Mutagenetix > Incidental Mutation

Incidental Mutation 'R9712:Hectd4'

730245

Institutional Source

Beutler Lab

Gene Symbol

Hectd4

Ensembl Gene

ENSMUSG00000042744

Gene Name

HECT domain E3 ubiquitin protein ligase 4

Synonyms

Gm15800

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.937) question?

Stock #

R9712 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

121220219-121368577 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 121310681 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 364 (Y364F)

Ref Sequence

ENSEMBL: ENSMUSP00000098332 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042614] [ENSMUST00000100769]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042614
AA Change: Y1701F

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744
AA Change: Y1701F

Domain	Start	End	E-Value	Type
low complexity region	224	234	N/A	INTRINSIC
low complexity region	266	282	N/A	INTRINSIC
low complexity region	553	564	N/A	INTRINSIC
low complexity region	725	735	N/A	INTRINSIC
low complexity region	1252	1265	N/A	INTRINSIC
coiled coil region	1372	1398	N/A	INTRINSIC
low complexity region	1551	1562	N/A	INTRINSIC
low complexity region	1725	1741	N/A	INTRINSIC
low complexity region	1892	1904	N/A	INTRINSIC
low complexity region	2656	2666	N/A	INTRINSIC
low complexity region	2857	2872	N/A	INTRINSIC
low complexity region	2901	2917	N/A	INTRINSIC
low complexity region	2921	2933	N/A	INTRINSIC
low complexity region	3232	3246	N/A	INTRINSIC
low complexity region	3275	3335	N/A	INTRINSIC
low complexity region	3441	3448	N/A	INTRINSIC
low complexity region	3473	3506	N/A	INTRINSIC
low complexity region	3512	3533	N/A	INTRINSIC
low complexity region	3540	3554	N/A	INTRINSIC
low complexity region	3794	3822	N/A	INTRINSIC
HECTc	4048	4412	4.78e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000100769
AA Change: Y364F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000098332
Gene: ENSMUSG00000042744
AA Change: Y364F

Domain	Start	End	E-Value	Type
coiled coil region	35	61	N/A	INTRINSIC
low complexity region	214	225	N/A	INTRINSIC
low complexity region	388	404	N/A	INTRINSIC
low complexity region	555	567	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	A	T	19: 3,715,784	M20L	probably benign	Het
9430007A20Rik	C	T	4: 144,528,784	A258V	probably benign	Het
Abca8b	T	A	11: 109,942,337	D1241V	probably benign	Het
Adam20	G	A	8: 40,795,453	R200H	probably benign	Het
Adcy10	T	C	1: 165,513,112	F229L	probably damaging	Het
Adsl	A	T	15: 80,955,639	N126I	probably benign	Het
Ahnak	AGATCTC	A	19: 9,007,028		probably benign	Het
Ahnak	GATCTCTAT	GAT	19: 9,007,029		probably benign	Het
Aktip	G	A	8: 91,129,727	P41S	probably damaging	Het
Alkbh3	C	A	2: 93,980,973	R258L	probably damaging	Het
Arfgap3	A	G	15: 83,313,533	Y341H	probably benign	Het
Arhgef26	C	T	3: 62,423,613	L583F	probably damaging	Het
Arhgef40	T	C	14: 51,988,958	I153T	probably damaging	Het
Atp1a1	T	C	3: 101,591,441	S179G	probably benign	Het
Bok	T	C	1: 93,686,507	S21P	probably damaging	Het
C130060K24Rik	A	G	6: 65,456,140	I315V	probably benign	Het
Ccdc136	A	G	6: 29,417,442	E754G	probably benign	Het
Cers3	A	G	7: 66,773,630	K108E	probably benign	Het
Cmya5	T	C	13: 93,065,373		probably null	Het
Col19a1	T	C	1: 24,328,067	E478G	possibly damaging	Het
Colec10	T	A	15: 54,459,784	S134R	possibly damaging	Het
Ctnnb1	A	T	9: 120,955,829	I514F	probably damaging	Het
Cux1	C	T	5: 136,309,819	E664K	probably benign	Het
Dars	T	C	1: 128,405,462	Q75R	probably benign	Het
Disp1	T	A	1: 183,135,815	S16C	probably damaging	Het
Dnah7a	A	T	1: 53,559,140	V1412E	probably benign	Het
Ect2l	C	T	10: 18,168,434	V226I	probably benign	Het
Ep400	T	A	5: 110,756,643	H30L	unknown	Het
Ephx4	A	G	5: 107,419,781	I202V	probably benign	Het
Exoc3	A	T	13: 74,192,908	F259Y	probably damaging	Het
Ezr	T	C	17: 6,752,995	E229G	probably damaging	Het
Fat1	A	T	8: 45,017,380	I1472L	probably benign	Het
Fsd1l	T	G	4: 53,679,972	D223E	probably benign	Het
Gata6	A	T	18: 11,059,064	D377V	possibly damaging	Het
Gm12185	A	T	11: 48,907,389	M759K	probably benign	Het
Gm21994	C	T	2: 150,254,576	R311Q	probably benign	Het
Gm9922	C	T	14: 101,729,457	A120T	unknown	Het
Hnrnph1	A	G	11: 50,385,869	S465G	unknown	Het
Ifi204	T	C	1: 173,749,358	Y559C	probably damaging	Het
Ift88	T	C	14: 57,481,396	S613P	probably damaging	Het
Kif21a	G	C	15: 90,985,325	A441G	probably damaging	Het
Kif21a	G	T	15: 90,995,512	T191K	probably benign	Het
Lrit1	T	A	14: 37,060,127	C252*	probably null	Het
Ncbp1	T	A	4: 46,144,837	D29E	probably benign	Het
Nlrp10	A	T	7: 108,925,528	D248E	probably damaging	Het
Nphp4	T	G	4: 152,547,064	V807G	probably benign	Het
Nsd1	T	C	13: 55,246,043	S589P	possibly damaging	Het
Oas1b	T	A	5: 120,814,485	N80K	probably damaging	Het
Olfr1055	G	A	2: 86,347,239	H176Y	probably benign	Het
Olfr1135	A	T	2: 87,671,761	I202N	probably benign	Het
Oprk1	T	A	1: 5,598,873	C181S	probably damaging	Het
Oprl1	T	A	2: 181,718,419	N89K	probably damaging	Het
Pdcd11	A	G	19: 47,129,302	K1697E	probably damaging	Het
Pdp1	G	A	4: 11,961,607	H254Y	probably benign	Het
Pds5b	A	T	5: 150,805,663	D1419V	possibly damaging	Het
Per1	G	T	11: 69,100,649	G3V	probably benign	Het
Pex16	C	A	2: 92,376,643	N55K	probably damaging	Het
Phldb2	C	A	16: 45,774,977	L862F	probably benign	Het
Pld5	T	A	1: 175,964,006	D478V	probably benign	Het
Pms2	T	C	5: 143,914,796	I177T	probably damaging	Het
Pou1f1	A	T	16: 65,529,872	E119D	probably benign	Het
Ppp2r1a	A	C	17: 20,958,796	E295A	probably damaging	Het
Rad51ap2	A	T	12: 11,457,592	N505I	possibly damaging	Het
Rasal3	A	C	17: 32,396,562	V434G	probably damaging	Het
Rasgrf2	C	T	13: 91,987,973	V6M		Het
Rwdd1	A	T	10: 34,001,156	D197E		Het
Scn11a	A	T	9: 119,790,010	C755*	probably null	Het
Skil	T	C	3: 31,116,860	S443P	probably benign	Het
Slc12a6	T	C	2: 112,356,472	C939R	probably damaging	Het
Slc25a36	A	G	9: 97,079,177	S269P	probably benign	Het
Srrm4	T	A	5: 116,482,393	H92L	unknown	Het
Styk1	CTCTTCATGATTTTCTT	CTCTT	6: 131,301,649		probably benign	Het
Tbc1d4	A	T	14: 101,507,410	V260E	probably benign	Het
Tbc1d8	T	C	1: 39,385,232	N593D	probably damaging	Het
Trex1	C	A	9: 109,058,737	R62L	probably damaging	Het
Trpm3	A	T	19: 22,715,352	D269V	possibly damaging	Het
Trpv4	G	T	5: 114,633,150	Y439*	probably null	Het
Ttn	G	A	2: 76,734,248	T28515I	probably damaging	Het
Ucn2	G	A	9: 108,986,503	G111D	probably damaging	Het
Uhrf2	A	G	19: 30,056,481	I212V	possibly damaging	Het
Usp24	T	A	4: 106,347,367	M261K	probably benign	Het
Vmn1r235	A	T	17: 21,261,698	D95V	probably benign	Het
Vwf	G	A	6: 125,624,573	R826Q		Het
Zfp28	T	C	7: 6,393,879	C438R	probably damaging	Het

Other mutations in Hectd4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Hectd4	APN	5	121363870	missense	possibly damaging	0.51
IGL00976:Hectd4	APN	5	121349106	missense	probably benign	0.18
IGL01085:Hectd4	APN	5	121331701	missense	probably damaging	1.00
IGL01112:Hectd4	APN	5	121306950	missense	probably benign	0.01
IGL01402:Hectd4	APN	5	121339417	splice site	probably benign
IGL01474:Hectd4	APN	5	121336649	missense	possibly damaging	0.53
IGL01503:Hectd4	APN	5	121318651	missense	probably benign	0.28
IGL01548:Hectd4	APN	5	121364660	missense	possibly damaging	0.71
IGL01656:Hectd4	APN	5	121322700	missense	probably damaging	0.99
IGL01756:Hectd4	APN	5	121344824	missense	probably benign	0.28
IGL01819:Hectd4	APN	5	121328418	missense	possibly damaging	0.85
IGL02080:Hectd4	APN	5	121366606	utr 3 prime	probably benign
IGL02488:Hectd4	APN	5	121292087	missense	probably benign	0.33
IGL02490:Hectd4	APN	5	121318613	missense	possibly damaging	0.82
IGL02558:Hectd4	APN	5	121344785	missense	probably benign	0.28
IGL02626:Hectd4	APN	5	121353881	missense	possibly damaging	0.86
IGL02649:Hectd4	APN	5	121349402	missense	possibly damaging	0.73
IGL02736:Hectd4	APN	5	121342719	missense	possibly damaging	0.73
IGL02861:Hectd4	APN	5	121307004	missense	possibly damaging	0.81
IGL02880:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL02889:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL02953:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL02969:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL03031:Hectd4	APN	5	121348794	missense	possibly damaging	0.96
IGL03066:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL03160:Hectd4	APN	5	121259879	missense	probably benign
IGL03181:Hectd4	APN	5	121353958	missense	possibly damaging	0.91
IGL03265:Hectd4	APN	5	121259939	splice site	probably benign
IGL03375:Hectd4	APN	5	121328382	missense	possibly damaging	0.72
Achilles	UTSW	5	121307381	nonsense	probably null
agamemnon	UTSW	5	121253858	splice site	probably benign
clymnestra	UTSW	5	121334375	missense	possibly damaging	0.86
hector	UTSW	5	121315437	missense	probably damaging	1.00
helen	UTSW	5	121310663	missense	probably damaging	0.97
Merriwether	UTSW	5	121353551	missense	possibly damaging	0.53
PIT4466001:Hectd4	UTSW	5	121333060	critical splice donor site	probably null
R0018:Hectd4	UTSW	5	121254179	missense	possibly damaging	0.53
R0024:Hectd4	UTSW	5	121308576	missense	possibly damaging	0.92
R0030:Hectd4	UTSW	5	121262588	nonsense	probably null
R0080:Hectd4	UTSW	5	121349372	missense	probably benign	0.18
R0110:Hectd4	UTSW	5	121281896	missense	possibly damaging	0.90
R0110:Hectd4	UTSW	5	121305673	missense	possibly damaging	0.53
R0115:Hectd4	UTSW	5	121295506	splice site	probably benign
R0128:Hectd4	UTSW	5	121349243	missense	possibly damaging	0.86
R0131:Hectd4	UTSW	5	121333024	missense	probably benign	0.44
R0131:Hectd4	UTSW	5	121333024	missense	probably benign	0.44
R0132:Hectd4	UTSW	5	121333024	missense	probably benign	0.44
R0244:Hectd4	UTSW	5	121329605	missense	probably benign	0.33
R0281:Hectd4	UTSW	5	121254251	missense	possibly damaging	0.85
R0329:Hectd4	UTSW	5	121259864	missense	probably benign
R0410:Hectd4	UTSW	5	121286266	missense	possibly damaging	0.86
R0422:Hectd4	UTSW	5	121343082	splice site	probably null
R0442:Hectd4	UTSW	5	121323982	missense	possibly damaging	0.66
R0449:Hectd4	UTSW	5	121364590	splice site	probably null
R0469:Hectd4	UTSW	5	121281896	missense	possibly damaging	0.90
R0469:Hectd4	UTSW	5	121305673	missense	possibly damaging	0.53
R0481:Hectd4	UTSW	5	121295506	splice site	probably benign
R0510:Hectd4	UTSW	5	121281896	missense	possibly damaging	0.90
R0510:Hectd4	UTSW	5	121305673	missense	possibly damaging	0.53
R0520:Hectd4	UTSW	5	121331707	missense	possibly damaging	0.53
R0534:Hectd4	UTSW	5	121348476	missense	possibly damaging	0.96
R0603:Hectd4	UTSW	5	121304337	missense	possibly damaging	0.46
R0617:Hectd4	UTSW	5	121343232	splice site	probably benign
R0622:Hectd4	UTSW	5	121348625	missense	possibly damaging	0.53
R0626:Hectd4	UTSW	5	121277824	missense	probably benign	0.18
R0708:Hectd4	UTSW	5	121286463	critical splice donor site	probably null
R0710:Hectd4	UTSW	5	121336628	missense	probably benign	0.08
R0763:Hectd4	UTSW	5	121307033	unclassified	probably benign
R0764:Hectd4	UTSW	5	121286769	missense	possibly damaging	0.46
R1123:Hectd4	UTSW	5	121286736	missense	probably damaging	0.96
R1129:Hectd4	UTSW	5	121310599	missense	possibly damaging	0.66
R1204:Hectd4	UTSW	5	121350485	missense	possibly damaging	0.85
R1237:Hectd4	UTSW	5	121321507	missense	possibly damaging	0.90
R1257:Hectd4	UTSW	5	121318624	nonsense	probably null
R1391:Hectd4	UTSW	5	121353695	missense	possibly damaging	0.96
R1395:Hectd4	UTSW	5	121328513	critical splice donor site	probably null
R1468:Hectd4	UTSW	5	121349172	missense	possibly damaging	0.65
R1468:Hectd4	UTSW	5	121349172	missense	possibly damaging	0.65
R1545:Hectd4	UTSW	5	121323956	missense	possibly damaging	0.87
R1553:Hectd4	UTSW	5	121349259	missense	probably benign	0.00
R1572:Hectd4	UTSW	5	121301878	missense	possibly damaging	0.85
R1662:Hectd4	UTSW	5	121317245	missense	probably benign	0.01
R1705:Hectd4	UTSW	5	121298104	missense	probably benign
R1715:Hectd4	UTSW	5	121344818	missense	possibly damaging	0.85
R1728:Hectd4	UTSW	5	121301839	missense	possibly damaging	0.51
R1736:Hectd4	UTSW	5	121349530	missense	possibly damaging	0.53
R1768:Hectd4	UTSW	5	121358303	missense	possibly damaging	0.70
R1775:Hectd4	UTSW	5	121291191	splice site	probably benign
R1784:Hectd4	UTSW	5	121301839	missense	possibly damaging	0.51
R1843:Hectd4	UTSW	5	121297180	missense	possibly damaging	0.53
R1914:Hectd4	UTSW	5	121322294	missense	probably benign	0.08
R1915:Hectd4	UTSW	5	121322294	missense	probably benign	0.08
R2024:Hectd4	UTSW	5	121281918	missense	possibly damaging	0.86
R2103:Hectd4	UTSW	5	121355629	missense	probably benign	0.04
R2108:Hectd4	UTSW	5	121333424	missense	possibly damaging	0.72
R2124:Hectd4	UTSW	5	121318639	missense	probably damaging	0.97
R2150:Hectd4	UTSW	5	121253858	splice site	probably benign
R2192:Hectd4	UTSW	5	121315143	missense	possibly damaging	0.46
R2301:Hectd4	UTSW	5	121353537	missense	probably benign	0.18
R2324:Hectd4	UTSW	5	121315437	missense	probably damaging	1.00
R2331:Hectd4	UTSW	5	121320026	missense	probably benign	0.05
R2504:Hectd4	UTSW	5	121220620	missense	unknown
R2504:Hectd4	UTSW	5	121263967	missense	possibly damaging	0.73
R2904:Hectd4	UTSW	5	121292724	splice site	probably benign
R3843:Hectd4	UTSW	5	121259873	missense	possibly damaging	0.72
R3934:Hectd4	UTSW	5	121320101	critical splice donor site	probably null
R3944:Hectd4	UTSW	5	121303525	splice site	probably benign
R4133:Hectd4	UTSW	5	121277834	critical splice donor site	probably null
R4271:Hectd4	UTSW	5	121220504	small deletion	probably benign
R4413:Hectd4	UTSW	5	121350481	missense	possibly damaging	0.53
R4456:Hectd4	UTSW	5	121308271	missense	possibly damaging	0.65
R4489:Hectd4	UTSW	5	121286257	missense	possibly damaging	0.73
R4539:Hectd4	UTSW	5	121314907	nonsense	probably null
R4564:Hectd4	UTSW	5	121350431	missense	probably benign	0.33
R4582:Hectd4	UTSW	5	121286419	missense	possibly damaging	0.53
R4629:Hectd4	UTSW	5	121297203	missense	probably benign	0.01
R4633:Hectd4	UTSW	5	121349216	missense	probably benign	0.33
R4643:Hectd4	UTSW	5	121349055	missense	possibly damaging	0.53
R4679:Hectd4	UTSW	5	121325251	missense	possibly damaging	0.72
R4681:Hectd4	UTSW	5	121303615	missense	possibly damaging	0.86
R4734:Hectd4	UTSW	5	121341977	missense	possibly damaging	0.53
R4739:Hectd4	UTSW	5	121348442	missense	probably benign
R4781:Hectd4	UTSW	5	121306107	critical splice donor site	probably null
R4860:Hectd4	UTSW	5	121305818	missense	probably benign	0.04
R4860:Hectd4	UTSW	5	121305818	missense	probably benign	0.04
R4869:Hectd4	UTSW	5	121322672	missense	possibly damaging	0.46
R4909:Hectd4	UTSW	5	121263891	missense	probably benign	0.18
R4922:Hectd4	UTSW	5	121359315	missense	possibly damaging	0.86
R4925:Hectd4	UTSW	5	121322690	missense	possibly damaging	0.83
R5004:Hectd4	UTSW	5	121328199	splice site	probably null
R5004:Hectd4	UTSW	5	121329565	missense	possibly damaging	0.93
R5129:Hectd4	UTSW	5	121343510	missense	possibly damaging	0.87
R5217:Hectd4	UTSW	5	121353551	missense	possibly damaging	0.53
R5267:Hectd4	UTSW	5	121344824	missense	probably benign	0.28
R5344:Hectd4	UTSW	5	121343676	missense	probably benign	0.28
R5345:Hectd4	UTSW	5	121263974	missense	possibly damaging	0.85
R5347:Hectd4	UTSW	5	121304448	missense	probably benign	0.33
R5360:Hectd4	UTSW	5	121315401	missense	possibly damaging	0.90
R5363:Hectd4	UTSW	5	121310603	missense	probably benign	0.04
R5445:Hectd4	UTSW	5	121266274	missense	probably benign	0.00
R5479:Hectd4	UTSW	5	121306948	missense	probably benign
R5507:Hectd4	UTSW	5	121281101	missense	unknown
R5552:Hectd4	UTSW	5	121342851	missense	possibly damaging	0.96
R5691:Hectd4	UTSW	5	121348815	missense	possibly damaging	0.85
R5745:Hectd4	UTSW	5	121353502	missense	possibly damaging	0.96
R5757:Hectd4	UTSW	5	121348619	missense	possibly damaging	0.72
R5845:Hectd4	UTSW	5	121307524	critical splice donor site	probably null
R5869:Hectd4	UTSW	5	121343225	critical splice donor site	probably null
R5913:Hectd4	UTSW	5	121323974	missense	possibly damaging	0.83
R5920:Hectd4	UTSW	5	121308271	missense	possibly damaging	0.65
R5943:Hectd4	UTSW	5	121322294	missense	probably benign	0.01
R6219:Hectd4	UTSW	5	121308878	missense	possibly damaging	0.92
R6250:Hectd4	UTSW	5	121339498	missense	possibly damaging	0.85
R6301:Hectd4	UTSW	5	121254220	missense	possibly damaging	0.91
R6428:Hectd4	UTSW	5	121350445	missense	possibly damaging	0.53
R6446:Hectd4	UTSW	5	121334375	missense	possibly damaging	0.86
R6453:Hectd4	UTSW	5	121350592	missense	probably damaging	1.00
R6513:Hectd4	UTSW	5	121356196	splice site	probably null
R6540:Hectd4	UTSW	5	121303571	missense	probably benign	0.33
R6706:Hectd4	UTSW	5	121320084	missense	possibly damaging	0.92
R6720:Hectd4	UTSW	5	121307381	nonsense	probably null
R6736:Hectd4	UTSW	5	121277725	missense	possibly damaging	0.86
R6776:Hectd4	UTSW	5	121353511	missense	possibly damaging	0.85
R7033:Hectd4	UTSW	5	121364568	missense	possibly damaging	0.86
R7038:Hectd4	UTSW	5	121299597	missense	possibly damaging	0.90
R7175:Hectd4	UTSW	5	121273629	missense	possibly damaging	0.85
R7180:Hectd4	UTSW	5	121308342	missense	probably benign	0.01
R7234:Hectd4	UTSW	5	121329073	missense	possibly damaging	0.53
R7253:Hectd4	UTSW	5	121314881	missense	possibly damaging	0.66
R7349:Hectd4	UTSW	5	121310663	missense	probably damaging	0.97
R7450:Hectd4	UTSW	5	121281932	missense	probably benign	0.00
R7467:Hectd4	UTSW	5	121323961	missense	possibly damaging	0.66
R7475:Hectd4	UTSW	5	121358133	splice site	probably null
R7482:Hectd4	UTSW	5	121363878	missense	possibly damaging	0.71
R7512:Hectd4	UTSW	5	121297109	missense	possibly damaging	0.72
R7525:Hectd4	UTSW	5	121343665	missense	possibly damaging	0.70
R7559:Hectd4	UTSW	5	121315510	splice site	probably null
R7560:Hectd4	UTSW	5	121254342	missense	possibly damaging	0.53
R7561:Hectd4	UTSW	5	121291225	missense	possibly damaging	0.91
R7576:Hectd4	UTSW	5	121349459	missense	possibly damaging	0.91
R7584:Hectd4	UTSW	5	121318735	missense	possibly damaging	0.83
R7648:Hectd4	UTSW	5	121254371	missense	possibly damaging	0.73
R7663:Hectd4	UTSW	5	121324031	missense	probably benign	0.06
R7692:Hectd4	UTSW	5	121321564	missense	possibly damaging	0.46
R7725:Hectd4	UTSW	5	121220617	missense	unknown
R7731:Hectd4	UTSW	5	121307014	missense	probably benign	0.00
R7732:Hectd4	UTSW	5	121336629	missense	probably benign	0.14
R7782:Hectd4	UTSW	5	121305721	missense	possibly damaging	0.53
R7854:Hectd4	UTSW	5	121329568	missense	probably benign	0.27
R7898:Hectd4	UTSW	5	121331817	missense	probably benign	0.18
R7910:Hectd4	UTSW	5	121254228	missense	possibly damaging	0.86
R7962:Hectd4	UTSW	5	121310629	missense	probably damaging	0.98
R8003:Hectd4	UTSW	5	121339518	missense	possibly damaging	0.85
R8098:Hectd4	UTSW	5	121321398	missense	possibly damaging	0.46
R8110:Hectd4	UTSW	5	121332949	missense	possibly damaging	0.96
R8118:Hectd4	UTSW	5	121286376	missense	probably benign	0.33
R8171:Hectd4	UTSW	5	121318756	missense	possibly damaging	0.82
R8234:Hectd4	UTSW	5	121339544	missense	possibly damaging	0.72
R8289:Hectd4	UTSW	5	121266361	missense	possibly damaging	0.53
R8292:Hectd4	UTSW	5	121317225	missense	possibly damaging	0.66
R8348:Hectd4	UTSW	5	121220256	start gained	probably benign
R8397:Hectd4	UTSW	5	121259894	missense	probably damaging	0.98
R8436:Hectd4	UTSW	5	121308358	missense	possibly damaging	0.90
R8436:Hectd4	UTSW	5	121343147	missense	probably benign	0.00
R8443:Hectd4	UTSW	5	121329109	missense	possibly damaging	0.72
R8448:Hectd4	UTSW	5	121220256	start gained	probably benign
R8516:Hectd4	UTSW	5	121349010	missense	possibly damaging	0.53
R8519:Hectd4	UTSW	5	121304426	nonsense	probably null
R8553:Hectd4	UTSW	5	121353598	missense	possibly damaging	0.73
R8557:Hectd4	UTSW	5	121310651	missense	possibly damaging	0.66
R8725:Hectd4	UTSW	5	121350494	missense	probably damaging	1.00
R8751:Hectd4	UTSW	5	121363775	nonsense	probably null
R8769:Hectd4	UTSW	5	121281873	missense	possibly damaging	0.53
R8803:Hectd4	UTSW	5	121323931	missense	probably benign	0.01
R8887:Hectd4	UTSW	5	121295478	missense	probably benign	0.44
R8982:Hectd4	UTSW	5	121328242	missense	probably benign	0.02
R8988:Hectd4	UTSW	5	121277756	missense	possibly damaging	0.86
R8991:Hectd4	UTSW	5	121358284	missense	probably benign	0.33
R8994:Hectd4	UTSW	5	121303566	missense	probably benign	0.33
R8995:Hectd4	UTSW	5	121254359	missense	possibly damaging	0.96
R9049:Hectd4	UTSW	5	121313892	missense	possibly damaging	0.92
R9093:Hectd4	UTSW	5	121273614	missense	probably benign	0.14
R9106:Hectd4	UTSW	5	121329556	missense	possibly damaging	0.53
R9137:Hectd4	UTSW	5	121358175	missense	possibly damaging	0.53
R9146:Hectd4	UTSW	5	121349034	missense	probably benign	0.33
R9154:Hectd4	UTSW	5	121253904	missense
R9162:Hectd4	UTSW	5	121306979	missense	possibly damaging	0.66
R9166:Hectd4	UTSW	5	121308627	missense	probably damaging	0.96
R9183:Hectd4	UTSW	5	121299488	missense	possibly damaging	0.51
R9207:Hectd4	UTSW	5	121295433	missense	possibly damaging	0.86
R9291:Hectd4	UTSW	5	121348965	missense	probably benign	0.14
R9300:Hectd4	UTSW	5	121348889	missense	probably benign	0.33
R9314:Hectd4	UTSW	5	121299645	critical splice donor site	probably null
R9381:Hectd4	UTSW	5	121334429	missense	possibly damaging	0.53
R9432:Hectd4	UTSW	5	121322801	missense	probably benign	0.01
R9491:Hectd4	UTSW	5	121314918	missense	probably damaging	0.97
R9532:Hectd4	UTSW	5	121364553	missense	probably benign	0.00
R9557:Hectd4	UTSW	5	121321554	missense	possibly damaging	0.66
R9561:Hectd4	UTSW	5	121334469	missense	possibly damaging	0.53
R9593:Hectd4	UTSW	5	121286781	nonsense	probably null
R9704:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9705:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9713:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9726:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9732:Hectd4	UTSW	5	121254191	nonsense	probably null
R9750:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9752:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9752:Hectd4	UTSW	5	121334352	missense	possibly damaging	0.85
R9772:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
X0026:Hectd4	UTSW	5	121349637	missense	probably benign	0.04
X0027:Hectd4	UTSW	5	121321404	missense	probably benign	0.27
Z1088:Hectd4	UTSW	5	121295503	splice site	probably null
Z1177:Hectd4	UTSW	5	121358320	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGTCTTCGGGAAAGCTGAACT -3'
(R):5'- TGTGCCTAGTGTGGTGTATACA -3'

Sequencing Primer
(F):5'- GCTGAACTTGATTTTGTCTCACAG -3'
(R):5'- CCCTGGAGTTAGGAACTGAACTC -3'

Posted On

2022-10-06