Incidental Mutation 'R9712:Hectd4'
ID 730245
Institutional Source Beutler Lab
Gene Symbol Hectd4
Ensembl Gene ENSMUSG00000042744
Gene Name HECT domain E3 ubiquitin protein ligase 4
Synonyms Gm15800
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.927) question?
Stock # R9712 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 121358282-121506640 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 121448744 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 364 (Y364F)
Ref Sequence ENSEMBL: ENSMUSP00000098332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042614] [ENSMUST00000100769]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000042614
AA Change: Y1701F

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744
AA Change: Y1701F

DomainStartEndE-ValueType
low complexity region 224 234 N/A INTRINSIC
low complexity region 266 282 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 725 735 N/A INTRINSIC
low complexity region 1252 1265 N/A INTRINSIC
coiled coil region 1372 1398 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1725 1741 N/A INTRINSIC
low complexity region 1892 1904 N/A INTRINSIC
low complexity region 2656 2666 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
low complexity region 2901 2917 N/A INTRINSIC
low complexity region 2921 2933 N/A INTRINSIC
low complexity region 3232 3246 N/A INTRINSIC
low complexity region 3275 3335 N/A INTRINSIC
low complexity region 3441 3448 N/A INTRINSIC
low complexity region 3473 3506 N/A INTRINSIC
low complexity region 3512 3533 N/A INTRINSIC
low complexity region 3540 3554 N/A INTRINSIC
low complexity region 3794 3822 N/A INTRINSIC
HECTc 4048 4412 4.78e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100769
AA Change: Y364F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000098332
Gene: ENSMUSG00000042744
AA Change: Y364F

DomainStartEndE-ValueType
coiled coil region 35 61 N/A INTRINSIC
low complexity region 214 225 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
low complexity region 555 567 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik A T 19: 3,765,784 (GRCm39) M20L probably benign Het
Aadacl4fm1 C T 4: 144,255,354 (GRCm39) A258V probably benign Het
Abca8b T A 11: 109,833,163 (GRCm39) D1241V probably benign Het
Adam20 G A 8: 41,248,490 (GRCm39) R200H probably benign Het
Adcy10 T C 1: 165,340,681 (GRCm39) F229L probably damaging Het
Adsl A T 15: 80,839,840 (GRCm39) N126I probably benign Het
Ahnak GATCTCTAT GAT 19: 8,984,393 (GRCm39) probably benign Het
Ahnak AGATCTC A 19: 8,984,392 (GRCm39) probably benign Het
Aktip G A 8: 91,856,355 (GRCm39) P41S probably damaging Het
Alkbh3 C A 2: 93,811,318 (GRCm39) R258L probably damaging Het
Arfgap3 A G 15: 83,197,734 (GRCm39) Y341H probably benign Het
Arhgef26 C T 3: 62,331,034 (GRCm39) L583F probably damaging Het
Arhgef40 T C 14: 52,226,415 (GRCm39) I153T probably damaging Het
Atp1a1 T C 3: 101,498,757 (GRCm39) S179G probably benign Het
Bok T C 1: 93,614,229 (GRCm39) S21P probably damaging Het
Ccdc136 A G 6: 29,417,441 (GRCm39) E754G probably benign Het
Cers3 A G 7: 66,423,378 (GRCm39) K108E probably benign Het
Cmya5 T C 13: 93,201,881 (GRCm39) probably null Het
Col19a1 T C 1: 24,367,148 (GRCm39) E478G possibly damaging Het
Colec10 T A 15: 54,323,180 (GRCm39) S134R possibly damaging Het
Ctnnb1 A T 9: 120,784,895 (GRCm39) I514F probably damaging Het
Cux1 C T 5: 136,338,673 (GRCm39) E664K probably benign Het
Dars1 T C 1: 128,333,199 (GRCm39) Q75R probably benign Het
Disp1 T A 1: 182,917,379 (GRCm39) S16C probably damaging Het
Dnah7a A T 1: 53,598,299 (GRCm39) V1412E probably benign Het
Ect2l C T 10: 18,044,182 (GRCm39) V226I probably benign Het
Ep400 T A 5: 110,904,509 (GRCm39) H30L unknown Het
Ephx4 A G 5: 107,567,647 (GRCm39) I202V probably benign Het
Exoc3 A T 13: 74,341,027 (GRCm39) F259Y probably damaging Het
Ezr T C 17: 7,020,394 (GRCm39) E229G probably damaging Het
Fat1 A T 8: 45,470,417 (GRCm39) I1472L probably benign Het
Fsd1l T G 4: 53,679,972 (GRCm39) D223E probably benign Het
Gata6 A T 18: 11,059,064 (GRCm39) D377V possibly damaging Het
Gm12185 A T 11: 48,798,216 (GRCm39) M759K probably benign Het
Gm9922 C T 14: 101,966,893 (GRCm39) A120T unknown Het
Hnrnph1 A G 11: 50,276,696 (GRCm39) S465G unknown Het
Ifi204 T C 1: 173,576,924 (GRCm39) Y559C probably damaging Het
Ift88 T C 14: 57,718,853 (GRCm39) S613P probably damaging Het
Kif21a G C 15: 90,869,528 (GRCm39) A441G probably damaging Het
Kif21a G T 15: 90,879,715 (GRCm39) T191K probably benign Het
Lrit1 T A 14: 36,782,084 (GRCm39) C252* probably null Het
Ncbp1 T A 4: 46,144,837 (GRCm39) D29E probably benign Het
Nlrp10 A T 7: 108,524,735 (GRCm39) D248E probably damaging Het
Nphp4 T G 4: 152,631,521 (GRCm39) V807G probably benign Het
Nsd1 T C 13: 55,393,856 (GRCm39) S589P possibly damaging Het
Oas1b T A 5: 120,952,550 (GRCm39) N80K probably damaging Het
Oprk1 T A 1: 5,669,096 (GRCm39) C181S probably damaging Het
Oprl1 T A 2: 181,360,212 (GRCm39) N89K probably damaging Het
Or5w12 A T 2: 87,502,105 (GRCm39) I202N probably benign Het
Or8k53 G A 2: 86,177,583 (GRCm39) H176Y probably benign Het
Pdcd11 A G 19: 47,117,741 (GRCm39) K1697E probably damaging Het
Pdp1 G A 4: 11,961,607 (GRCm39) H254Y probably benign Het
Pds5b A T 5: 150,729,128 (GRCm39) D1419V possibly damaging Het
Per1 G T 11: 68,991,475 (GRCm39) G3V probably benign Het
Pex16 C A 2: 92,206,988 (GRCm39) N55K probably damaging Het
Phldb2 C A 16: 45,595,340 (GRCm39) L862F probably benign Het
Pld5 T A 1: 175,791,572 (GRCm39) D478V probably benign Het
Pms2 T C 5: 143,851,614 (GRCm39) I177T probably damaging Het
Pou1f1 A T 16: 65,326,758 (GRCm39) E119D probably benign Het
Ppp2r1a A C 17: 21,179,058 (GRCm39) E295A probably damaging Het
Qrfprl A G 6: 65,433,124 (GRCm39) I315V probably benign Het
Rad51ap2 A T 12: 11,507,593 (GRCm39) N505I possibly damaging Het
Rasal3 A C 17: 32,615,536 (GRCm39) V434G probably damaging Het
Rasgrf2 C T 13: 92,136,092 (GRCm39) V6M Het
Rwdd1 A T 10: 33,877,152 (GRCm39) D197E Het
Scn11a A T 9: 119,619,076 (GRCm39) C755* probably null Het
Skil T C 3: 31,171,009 (GRCm39) S443P probably benign Het
Slc12a6 T C 2: 112,186,817 (GRCm39) C939R probably damaging Het
Slc25a36 A G 9: 96,961,230 (GRCm39) S269P probably benign Het
Srrm4 T A 5: 116,620,452 (GRCm39) H92L unknown Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Tbc1d4 A T 14: 101,744,846 (GRCm39) V260E probably benign Het
Tbc1d8 T C 1: 39,424,313 (GRCm39) N593D probably damaging Het
Trex1 C A 9: 108,887,805 (GRCm39) R62L probably damaging Het
Trpm3 A T 19: 22,692,716 (GRCm39) D269V possibly damaging Het
Trpv4 G T 5: 114,771,211 (GRCm39) Y439* probably null Het
Ttn G A 2: 76,564,592 (GRCm39) T28515I probably damaging Het
Ucn2 G A 9: 108,815,571 (GRCm39) G111D probably damaging Het
Uhrf2 A G 19: 30,033,881 (GRCm39) I212V possibly damaging Het
Usp24 T A 4: 106,204,564 (GRCm39) M261K probably benign Het
Vmn1r235 A T 17: 21,481,960 (GRCm39) D95V probably benign Het
Vwf G A 6: 125,601,536 (GRCm39) R826Q Het
Zfp1002 C T 2: 150,096,496 (GRCm39) R311Q probably benign Het
Zfp28 T C 7: 6,396,878 (GRCm39) C438R probably damaging Het
Other mutations in Hectd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Hectd4 APN 5 121,501,933 (GRCm39) missense possibly damaging 0.51
IGL00976:Hectd4 APN 5 121,487,169 (GRCm39) missense probably benign 0.18
IGL01085:Hectd4 APN 5 121,469,764 (GRCm39) missense probably damaging 1.00
IGL01112:Hectd4 APN 5 121,445,013 (GRCm39) missense probably benign 0.01
IGL01402:Hectd4 APN 5 121,477,480 (GRCm39) splice site probably benign
IGL01474:Hectd4 APN 5 121,474,712 (GRCm39) missense possibly damaging 0.53
IGL01503:Hectd4 APN 5 121,456,714 (GRCm39) missense probably benign 0.28
IGL01548:Hectd4 APN 5 121,502,723 (GRCm39) missense possibly damaging 0.71
IGL01656:Hectd4 APN 5 121,460,763 (GRCm39) missense probably damaging 0.99
IGL01756:Hectd4 APN 5 121,482,887 (GRCm39) missense probably benign 0.28
IGL01819:Hectd4 APN 5 121,466,481 (GRCm39) missense possibly damaging 0.85
IGL02080:Hectd4 APN 5 121,504,669 (GRCm39) utr 3 prime probably benign
IGL02488:Hectd4 APN 5 121,430,150 (GRCm39) missense probably benign 0.33
IGL02490:Hectd4 APN 5 121,456,676 (GRCm39) missense possibly damaging 0.82
IGL02558:Hectd4 APN 5 121,482,848 (GRCm39) missense probably benign 0.28
IGL02626:Hectd4 APN 5 121,491,944 (GRCm39) missense possibly damaging 0.86
IGL02649:Hectd4 APN 5 121,487,465 (GRCm39) missense possibly damaging 0.73
IGL02736:Hectd4 APN 5 121,480,782 (GRCm39) missense possibly damaging 0.73
IGL02861:Hectd4 APN 5 121,445,067 (GRCm39) missense possibly damaging 0.81
IGL02880:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL02889:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL02953:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL02969:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL03031:Hectd4 APN 5 121,486,857 (GRCm39) missense possibly damaging 0.96
IGL03066:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL03160:Hectd4 APN 5 121,397,942 (GRCm39) missense probably benign
IGL03181:Hectd4 APN 5 121,492,021 (GRCm39) missense possibly damaging 0.91
IGL03265:Hectd4 APN 5 121,398,002 (GRCm39) splice site probably benign
IGL03375:Hectd4 APN 5 121,466,445 (GRCm39) missense possibly damaging 0.72
Achilles UTSW 5 121,445,444 (GRCm39) nonsense probably null
agamemnon UTSW 5 121,391,921 (GRCm39) splice site probably benign
clymnestra UTSW 5 121,472,438 (GRCm39) missense possibly damaging 0.86
hector UTSW 5 121,453,500 (GRCm39) missense probably damaging 1.00
helen UTSW 5 121,448,726 (GRCm39) missense probably damaging 0.97
Merriwether UTSW 5 121,491,614 (GRCm39) missense possibly damaging 0.53
PIT4466001:Hectd4 UTSW 5 121,471,123 (GRCm39) critical splice donor site probably null
R0018:Hectd4 UTSW 5 121,392,242 (GRCm39) missense possibly damaging 0.53
R0024:Hectd4 UTSW 5 121,446,639 (GRCm39) missense possibly damaging 0.92
R0030:Hectd4 UTSW 5 121,400,651 (GRCm39) nonsense probably null
R0080:Hectd4 UTSW 5 121,487,435 (GRCm39) missense probably benign 0.18
R0110:Hectd4 UTSW 5 121,443,736 (GRCm39) missense possibly damaging 0.53
R0110:Hectd4 UTSW 5 121,419,959 (GRCm39) missense possibly damaging 0.90
R0115:Hectd4 UTSW 5 121,433,569 (GRCm39) splice site probably benign
R0128:Hectd4 UTSW 5 121,487,306 (GRCm39) missense possibly damaging 0.86
R0131:Hectd4 UTSW 5 121,471,087 (GRCm39) missense probably benign 0.44
R0131:Hectd4 UTSW 5 121,471,087 (GRCm39) missense probably benign 0.44
R0132:Hectd4 UTSW 5 121,471,087 (GRCm39) missense probably benign 0.44
R0244:Hectd4 UTSW 5 121,467,668 (GRCm39) missense probably benign 0.33
R0281:Hectd4 UTSW 5 121,392,314 (GRCm39) missense possibly damaging 0.85
R0329:Hectd4 UTSW 5 121,397,927 (GRCm39) missense probably benign
R0410:Hectd4 UTSW 5 121,424,329 (GRCm39) missense possibly damaging 0.86
R0422:Hectd4 UTSW 5 121,481,145 (GRCm39) splice site probably null
R0442:Hectd4 UTSW 5 121,462,045 (GRCm39) missense possibly damaging 0.66
R0449:Hectd4 UTSW 5 121,502,653 (GRCm39) splice site probably null
R0469:Hectd4 UTSW 5 121,443,736 (GRCm39) missense possibly damaging 0.53
R0469:Hectd4 UTSW 5 121,419,959 (GRCm39) missense possibly damaging 0.90
R0481:Hectd4 UTSW 5 121,433,569 (GRCm39) splice site probably benign
R0510:Hectd4 UTSW 5 121,443,736 (GRCm39) missense possibly damaging 0.53
R0510:Hectd4 UTSW 5 121,419,959 (GRCm39) missense possibly damaging 0.90
R0520:Hectd4 UTSW 5 121,469,770 (GRCm39) missense possibly damaging 0.53
R0534:Hectd4 UTSW 5 121,486,539 (GRCm39) missense possibly damaging 0.96
R0603:Hectd4 UTSW 5 121,442,400 (GRCm39) missense possibly damaging 0.46
R0617:Hectd4 UTSW 5 121,481,295 (GRCm39) splice site probably benign
R0622:Hectd4 UTSW 5 121,486,688 (GRCm39) missense possibly damaging 0.53
R0626:Hectd4 UTSW 5 121,415,887 (GRCm39) missense probably benign 0.18
R0708:Hectd4 UTSW 5 121,424,526 (GRCm39) critical splice donor site probably null
R0710:Hectd4 UTSW 5 121,474,691 (GRCm39) missense probably benign 0.08
R0763:Hectd4 UTSW 5 121,445,096 (GRCm39) unclassified probably benign
R0764:Hectd4 UTSW 5 121,424,832 (GRCm39) missense possibly damaging 0.46
R1123:Hectd4 UTSW 5 121,424,799 (GRCm39) missense probably damaging 0.96
R1129:Hectd4 UTSW 5 121,448,662 (GRCm39) missense possibly damaging 0.66
R1204:Hectd4 UTSW 5 121,488,548 (GRCm39) missense possibly damaging 0.85
R1237:Hectd4 UTSW 5 121,459,570 (GRCm39) missense possibly damaging 0.90
R1257:Hectd4 UTSW 5 121,456,687 (GRCm39) nonsense probably null
R1391:Hectd4 UTSW 5 121,491,758 (GRCm39) missense possibly damaging 0.96
R1395:Hectd4 UTSW 5 121,466,576 (GRCm39) critical splice donor site probably null
R1468:Hectd4 UTSW 5 121,487,235 (GRCm39) missense possibly damaging 0.65
R1468:Hectd4 UTSW 5 121,487,235 (GRCm39) missense possibly damaging 0.65
R1545:Hectd4 UTSW 5 121,462,019 (GRCm39) missense possibly damaging 0.87
R1553:Hectd4 UTSW 5 121,487,322 (GRCm39) missense probably benign 0.00
R1572:Hectd4 UTSW 5 121,439,941 (GRCm39) missense possibly damaging 0.85
R1662:Hectd4 UTSW 5 121,455,308 (GRCm39) missense probably benign 0.01
R1705:Hectd4 UTSW 5 121,436,167 (GRCm39) missense probably benign
R1715:Hectd4 UTSW 5 121,482,881 (GRCm39) missense possibly damaging 0.85
R1728:Hectd4 UTSW 5 121,439,902 (GRCm39) missense possibly damaging 0.51
R1736:Hectd4 UTSW 5 121,487,593 (GRCm39) missense possibly damaging 0.53
R1768:Hectd4 UTSW 5 121,496,366 (GRCm39) missense possibly damaging 0.70
R1775:Hectd4 UTSW 5 121,429,254 (GRCm39) splice site probably benign
R1784:Hectd4 UTSW 5 121,439,902 (GRCm39) missense possibly damaging 0.51
R1843:Hectd4 UTSW 5 121,435,243 (GRCm39) missense possibly damaging 0.53
R1914:Hectd4 UTSW 5 121,460,357 (GRCm39) missense probably benign 0.08
R1915:Hectd4 UTSW 5 121,460,357 (GRCm39) missense probably benign 0.08
R2024:Hectd4 UTSW 5 121,419,981 (GRCm39) missense possibly damaging 0.86
R2103:Hectd4 UTSW 5 121,493,692 (GRCm39) missense probably benign 0.04
R2108:Hectd4 UTSW 5 121,471,487 (GRCm39) missense possibly damaging 0.72
R2124:Hectd4 UTSW 5 121,456,702 (GRCm39) missense probably damaging 0.97
R2150:Hectd4 UTSW 5 121,391,921 (GRCm39) splice site probably benign
R2192:Hectd4 UTSW 5 121,453,206 (GRCm39) missense possibly damaging 0.46
R2301:Hectd4 UTSW 5 121,491,600 (GRCm39) missense probably benign 0.18
R2324:Hectd4 UTSW 5 121,453,500 (GRCm39) missense probably damaging 1.00
R2331:Hectd4 UTSW 5 121,458,089 (GRCm39) missense probably benign 0.05
R2504:Hectd4 UTSW 5 121,402,030 (GRCm39) missense possibly damaging 0.73
R2504:Hectd4 UTSW 5 121,358,683 (GRCm39) missense unknown
R2904:Hectd4 UTSW 5 121,430,787 (GRCm39) splice site probably benign
R3843:Hectd4 UTSW 5 121,397,936 (GRCm39) missense possibly damaging 0.72
R3934:Hectd4 UTSW 5 121,458,164 (GRCm39) critical splice donor site probably null
R3944:Hectd4 UTSW 5 121,441,588 (GRCm39) splice site probably benign
R4133:Hectd4 UTSW 5 121,415,897 (GRCm39) critical splice donor site probably null
R4271:Hectd4 UTSW 5 121,358,567 (GRCm39) small deletion probably benign
R4413:Hectd4 UTSW 5 121,488,544 (GRCm39) missense possibly damaging 0.53
R4456:Hectd4 UTSW 5 121,446,334 (GRCm39) missense possibly damaging 0.65
R4489:Hectd4 UTSW 5 121,424,320 (GRCm39) missense possibly damaging 0.73
R4539:Hectd4 UTSW 5 121,452,970 (GRCm39) nonsense probably null
R4564:Hectd4 UTSW 5 121,488,494 (GRCm39) missense probably benign 0.33
R4582:Hectd4 UTSW 5 121,424,482 (GRCm39) missense possibly damaging 0.53
R4629:Hectd4 UTSW 5 121,435,266 (GRCm39) missense probably benign 0.01
R4633:Hectd4 UTSW 5 121,487,279 (GRCm39) missense probably benign 0.33
R4643:Hectd4 UTSW 5 121,487,118 (GRCm39) missense possibly damaging 0.53
R4679:Hectd4 UTSW 5 121,463,314 (GRCm39) missense possibly damaging 0.72
R4681:Hectd4 UTSW 5 121,441,678 (GRCm39) missense possibly damaging 0.86
R4734:Hectd4 UTSW 5 121,480,040 (GRCm39) missense possibly damaging 0.53
R4739:Hectd4 UTSW 5 121,486,505 (GRCm39) missense probably benign
R4781:Hectd4 UTSW 5 121,444,170 (GRCm39) critical splice donor site probably null
R4860:Hectd4 UTSW 5 121,443,881 (GRCm39) missense probably benign 0.04
R4860:Hectd4 UTSW 5 121,443,881 (GRCm39) missense probably benign 0.04
R4869:Hectd4 UTSW 5 121,460,735 (GRCm39) missense possibly damaging 0.46
R4909:Hectd4 UTSW 5 121,401,954 (GRCm39) missense probably benign 0.18
R4922:Hectd4 UTSW 5 121,497,378 (GRCm39) missense possibly damaging 0.86
R4925:Hectd4 UTSW 5 121,460,753 (GRCm39) missense possibly damaging 0.83
R5004:Hectd4 UTSW 5 121,467,628 (GRCm39) missense possibly damaging 0.93
R5004:Hectd4 UTSW 5 121,466,262 (GRCm39) splice site probably null
R5129:Hectd4 UTSW 5 121,481,573 (GRCm39) missense possibly damaging 0.87
R5217:Hectd4 UTSW 5 121,491,614 (GRCm39) missense possibly damaging 0.53
R5267:Hectd4 UTSW 5 121,482,887 (GRCm39) missense probably benign 0.28
R5344:Hectd4 UTSW 5 121,481,739 (GRCm39) missense probably benign 0.28
R5345:Hectd4 UTSW 5 121,402,037 (GRCm39) missense possibly damaging 0.85
R5347:Hectd4 UTSW 5 121,442,511 (GRCm39) missense probably benign 0.33
R5360:Hectd4 UTSW 5 121,453,464 (GRCm39) missense possibly damaging 0.90
R5363:Hectd4 UTSW 5 121,448,666 (GRCm39) missense probably benign 0.04
R5445:Hectd4 UTSW 5 121,404,337 (GRCm39) missense probably benign 0.00
R5479:Hectd4 UTSW 5 121,445,011 (GRCm39) missense probably benign
R5507:Hectd4 UTSW 5 121,419,164 (GRCm39) missense unknown
R5552:Hectd4 UTSW 5 121,480,914 (GRCm39) missense possibly damaging 0.96
R5691:Hectd4 UTSW 5 121,486,878 (GRCm39) missense possibly damaging 0.85
R5745:Hectd4 UTSW 5 121,491,565 (GRCm39) missense possibly damaging 0.96
R5757:Hectd4 UTSW 5 121,486,682 (GRCm39) missense possibly damaging 0.72
R5845:Hectd4 UTSW 5 121,445,587 (GRCm39) critical splice donor site probably null
R5869:Hectd4 UTSW 5 121,481,288 (GRCm39) critical splice donor site probably null
R5913:Hectd4 UTSW 5 121,462,037 (GRCm39) missense possibly damaging 0.83
R5920:Hectd4 UTSW 5 121,446,334 (GRCm39) missense possibly damaging 0.65
R5943:Hectd4 UTSW 5 121,460,357 (GRCm39) missense probably benign 0.01
R6219:Hectd4 UTSW 5 121,446,941 (GRCm39) missense possibly damaging 0.92
R6250:Hectd4 UTSW 5 121,477,561 (GRCm39) missense possibly damaging 0.85
R6301:Hectd4 UTSW 5 121,392,283 (GRCm39) missense possibly damaging 0.91
R6428:Hectd4 UTSW 5 121,488,508 (GRCm39) missense possibly damaging 0.53
R6446:Hectd4 UTSW 5 121,472,438 (GRCm39) missense possibly damaging 0.86
R6453:Hectd4 UTSW 5 121,488,655 (GRCm39) missense probably damaging 1.00
R6513:Hectd4 UTSW 5 121,494,259 (GRCm39) splice site probably null
R6540:Hectd4 UTSW 5 121,441,634 (GRCm39) missense probably benign 0.33
R6706:Hectd4 UTSW 5 121,458,147 (GRCm39) missense possibly damaging 0.92
R6720:Hectd4 UTSW 5 121,445,444 (GRCm39) nonsense probably null
R6736:Hectd4 UTSW 5 121,415,788 (GRCm39) missense possibly damaging 0.86
R6776:Hectd4 UTSW 5 121,491,574 (GRCm39) missense possibly damaging 0.85
R7033:Hectd4 UTSW 5 121,502,631 (GRCm39) missense possibly damaging 0.86
R7038:Hectd4 UTSW 5 121,437,660 (GRCm39) missense possibly damaging 0.90
R7175:Hectd4 UTSW 5 121,411,692 (GRCm39) missense possibly damaging 0.85
R7180:Hectd4 UTSW 5 121,446,405 (GRCm39) missense probably benign 0.01
R7234:Hectd4 UTSW 5 121,467,136 (GRCm39) missense possibly damaging 0.53
R7253:Hectd4 UTSW 5 121,452,944 (GRCm39) missense possibly damaging 0.66
R7349:Hectd4 UTSW 5 121,448,726 (GRCm39) missense probably damaging 0.97
R7450:Hectd4 UTSW 5 121,419,995 (GRCm39) missense probably benign 0.00
R7467:Hectd4 UTSW 5 121,462,024 (GRCm39) missense possibly damaging 0.66
R7475:Hectd4 UTSW 5 121,496,196 (GRCm39) splice site probably null
R7482:Hectd4 UTSW 5 121,501,941 (GRCm39) missense possibly damaging 0.71
R7512:Hectd4 UTSW 5 121,435,172 (GRCm39) missense possibly damaging 0.72
R7525:Hectd4 UTSW 5 121,481,728 (GRCm39) missense possibly damaging 0.70
R7559:Hectd4 UTSW 5 121,453,573 (GRCm39) splice site probably null
R7560:Hectd4 UTSW 5 121,392,405 (GRCm39) missense possibly damaging 0.53
R7561:Hectd4 UTSW 5 121,429,288 (GRCm39) missense possibly damaging 0.91
R7576:Hectd4 UTSW 5 121,487,522 (GRCm39) missense possibly damaging 0.91
R7584:Hectd4 UTSW 5 121,456,798 (GRCm39) missense possibly damaging 0.83
R7648:Hectd4 UTSW 5 121,392,434 (GRCm39) missense possibly damaging 0.73
R7663:Hectd4 UTSW 5 121,462,094 (GRCm39) missense probably benign 0.06
R7692:Hectd4 UTSW 5 121,459,627 (GRCm39) missense possibly damaging 0.46
R7725:Hectd4 UTSW 5 121,358,680 (GRCm39) missense unknown
R7731:Hectd4 UTSW 5 121,445,077 (GRCm39) missense probably benign 0.00
R7732:Hectd4 UTSW 5 121,474,692 (GRCm39) missense probably benign 0.14
R7782:Hectd4 UTSW 5 121,443,784 (GRCm39) missense possibly damaging 0.53
R7854:Hectd4 UTSW 5 121,467,631 (GRCm39) missense probably benign 0.27
R7898:Hectd4 UTSW 5 121,469,880 (GRCm39) missense probably benign 0.18
R7910:Hectd4 UTSW 5 121,392,291 (GRCm39) missense possibly damaging 0.86
R7962:Hectd4 UTSW 5 121,448,692 (GRCm39) missense probably damaging 0.98
R8003:Hectd4 UTSW 5 121,477,581 (GRCm39) missense possibly damaging 0.85
R8098:Hectd4 UTSW 5 121,459,461 (GRCm39) missense possibly damaging 0.46
R8110:Hectd4 UTSW 5 121,471,012 (GRCm39) missense possibly damaging 0.96
R8118:Hectd4 UTSW 5 121,424,439 (GRCm39) missense probably benign 0.33
R8171:Hectd4 UTSW 5 121,456,819 (GRCm39) missense possibly damaging 0.82
R8234:Hectd4 UTSW 5 121,477,607 (GRCm39) missense possibly damaging 0.72
R8289:Hectd4 UTSW 5 121,404,424 (GRCm39) missense possibly damaging 0.53
R8292:Hectd4 UTSW 5 121,455,288 (GRCm39) missense possibly damaging 0.66
R8348:Hectd4 UTSW 5 121,358,319 (GRCm39) start gained probably benign
R8397:Hectd4 UTSW 5 121,397,957 (GRCm39) missense probably damaging 0.98
R8436:Hectd4 UTSW 5 121,481,210 (GRCm39) missense probably benign 0.00
R8436:Hectd4 UTSW 5 121,446,421 (GRCm39) missense possibly damaging 0.90
R8443:Hectd4 UTSW 5 121,467,172 (GRCm39) missense possibly damaging 0.72
R8448:Hectd4 UTSW 5 121,358,319 (GRCm39) start gained probably benign
R8516:Hectd4 UTSW 5 121,487,073 (GRCm39) missense possibly damaging 0.53
R8519:Hectd4 UTSW 5 121,442,489 (GRCm39) nonsense probably null
R8553:Hectd4 UTSW 5 121,491,661 (GRCm39) missense possibly damaging 0.73
R8557:Hectd4 UTSW 5 121,448,714 (GRCm39) missense possibly damaging 0.66
R8725:Hectd4 UTSW 5 121,488,557 (GRCm39) missense probably damaging 1.00
R8751:Hectd4 UTSW 5 121,501,838 (GRCm39) nonsense probably null
R8769:Hectd4 UTSW 5 121,419,936 (GRCm39) missense possibly damaging 0.53
R8803:Hectd4 UTSW 5 121,461,994 (GRCm39) missense probably benign 0.01
R8887:Hectd4 UTSW 5 121,433,541 (GRCm39) missense probably benign 0.44
R8982:Hectd4 UTSW 5 121,466,305 (GRCm39) missense probably benign 0.02
R8988:Hectd4 UTSW 5 121,415,819 (GRCm39) missense possibly damaging 0.86
R8991:Hectd4 UTSW 5 121,496,347 (GRCm39) missense probably benign 0.33
R8994:Hectd4 UTSW 5 121,441,629 (GRCm39) missense probably benign 0.33
R8995:Hectd4 UTSW 5 121,392,422 (GRCm39) missense possibly damaging 0.96
R9049:Hectd4 UTSW 5 121,451,955 (GRCm39) missense possibly damaging 0.92
R9093:Hectd4 UTSW 5 121,411,677 (GRCm39) missense probably benign 0.14
R9106:Hectd4 UTSW 5 121,467,619 (GRCm39) missense possibly damaging 0.53
R9137:Hectd4 UTSW 5 121,496,238 (GRCm39) missense possibly damaging 0.53
R9146:Hectd4 UTSW 5 121,487,097 (GRCm39) missense probably benign 0.33
R9154:Hectd4 UTSW 5 121,391,967 (GRCm39) missense
R9162:Hectd4 UTSW 5 121,445,042 (GRCm39) missense possibly damaging 0.66
R9166:Hectd4 UTSW 5 121,446,690 (GRCm39) missense probably damaging 0.96
R9183:Hectd4 UTSW 5 121,437,551 (GRCm39) missense possibly damaging 0.51
R9207:Hectd4 UTSW 5 121,433,496 (GRCm39) missense possibly damaging 0.86
R9291:Hectd4 UTSW 5 121,487,028 (GRCm39) missense probably benign 0.14
R9300:Hectd4 UTSW 5 121,486,952 (GRCm39) missense probably benign 0.33
R9314:Hectd4 UTSW 5 121,437,708 (GRCm39) critical splice donor site probably null
R9381:Hectd4 UTSW 5 121,472,492 (GRCm39) missense possibly damaging 0.53
R9432:Hectd4 UTSW 5 121,460,864 (GRCm39) missense probably benign 0.01
R9491:Hectd4 UTSW 5 121,452,981 (GRCm39) missense probably damaging 0.97
R9532:Hectd4 UTSW 5 121,502,616 (GRCm39) missense probably benign 0.00
R9557:Hectd4 UTSW 5 121,459,617 (GRCm39) missense possibly damaging 0.66
R9561:Hectd4 UTSW 5 121,472,532 (GRCm39) missense possibly damaging 0.53
R9593:Hectd4 UTSW 5 121,424,844 (GRCm39) nonsense probably null
R9704:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9705:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9713:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9726:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9732:Hectd4 UTSW 5 121,392,254 (GRCm39) nonsense probably null
R9750:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9752:Hectd4 UTSW 5 121,472,415 (GRCm39) missense possibly damaging 0.85
R9752:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9772:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
X0026:Hectd4 UTSW 5 121,487,700 (GRCm39) missense probably benign 0.04
X0027:Hectd4 UTSW 5 121,459,467 (GRCm39) missense probably benign 0.27
Z1088:Hectd4 UTSW 5 121,433,566 (GRCm39) splice site probably null
Z1177:Hectd4 UTSW 5 121,496,383 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCTTCGGGAAAGCTGAACT -3'
(R):5'- TGTGCCTAGTGTGGTGTATACA -3'

Sequencing Primer
(F):5'- GCTGAACTTGATTTTGTCTCACAG -3'
(R):5'- CCCTGGAGTTAGGAACTGAACTC -3'
Posted On 2022-10-06