Mutagenetix > Incidental Mutation

Incidental Mutation 'R9712:Cux1'

730246

Institutional Source

Beutler Lab

Gene Symbol

Cux1

Ensembl Gene

ENSMUSG00000029705

Gene Name

cut-like homeobox 1

Synonyms

Cux-1, Cutl1, CDP, Cux

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.883) question?

Stock #

R9712 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

136248135-136567490 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 136309819 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 664 (E664K)

Ref Sequence

ENSEMBL: ENSMUSP00000135086 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004097] [ENSMUST00000175918] [ENSMUST00000175975] [ENSMUST00000175998] [ENSMUST00000176172] [ENSMUST00000176216] [ENSMUST00000176423] [ENSMUST00000176745] [ENSMUST00000176778] [ENSMUST00000177297]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000004097
AA Change: E573K

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000004097
Gene: ENSMUSG00000029705
AA Change: E573K

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
low complexity region	425	436	N/A	INTRINSIC
CUT	452	538	5.06e-39	SMART
low complexity region	602	608	N/A	INTRINSIC
low complexity region	620	642	N/A	INTRINSIC
CUT	841	929	3.31e-43	SMART
low complexity region	956	972	N/A	INTRINSIC
low complexity region	990	1011	N/A	INTRINSIC
CUT	1024	1110	3.78e-38	SMART
HOX	1150	1212	6.32e-15	SMART
low complexity region	1224	1239	N/A	INTRINSIC
low complexity region	1317	1379	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000175918

SMART Domains

Protein: ENSMUSP00000135606
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	73	328	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000175975
AA Change: E651K

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000135223
Gene: ENSMUSG00000029705
AA Change: E651K

Domain	Start	End	E-Value	Type
coiled coil region	1	169	N/A	INTRINSIC
low complexity region	235	251	N/A	INTRINSIC
low complexity region	277	289	N/A	INTRINSIC
low complexity region	331	342	N/A	INTRINSIC
CUT	358	444	5.06e-39	SMART
low complexity region	508	514	N/A	INTRINSIC
low complexity region	526	548	N/A	INTRINSIC
CUT	747	835	3.31e-43	SMART
low complexity region	862	878	N/A	INTRINSIC
low complexity region	896	917	N/A	INTRINSIC
CUT	930	1016	3.78e-38	SMART
HOX	1056	1118	6.32e-15	SMART
low complexity region	1130	1145	N/A	INTRINSIC
low complexity region	1223	1285	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000175998

SMART Domains

Protein: ENSMUSP00000135816
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	1	39	N/A	INTRINSIC
low complexity region	52	64	N/A	INTRINSIC
coiled coil region	76	148	N/A	INTRINSIC
Pfam:CASP_C	204	430	8.6e-72	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176172
AA Change: E664K

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000135086
Gene: ENSMUSG00000029705
AA Change: E664K

Domain	Start	End	E-Value	Type
coiled coil region	99	354	N/A	INTRINSIC
low complexity region	420	436	N/A	INTRINSIC
low complexity region	462	474	N/A	INTRINSIC
low complexity region	516	527	N/A	INTRINSIC
CUT	543	629	5.06e-39	SMART
low complexity region	693	699	N/A	INTRINSIC
low complexity region	711	733	N/A	INTRINSIC
CUT	932	1020	3.31e-43	SMART
low complexity region	1047	1063	N/A	INTRINSIC
low complexity region	1081	1102	N/A	INTRINSIC
CUT	1115	1201	3.78e-38	SMART
HOX	1241	1303	6.32e-15	SMART
low complexity region	1315	1330	N/A	INTRINSIC
low complexity region	1408	1470	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176216

SMART Domains

Protein: ENSMUSP00000135054
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
internal_repeat_1	369	390	9.35e-5	PROSPERO
Pfam:CASP_C	421	647	1.2e-71	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176423

SMART Domains

Protein: ENSMUSP00000135036
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	1	39	N/A	INTRINSIC
low complexity region	52	64	N/A	INTRINSIC
coiled coil region	76	148	N/A	INTRINSIC
low complexity region	217	226	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000135370
Gene: ENSMUSG00000029705
AA Change: E535K

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	363	N/A	INTRINSIC
low complexity region	429	445	N/A	INTRINSIC
low complexity region	471	483	N/A	INTRINSIC
low complexity region	525	536	N/A	INTRINSIC
CUT	552	638	5.06e-39	SMART
Blast:CUT	641	840	3e-50	BLAST
CUT	919	1007	3.31e-43	SMART
low complexity region	1034	1050	N/A	INTRINSIC
low complexity region	1068	1089	N/A	INTRINSIC
CUT	1102	1188	3.78e-38	SMART
HOX	1228	1290	6.32e-15	SMART
low complexity region	1302	1317	N/A	INTRINSIC
low complexity region	1395	1457	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176745

SMART Domains

Protein: ENSMUSP00000135512
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	363	N/A	INTRINSIC
internal_repeat_1	367	388	8.95e-5	PROSPERO
Pfam:CASP_C	419	645	1.2e-71	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000176778
AA Change: E656K

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000135892
Gene: ENSMUSG00000029705
AA Change: E656K

Domain	Start	End	E-Value	Type
low complexity region	78	86	N/A	INTRINSIC
coiled coil region	195	448	N/A	INTRINSIC
low complexity region	508	519	N/A	INTRINSIC
CUT	535	621	5.06e-39	SMART
low complexity region	685	691	N/A	INTRINSIC
low complexity region	703	725	N/A	INTRINSIC
CUT	924	1012	3.31e-43	SMART
low complexity region	1039	1055	N/A	INTRINSIC
low complexity region	1073	1094	N/A	INTRINSIC
CUT	1107	1193	3.78e-38	SMART
HOX	1233	1295	6.32e-15	SMART
low complexity region	1307	1322	N/A	INTRINSIC
low complexity region	1400	1462	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177297

SMART Domains

Protein: ENSMUSP00000134819
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
internal_repeat_1	369	390	8.99e-6	PROSPERO
Pfam:CASP_C	422	527	1.8e-17	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	A	T	19: 3,715,784	M20L	probably benign	Het
9430007A20Rik	C	T	4: 144,528,784	A258V	probably benign	Het
Abca8b	T	A	11: 109,942,337	D1241V	probably benign	Het
Adam20	G	A	8: 40,795,453	R200H	probably benign	Het
Adcy10	T	C	1: 165,513,112	F229L	probably damaging	Het
Adsl	A	T	15: 80,955,639	N126I	probably benign	Het
Ahnak	AGATCTC	A	19: 9,007,028		probably benign	Het
Ahnak	GATCTCTAT	GAT	19: 9,007,029		probably benign	Het
Aktip	G	A	8: 91,129,727	P41S	probably damaging	Het
Alkbh3	C	A	2: 93,980,973	R258L	probably damaging	Het
Arfgap3	A	G	15: 83,313,533	Y341H	probably benign	Het
Arhgef26	C	T	3: 62,423,613	L583F	probably damaging	Het
Arhgef40	T	C	14: 51,988,958	I153T	probably damaging	Het
Atp1a1	T	C	3: 101,591,441	S179G	probably benign	Het
Bok	T	C	1: 93,686,507	S21P	probably damaging	Het
C130060K24Rik	A	G	6: 65,456,140	I315V	probably benign	Het
Ccdc136	A	G	6: 29,417,442	E754G	probably benign	Het
Cers3	A	G	7: 66,773,630	K108E	probably benign	Het
Cmya5	T	C	13: 93,065,373		probably null	Het
Col19a1	T	C	1: 24,328,067	E478G	possibly damaging	Het
Colec10	T	A	15: 54,459,784	S134R	possibly damaging	Het
Ctnnb1	A	T	9: 120,955,829	I514F	probably damaging	Het
Dars	T	C	1: 128,405,462	Q75R	probably benign	Het
Disp1	T	A	1: 183,135,815	S16C	probably damaging	Het
Dnah7a	A	T	1: 53,559,140	V1412E	probably benign	Het
Ect2l	C	T	10: 18,168,434	V226I	probably benign	Het
Ep400	T	A	5: 110,756,643	H30L	unknown	Het
Ephx4	A	G	5: 107,419,781	I202V	probably benign	Het
Exoc3	A	T	13: 74,192,908	F259Y	probably damaging	Het
Ezr	T	C	17: 6,752,995	E229G	probably damaging	Het
Fat1	A	T	8: 45,017,380	I1472L	probably benign	Het
Fsd1l	T	G	4: 53,679,972	D223E	probably benign	Het
Gata6	A	T	18: 11,059,064	D377V	possibly damaging	Het
Gm12185	A	T	11: 48,907,389	M759K	probably benign	Het
Gm21994	C	T	2: 150,254,576	R311Q	probably benign	Het
Gm9922	C	T	14: 101,729,457	A120T	unknown	Het
Hectd4	A	T	5: 121,310,681	Y364F	probably benign	Het
Hnrnph1	A	G	11: 50,385,869	S465G	unknown	Het
Ifi204	T	C	1: 173,749,358	Y559C	probably damaging	Het
Ift88	T	C	14: 57,481,396	S613P	probably damaging	Het
Kif21a	G	C	15: 90,985,325	A441G	probably damaging	Het
Kif21a	G	T	15: 90,995,512	T191K	probably benign	Het
Lrit1	T	A	14: 37,060,127	C252*	probably null	Het
Ncbp1	T	A	4: 46,144,837	D29E	probably benign	Het
Nlrp10	A	T	7: 108,925,528	D248E	probably damaging	Het
Nphp4	T	G	4: 152,547,064	V807G	probably benign	Het
Nsd1	T	C	13: 55,246,043	S589P	possibly damaging	Het
Oas1b	T	A	5: 120,814,485	N80K	probably damaging	Het
Olfr1055	G	A	2: 86,347,239	H176Y	probably benign	Het
Olfr1135	A	T	2: 87,671,761	I202N	probably benign	Het
Oprk1	T	A	1: 5,598,873	C181S	probably damaging	Het
Oprl1	T	A	2: 181,718,419	N89K	probably damaging	Het
Pdcd11	A	G	19: 47,129,302	K1697E	probably damaging	Het
Pdp1	G	A	4: 11,961,607	H254Y	probably benign	Het
Pds5b	A	T	5: 150,805,663	D1419V	possibly damaging	Het
Per1	G	T	11: 69,100,649	G3V	probably benign	Het
Pex16	C	A	2: 92,376,643	N55K	probably damaging	Het
Phldb2	C	A	16: 45,774,977	L862F	probably benign	Het
Pld5	T	A	1: 175,964,006	D478V	probably benign	Het
Pms2	T	C	5: 143,914,796	I177T	probably damaging	Het
Pou1f1	A	T	16: 65,529,872	E119D	probably benign	Het
Ppp2r1a	A	C	17: 20,958,796	E295A	probably damaging	Het
Rad51ap2	A	T	12: 11,457,592	N505I	possibly damaging	Het
Rasal3	A	C	17: 32,396,562	V434G	probably damaging	Het
Rasgrf2	C	T	13: 91,987,973	V6M		Het
Rwdd1	A	T	10: 34,001,156	D197E		Het
Scn11a	A	T	9: 119,790,010	C755*	probably null	Het
Skil	T	C	3: 31,116,860	S443P	probably benign	Het
Slc12a6	T	C	2: 112,356,472	C939R	probably damaging	Het
Slc25a36	A	G	9: 97,079,177	S269P	probably benign	Het
Srrm4	T	A	5: 116,482,393	H92L	unknown	Het
Styk1	CTCTTCATGATTTTCTT	CTCTT	6: 131,301,649		probably benign	Het
Tbc1d4	A	T	14: 101,507,410	V260E	probably benign	Het
Tbc1d8	T	C	1: 39,385,232	N593D	probably damaging	Het
Trex1	C	A	9: 109,058,737	R62L	probably damaging	Het
Trpm3	A	T	19: 22,715,352	D269V	possibly damaging	Het
Trpv4	G	T	5: 114,633,150	Y439*	probably null	Het
Ttn	G	A	2: 76,734,248	T28515I	probably damaging	Het
Ucn2	G	A	9: 108,986,503	G111D	probably damaging	Het
Uhrf2	A	G	19: 30,056,481	I212V	possibly damaging	Het
Usp24	T	A	4: 106,347,367	M261K	probably benign	Het
Vmn1r235	A	T	17: 21,261,698	D95V	probably benign	Het
Vwf	G	A	6: 125,624,573	R826Q		Het
Zfp28	T	C	7: 6,393,879	C438R	probably damaging	Het

Other mutations in Cux1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00846:Cux1	APN	5	136326796	missense	probably damaging	1.00
IGL00966:Cux1	APN	5	136311491	intron	probably benign
IGL01129:Cux1	APN	5	136304718	intron	probably benign
IGL01885:Cux1	APN	5	136308447	missense	possibly damaging	0.90
IGL01947:Cux1	APN	5	136275125	missense	probably benign	0.04
IGL02259:Cux1	APN	5	136326833	missense	probably damaging	1.00
IGL02666:Cux1	APN	5	136275315	nonsense	probably null
IGL02826:Cux1	APN	5	136308003	missense	probably damaging	1.00
IGL03014:Cux1	UTSW	5	136565525	intron	probably benign
R0047:Cux1	UTSW	5	136363253	splice site	probably benign
R0047:Cux1	UTSW	5	136363253	splice site	probably benign
R0057:Cux1	UTSW	5	136256282	missense	probably damaging	1.00
R0149:Cux1	UTSW	5	136279497	missense	probably damaging	1.00
R0295:Cux1	UTSW	5	136313212	missense	probably benign	0.04
R0361:Cux1	UTSW	5	136279497	missense	probably damaging	1.00
R0533:Cux1	UTSW	5	136307859	missense	probably damaging	1.00
R0630:Cux1	UTSW	5	136286835	missense	probably damaging	1.00
R0801:Cux1	UTSW	5	136326929	missense	probably damaging	0.97
R0884:Cux1	UTSW	5	136307835	missense	probably damaging	1.00
R0976:Cux1	UTSW	5	136313290	missense	probably damaging	1.00
R1073:Cux1	UTSW	5	136252541	critical splice donor site	probably null
R1222:Cux1	UTSW	5	136275149	missense	probably benign	0.18
R1518:Cux1	UTSW	5	136308279	missense	probably benign	0.29
R1686:Cux1	UTSW	5	136275381	nonsense	probably null
R1687:Cux1	UTSW	5	136312669	missense	probably damaging	1.00
R1758:Cux1	UTSW	5	136392322	missense	probably damaging	1.00
R1797:Cux1	UTSW	5	136275315	missense	probably benign	0.22
R1919:Cux1	UTSW	5	136363319	nonsense	probably null
R2051:Cux1	UTSW	5	136332658	missense	probably damaging	1.00
R2339:Cux1	UTSW	5	136287008	missense	probably damaging	1.00
R3438:Cux1	UTSW	5	136311560	missense	probably damaging	0.97
R3713:Cux1	UTSW	5	136565543	intron	probably benign
R3800:Cux1	UTSW	5	136316033	missense	probably damaging	1.00
R3964:Cux1	UTSW	5	136282942	missense	probably damaging	1.00
R4135:Cux1	UTSW	5	136307896	missense	probably damaging	1.00
R4198:Cux1	UTSW	5	136286848	missense	probably damaging	1.00
R4467:Cux1	UTSW	5	136312722	missense	probably damaging	1.00
R4498:Cux1	UTSW	5	136312993	missense	probably damaging	1.00
R4622:Cux1	UTSW	5	136308300	missense	probably damaging	0.99
R4623:Cux1	UTSW	5	136308300	missense	probably damaging	0.99
R4651:Cux1	UTSW	5	136567229	missense	probably damaging	1.00
R4652:Cux1	UTSW	5	136567229	missense	probably damaging	1.00
R4658:Cux1	UTSW	5	136250594	missense	possibly damaging	0.80
R4665:Cux1	UTSW	5	136286799	missense	probably damaging	1.00
R4704:Cux1	UTSW	5	136249201	missense	probably benign	0.01
R4867:Cux1	UTSW	5	136274961	intron	probably benign
R4965:Cux1	UTSW	5	136311556	missense	possibly damaging	0.77
R5090:Cux1	UTSW	5	136313200	missense	possibly damaging	0.95
R5155:Cux1	UTSW	5	136565441	intron	probably benign
R5226:Cux1	UTSW	5	136370173	missense	probably benign	0.01
R5252:Cux1	UTSW	5	136308297	missense	probably damaging	0.98
R5266:Cux1	UTSW	5	136312694	missense	probably damaging	1.00
R5399:Cux1	UTSW	5	136252604	missense	possibly damaging	0.58
R5509:Cux1	UTSW	5	136275317	missense	probably benign	0.13
R5609:Cux1	UTSW	5	136392320	missense	probably damaging	1.00
R5681:Cux1	UTSW	5	136308184	missense	probably damaging	1.00
R5993:Cux1	UTSW	5	136363271	missense	probably benign	0.00
R6049:Cux1	UTSW	5	136332710	missense	probably damaging	1.00
R6290:Cux1	UTSW	5	136311558	missense	probably damaging	0.99
R6310:Cux1	UTSW	5	136275164	missense	probably benign	0.10
R6351:Cux1	UTSW	5	136309792	missense	probably damaging	1.00
R6531:Cux1	UTSW	5	136275119	missense	probably benign	0.03
R6590:Cux1	UTSW	5	136340117	missense	probably damaging	0.99
R6663:Cux1	UTSW	5	136485847	missense	probably damaging	1.00
R6690:Cux1	UTSW	5	136340117	missense	probably damaging	0.99
R6777:Cux1	UTSW	5	136565568	intron	probably benign
R6786:Cux1	UTSW	5	136567231	missense	probably damaging	1.00
R6817:Cux1	UTSW	5	136373173	splice site	probably null
R6989:Cux1	UTSW	5	136279648	nonsense	probably null
R7011:Cux1	UTSW	5	136360033	missense	probably damaging	1.00
R7167:Cux1	UTSW	5	136310041	splice site	probably null
R7699:Cux1	UTSW	5	136485739	critical splice donor site	probably null
R7861:Cux1	UTSW	5	136252604	missense	possibly damaging	0.58
R7876:Cux1	UTSW	5	136363307	missense	probably benign	0.00
R7916:Cux1	UTSW	5	136282961	missense	probably damaging	1.00
R8023:Cux1	UTSW	5	136373397	missense	probably damaging	0.99
R8154:Cux1	UTSW	5	136252580	missense	probably damaging	1.00
R8267:Cux1	UTSW	5	136282999	missense	probably damaging	1.00
R8289:Cux1	UTSW	5	136308504	missense	probably damaging	0.99
R8305:Cux1	UTSW	5	136360009	missense	probably benign	0.02
R8319:Cux1	UTSW	5	136565397	missense	probably benign	0.02
R8405:Cux1	UTSW	5	136275387	missense	possibly damaging	0.83
R8483:Cux1	UTSW	5	136275090	missense	possibly damaging	0.83
R8506:Cux1	UTSW	5	136308504	missense	probably damaging	0.99
R8671:Cux1	UTSW	5	136250600	missense	probably damaging	1.00
R8680:Cux1	UTSW	5	136307856	missense	possibly damaging	0.46
R8737:Cux1	UTSW	5	136282942	missense	probably damaging	1.00
R8738:Cux1	UTSW	5	136373366	missense	probably damaging	1.00
R8793:Cux1	UTSW	5	136565685	missense	unknown
R8897:Cux1	UTSW	5	136286769	missense	probably damaging	1.00
R8926:Cux1	UTSW	5	136309550	intron	probably benign
R8954:Cux1	UTSW	5	136373349	nonsense	probably null
R9092:Cux1	UTSW	5	136485817	missense	probably damaging	1.00
R9205:Cux1	UTSW	5	136370135	missense	probably damaging	1.00
R9550:Cux1	UTSW	5	136311533	missense	probably damaging	0.99
R9578:Cux1	UTSW	5	136254065	critical splice donor site	probably null
R9682:Cux1	UTSW	5	136308262	missense	probably benign
R9701:Cux1	UTSW	5	136314315	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGTGTGGAATCATACTCAGGGTC -3'
(R):5'- TTGCAGCAATTAGGGATGAGTG -3'

Sequencing Primer
(F):5'- GAATCATACTCAGGGTCACTTTGGAG -3'
(R):5'- CAGCAATTAGGGATGAGTGGGAGAC -3'

Posted On

2022-10-06