Mutagenetix > Incidental Mutation

Incidental Mutation 'R9712:Pds5b'

730248

Institutional Source

Beutler Lab

Gene Symbol

Pds5b

Ensembl Gene

ENSMUSG00000034021

Gene Name

PDS5 cohesin associated factor B

Synonyms

Aprin, AS3

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9712 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

150673739-150810690 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 150805663 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1419 (D1419V)

Ref Sequence

ENSEMBL: ENSMUSP00000016569 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016569] [ENSMUST00000038900] [ENSMUST00000202170]

AlphaFold

Q4VA53

Predicted Effect

possibly damaging
Transcript: ENSMUST00000016569
AA Change: D1419V

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000016569
Gene: ENSMUSG00000034021
AA Change: D1419V

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	244	773	6e-33	SMART
low complexity region	1156	1167	N/A	INTRINSIC
AT_hook	1247	1259	4.14e1	SMART
AT_hook	1285	1297	1.35e2	SMART
low complexity region	1307	1316	N/A	INTRINSIC
low complexity region	1318	1329	N/A	INTRINSIC
AT_hook	1370	1382	1.46e0	SMART
low complexity region	1437	1446	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038900
AA Change: D1422V

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000038421
Gene: ENSMUSG00000034021
AA Change: D1422V

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	244	773	6e-33	SMART
low complexity region	1156	1167	N/A	INTRINSIC
AT_hook	1249	1261	4.14e1	SMART
AT_hook	1287	1299	1.35e2	SMART
low complexity region	1309	1318	N/A	INTRINSIC
low complexity region	1320	1331	N/A	INTRINSIC
AT_hook	1373	1385	1.46e0	SMART
low complexity region	1440	1449	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000202170
AA Change: D1421V

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000144572
Gene: ENSMUSG00000034021
AA Change: D1421V

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	244	773	6e-33	SMART
low complexity region	1156	1167	N/A	INTRINSIC
AT_hook	1249	1261	4.14e1	SMART
AT_hook	1287	1299	1.35e2	SMART
low complexity region	1309	1318	N/A	INTRINSIC
low complexity region	1320	1331	N/A	INTRINSIC
AT_hook	1372	1384	1.46e0	SMART
low complexity region	1439	1448	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the conserved protein complex termed cohesin. The cohesin complex holds together sister chromatids and facilitates accurate chromosome segregation during mitosis and meiosis. This protein is also a negative regulator of cell proliferation and may be a tumor-suppressor gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and neonatal lethality with cardiac defects, craniofacial abnormalities, axial skeletal defects, shortening of most of the long bones, abnormal enteric nervous system morphology, and decreased germ cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	A	T	19: 3,715,784	M20L	probably benign	Het
9430007A20Rik	C	T	4: 144,528,784	A258V	probably benign	Het
Abca8b	T	A	11: 109,942,337	D1241V	probably benign	Het
Adam20	G	A	8: 40,795,453	R200H	probably benign	Het
Adcy10	T	C	1: 165,513,112	F229L	probably damaging	Het
Adsl	A	T	15: 80,955,639	N126I	probably benign	Het
Ahnak	AGATCTC	A	19: 9,007,028		probably benign	Het
Ahnak	GATCTCTAT	GAT	19: 9,007,029		probably benign	Het
Aktip	G	A	8: 91,129,727	P41S	probably damaging	Het
Alkbh3	C	A	2: 93,980,973	R258L	probably damaging	Het
Arfgap3	A	G	15: 83,313,533	Y341H	probably benign	Het
Arhgef26	C	T	3: 62,423,613	L583F	probably damaging	Het
Arhgef40	T	C	14: 51,988,958	I153T	probably damaging	Het
Atp1a1	T	C	3: 101,591,441	S179G	probably benign	Het
Bok	T	C	1: 93,686,507	S21P	probably damaging	Het
C130060K24Rik	A	G	6: 65,456,140	I315V	probably benign	Het
Ccdc136	A	G	6: 29,417,442	E754G	probably benign	Het
Cers3	A	G	7: 66,773,630	K108E	probably benign	Het
Cmya5	T	C	13: 93,065,373		probably null	Het
Col19a1	T	C	1: 24,328,067	E478G	possibly damaging	Het
Colec10	T	A	15: 54,459,784	S134R	possibly damaging	Het
Ctnnb1	A	T	9: 120,955,829	I514F	probably damaging	Het
Cux1	C	T	5: 136,309,819	E664K	probably benign	Het
Dars	T	C	1: 128,405,462	Q75R	probably benign	Het
Disp1	T	A	1: 183,135,815	S16C	probably damaging	Het
Dnah7a	A	T	1: 53,559,140	V1412E	probably benign	Het
Ect2l	C	T	10: 18,168,434	V226I	probably benign	Het
Ep400	T	A	5: 110,756,643	H30L	unknown	Het
Ephx4	A	G	5: 107,419,781	I202V	probably benign	Het
Exoc3	A	T	13: 74,192,908	F259Y	probably damaging	Het
Ezr	T	C	17: 6,752,995	E229G	probably damaging	Het
Fat1	A	T	8: 45,017,380	I1472L	probably benign	Het
Fsd1l	T	G	4: 53,679,972	D223E	probably benign	Het
Gata6	A	T	18: 11,059,064	D377V	possibly damaging	Het
Gm12185	A	T	11: 48,907,389	M759K	probably benign	Het
Gm21994	C	T	2: 150,254,576	R311Q	probably benign	Het
Gm9922	C	T	14: 101,729,457	A120T	unknown	Het
Hectd4	A	T	5: 121,310,681	Y364F	probably benign	Het
Hnrnph1	A	G	11: 50,385,869	S465G	unknown	Het
Ifi204	T	C	1: 173,749,358	Y559C	probably damaging	Het
Ift88	T	C	14: 57,481,396	S613P	probably damaging	Het
Kif21a	G	C	15: 90,985,325	A441G	probably damaging	Het
Kif21a	G	T	15: 90,995,512	T191K	probably benign	Het
Lrit1	T	A	14: 37,060,127	C252*	probably null	Het
Ncbp1	T	A	4: 46,144,837	D29E	probably benign	Het
Nlrp10	A	T	7: 108,925,528	D248E	probably damaging	Het
Nphp4	T	G	4: 152,547,064	V807G	probably benign	Het
Nsd1	T	C	13: 55,246,043	S589P	possibly damaging	Het
Oas1b	T	A	5: 120,814,485	N80K	probably damaging	Het
Olfr1055	G	A	2: 86,347,239	H176Y	probably benign	Het
Olfr1135	A	T	2: 87,671,761	I202N	probably benign	Het
Oprk1	T	A	1: 5,598,873	C181S	probably damaging	Het
Oprl1	T	A	2: 181,718,419	N89K	probably damaging	Het
Pdcd11	A	G	19: 47,129,302	K1697E	probably damaging	Het
Pdp1	G	A	4: 11,961,607	H254Y	probably benign	Het
Per1	G	T	11: 69,100,649	G3V	probably benign	Het
Pex16	C	A	2: 92,376,643	N55K	probably damaging	Het
Phldb2	C	A	16: 45,774,977	L862F	probably benign	Het
Pld5	T	A	1: 175,964,006	D478V	probably benign	Het
Pms2	T	C	5: 143,914,796	I177T	probably damaging	Het
Pou1f1	A	T	16: 65,529,872	E119D	probably benign	Het
Ppp2r1a	A	C	17: 20,958,796	E295A	probably damaging	Het
Rad51ap2	A	T	12: 11,457,592	N505I	possibly damaging	Het
Rasal3	A	C	17: 32,396,562	V434G	probably damaging	Het
Rasgrf2	C	T	13: 91,987,973	V6M		Het
Rwdd1	A	T	10: 34,001,156	D197E		Het
Scn11a	A	T	9: 119,790,010	C755*	probably null	Het
Skil	T	C	3: 31,116,860	S443P	probably benign	Het
Slc12a6	T	C	2: 112,356,472	C939R	probably damaging	Het
Slc25a36	A	G	9: 97,079,177	S269P	probably benign	Het
Srrm4	T	A	5: 116,482,393	H92L	unknown	Het
Styk1	CTCTTCATGATTTTCTT	CTCTT	6: 131,301,649		probably benign	Het
Tbc1d4	A	T	14: 101,507,410	V260E	probably benign	Het
Tbc1d8	T	C	1: 39,385,232	N593D	probably damaging	Het
Trex1	C	A	9: 109,058,737	R62L	probably damaging	Het
Trpm3	A	T	19: 22,715,352	D269V	possibly damaging	Het
Trpv4	G	T	5: 114,633,150	Y439*	probably null	Het
Ttn	G	A	2: 76,734,248	T28515I	probably damaging	Het
Ucn2	G	A	9: 108,986,503	G111D	probably damaging	Het
Uhrf2	A	G	19: 30,056,481	I212V	possibly damaging	Het
Usp24	T	A	4: 106,347,367	M261K	probably benign	Het
Vmn1r235	A	T	17: 21,261,698	D95V	probably benign	Het
Vwf	G	A	6: 125,624,573	R826Q		Het
Zfp28	T	C	7: 6,393,879	C438R	probably damaging	Het

Other mutations in Pds5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00719:Pds5b	APN	5	150722542	missense	probably benign	0.25
IGL01530:Pds5b	APN	5	150792175	missense	probably benign	0.38
IGL01812:Pds5b	APN	5	150780689	missense	probably damaging	1.00
IGL02163:Pds5b	APN	5	150756406	missense	probably benign	0.00
IGL02730:Pds5b	APN	5	150780752	splice site	probably benign
IGL02825:Pds5b	APN	5	150728970	missense	possibly damaging	0.90
IGL03143:Pds5b	APN	5	150779257	missense	probably damaging	1.00
IGL03379:Pds5b	APN	5	150788331	missense	probably damaging	1.00
PIT4283001:Pds5b	UTSW	5	150778309	missense	probably damaging	0.99
R0026:Pds5b	UTSW	5	150749830	splice site	probably benign
R0197:Pds5b	UTSW	5	150754431	missense	probably benign	0.28
R0347:Pds5b	UTSW	5	150736427	splice site	probably benign
R0396:Pds5b	UTSW	5	150779275	missense	possibly damaging	0.96
R0400:Pds5b	UTSW	5	150723353	missense	possibly damaging	0.46
R0442:Pds5b	UTSW	5	150716544	splice site	probably benign
R0745:Pds5b	UTSW	5	150805671	missense	probably benign
R0839:Pds5b	UTSW	5	150764962	missense	probably benign	0.23
R0866:Pds5b	UTSW	5	150739191	splice site	probably benign
R1247:Pds5b	UTSW	5	150775354	critical splice acceptor site	probably benign
R1330:Pds5b	UTSW	5	150761077	missense	probably damaging	0.97
R1440:Pds5b	UTSW	5	150754417	missense	probably damaging	1.00
R1526:Pds5b	UTSW	5	150716400	splice site	probably null
R2010:Pds5b	UTSW	5	150775354	critical splice acceptor site	probably benign
R2051:Pds5b	UTSW	5	150748190	missense	probably damaging	1.00
R2507:Pds5b	UTSW	5	150756428	missense	possibly damaging	0.90
R3111:Pds5b	UTSW	5	150719907	missense	probably damaging	1.00
R3820:Pds5b	UTSW	5	150736337	missense	possibly damaging	0.94
R3911:Pds5b	UTSW	5	150746706	missense	probably benign	0.41
R4077:Pds5b	UTSW	5	150794359	missense	possibly damaging	0.62
R4118:Pds5b	UTSW	5	150775354	critical splice acceptor site	probably benign
R4342:Pds5b	UTSW	5	150800854	missense	probably benign	0.17
R4416:Pds5b	UTSW	5	150736396	missense	probably damaging	1.00
R4503:Pds5b	UTSW	5	150728934	missense	probably damaging	1.00
R4524:Pds5b	UTSW	5	150788316	missense	probably damaging	1.00
R4579:Pds5b	UTSW	5	150746732	missense	probably damaging	0.98
R4623:Pds5b	UTSW	5	150800601	missense	probably benign	0.37
R4847:Pds5b	UTSW	5	150748112	missense	probably damaging	1.00
R4885:Pds5b	UTSW	5	150716462	missense	probably benign	0.21
R5271:Pds5b	UTSW	5	150723353	missense	possibly damaging	0.46
R5281:Pds5b	UTSW	5	150746608	missense	probably benign	0.26
R5337:Pds5b	UTSW	5	150793597	missense	probably benign	0.03
R5635:Pds5b	UTSW	5	150778221	missense	possibly damaging	0.78
R5677:Pds5b	UTSW	5	150716461	missense	possibly damaging	0.91
R6005:Pds5b	UTSW	5	150769776	splice site	probably null
R6139:Pds5b	UTSW	5	150800777	missense	possibly damaging	0.81
R6225:Pds5b	UTSW	5	150746618	missense	probably damaging	0.98
R6279:Pds5b	UTSW	5	150723248	missense	possibly damaging	0.80
R6300:Pds5b	UTSW	5	150723248	missense	possibly damaging	0.80
R6666:Pds5b	UTSW	5	150778166	missense	probably damaging	1.00
R6805:Pds5b	UTSW	5	150805561	splice site	probably null
R7038:Pds5b	UTSW	5	150800760	missense	probably benign	0.02
R7046:Pds5b	UTSW	5	150749920	missense	probably damaging	1.00
R7051:Pds5b	UTSW	5	150794282	missense	possibly damaging	0.78
R7138:Pds5b	UTSW	5	150800677	nonsense	probably null
R7255:Pds5b	UTSW	5	150796667	missense	probably benign	0.33
R7467:Pds5b	UTSW	5	150736327	missense	probably damaging	0.99
R7488:Pds5b	UTSW	5	150723337	missense	probably damaging	0.97
R7512:Pds5b	UTSW	5	150788342	missense	probably damaging	1.00
R7561:Pds5b	UTSW	5	150739318	critical splice donor site	probably null
R7576:Pds5b	UTSW	5	150778261	missense	probably damaging	1.00
R7889:Pds5b	UTSW	5	150792172	missense	probably damaging	1.00
R7982:Pds5b	UTSW	5	150769941	missense	probably damaging	1.00
R8059:Pds5b	UTSW	5	150807835	missense	unknown
R8211:Pds5b	UTSW	5	150728942	missense	possibly damaging	0.90
R8412:Pds5b	UTSW	5	150719959	missense	probably damaging	1.00
R8503:Pds5b	UTSW	5	150716507	missense	possibly damaging	0.95
R8556:Pds5b	UTSW	5	150792608	missense	probably benign
R8786:Pds5b	UTSW	5	150780669	missense	probably damaging	1.00
R8929:Pds5b	UTSW	5	150719914	missense	probably damaging	1.00
R8985:Pds5b	UTSW	5	150800774	missense	probably benign	0.38
R9184:Pds5b	UTSW	5	150800784	missense	probably benign	0.04
R9343:Pds5b	UTSW	5	150780721	missense	probably damaging	1.00
R9432:Pds5b	UTSW	5	150769791	missense	probably damaging	1.00
R9571:Pds5b	UTSW	5	150722506	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGATAGTCTTGGTGGCACC -3'
(R):5'- TCTCAAATTCAAGCTCTCCTCAAAG -3'

Sequencing Primer
(F):5'- AAAAGAAATGCTTATGGGTCAAATG -3'
(R):5'- CTTTCTCCATTATCCTAGTTGGTAAG -3'

Posted On

2022-10-06