN 3 31,151,856 (GRCm39) missense possibly damaging 0.47
IGL02388:Skil APN 3 31,165,787 (GRCm39) nonsense probably null
IGL02478:Skil APN 3 31,151,968 (GRCm39) nonsense probably null
IGL02723:Skil APN 3 31,171,673 (GRCm39) missense probably damaging 1.00
PIT4243001:Skil UTSW 3 31,167,714 (GRCm39) missense probably damaging 0.98
PIT4466001:Skil UTSW 3 31,152,381 (GRCm39) missense probably damaging 1.00
PIT4472001:Skil UTSW 3 31,152,381 (GRCm39) missense probably damaging 1.00
R1809:Skil UTSW 3 31,171,655 (GRCm39) missense probably damaging 0.99
R3124:Skil UTSW 3 31,151,487 (GRCm39) missense probably benign 0.03
R3750:Skil UTSW 3 31,170,983 (GRCm39) missense probably benign 0.00
R4865:Skil UTSW 3 31,167,562 (GRCm39) missense probably damaging 1.00
R5213:Skil UTSW 3 31,171,600 (GRCm39) missense probably damaging 0.99
R5328:Skil UTSW 3 31,171,718 (GRCm39) missense probably benign 0.00
R5357:Skil UTSW 3 31,167,700 (GRCm39) missense probably benign
R5428:Skil UTSW 3 31,151,647 (GRCm39) missense probably benign
R6153:Skil UTSW 3 31,152,002 (GRCm39) missense probably damaging 1.00
R6613:Skil UTSW 3 31,152,029 (GRCm39) missense probably null 1.00
R7270:Skil UTSW 3 31,151,324 (GRCm39) intron probably benign
R7999:Skil UTSW 3 31,151,751 (GRCm39) missense possibly damaging 0.90
R8350:Skil UTSW 3 31,151,603 (GRCm39) missense probably benign 0.13
R8758:Skil UTSW 3 31,172,686 (GRCm39) missense probably damaging 1.00
R8802:Skil UTSW 3 31,167,592 (GRCm39) missense probably damaging 1.00
R8873:Skil UTSW 3 31,152,075 (GRCm39) missense probably damaging 1.00
R8961:Skil UTSW 3 31,167,729 (GRCm39) missense probably benign 0.02
R9526:Skil UTSW 3 31,171,639 (GRCm39) missense probably benign 0.09
R9755:Skil UTSW 3 31,151,544 (GRCm39) missense probably benign
Z1176:Skil UTSW 3 31,151,675 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TTTGTAGTTGTCACCTGGCACTAC -3'
(R):5'- AGCTTACCATCTGCAGCTG -3'

Sequencing Primer
(F):5'- GTCACCTGGCACTACATTTATTTG -3'
(R):5'- GCTGCTGCTTCCTCTGC -3'
Posted On 2022-10-06