Incidental Mutation 'R9712:Ccdc136'
ID 730249
Institutional Source Beutler Lab
Gene Symbol Ccdc136
Ensembl Gene ENSMUSG00000029769
Gene Name coiled-coil domain containing 136
Synonyms 4921511K06Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9712 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 29396296-29426954 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 29417441 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 754 (E754G)
Ref Sequence ENSEMBL: ENSMUSP00000137673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096084] [ENSMUST00000115275] [ENSMUST00000145310] [ENSMUST00000154619] [ENSMUST00000180829] [ENSMUST00000181464] [ENSMUST00000202726]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000096084
AA Change: E846G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093789
Gene: ENSMUSG00000029769
AA Change: E846G

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 65 83 N/A INTRINSIC
low complexity region 85 92 N/A INTRINSIC
coiled coil region 99 310 N/A INTRINSIC
coiled coil region 343 408 N/A INTRINSIC
internal_repeat_2 416 435 7.26e-6 PROSPERO
low complexity region 439 453 N/A INTRINSIC
coiled coil region 463 489 N/A INTRINSIC
coiled coil region 526 611 N/A INTRINSIC
low complexity region 645 658 N/A INTRINSIC
coiled coil region 730 779 N/A INTRINSIC
internal_repeat_1 791 810 8.87e-9 PROSPERO
internal_repeat_1 819 838 8.87e-9 PROSPERO
low complexity region 847 868 N/A INTRINSIC
internal_repeat_2 902 921 7.26e-6 PROSPERO
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
coiled coil region 1066 1104 N/A INTRINSIC
low complexity region 1108 1142 N/A INTRINSIC
transmembrane domain 1154 1176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115275
AA Change: E846G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110930
Gene: ENSMUSG00000029769
AA Change: E846G

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 65 83 N/A INTRINSIC
low complexity region 85 92 N/A INTRINSIC
coiled coil region 99 310 N/A INTRINSIC
coiled coil region 343 408 N/A INTRINSIC
internal_repeat_2 416 435 1.72e-5 PROSPERO
low complexity region 439 453 N/A INTRINSIC
coiled coil region 463 489 N/A INTRINSIC
coiled coil region 526 611 N/A INTRINSIC
low complexity region 645 658 N/A INTRINSIC
coiled coil region 730 779 N/A INTRINSIC
internal_repeat_1 791 810 2.93e-8 PROSPERO
internal_repeat_1 819 838 2.93e-8 PROSPERO
low complexity region 847 868 N/A INTRINSIC
internal_repeat_2 902 921 1.72e-5 PROSPERO
transmembrane domain 967 989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145310
SMART Domains Protein: ENSMUSP00000145331
Gene: ENSMUSG00000029769

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 65 83 N/A INTRINSIC
low complexity region 85 92 N/A INTRINSIC
coiled coil region 99 310 N/A INTRINSIC
coiled coil region 343 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154619
AA Change: E688G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118132
Gene: ENSMUSG00000029769
AA Change: E688G

DomainStartEndE-ValueType
coiled coil region 1 152 N/A INTRINSIC
coiled coil region 185 250 N/A INTRINSIC
internal_repeat_2 258 277 4.68e-6 PROSPERO
low complexity region 281 295 N/A INTRINSIC
coiled coil region 305 331 N/A INTRINSIC
coiled coil region 368 453 N/A INTRINSIC
low complexity region 487 500 N/A INTRINSIC
coiled coil region 572 621 N/A INTRINSIC
internal_repeat_1 633 652 5.47e-9 PROSPERO
internal_repeat_1 661 680 5.47e-9 PROSPERO
low complexity region 689 710 N/A INTRINSIC
internal_repeat_2 744 763 4.68e-6 PROSPERO
low complexity region 836 853 N/A INTRINSIC
low complexity region 865 883 N/A INTRINSIC
coiled coil region 908 946 N/A INTRINSIC
low complexity region 950 984 N/A INTRINSIC
transmembrane domain 996 1018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180829
AA Change: E754G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137747
Gene: ENSMUSG00000029769
AA Change: E754G

DomainStartEndE-ValueType
coiled coil region 7 218 N/A INTRINSIC
coiled coil region 251 316 N/A INTRINSIC
internal_repeat_2 324 343 1.21e-5 PROSPERO
low complexity region 347 361 N/A INTRINSIC
coiled coil region 371 397 N/A INTRINSIC
coiled coil region 434 519 N/A INTRINSIC
low complexity region 553 566 N/A INTRINSIC
coiled coil region 638 687 N/A INTRINSIC
internal_repeat_1 699 718 1.98e-8 PROSPERO
internal_repeat_1 727 746 1.98e-8 PROSPERO
low complexity region 755 776 N/A INTRINSIC
internal_repeat_2 810 829 1.21e-5 PROSPERO
transmembrane domain 875 897 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181464
AA Change: E754G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137673
Gene: ENSMUSG00000029769
AA Change: E754G

DomainStartEndE-ValueType
coiled coil region 7 218 N/A INTRINSIC
coiled coil region 251 316 N/A INTRINSIC
internal_repeat_2 324 343 7.68e-6 PROSPERO
low complexity region 347 361 N/A INTRINSIC
coiled coil region 371 397 N/A INTRINSIC
coiled coil region 434 519 N/A INTRINSIC
low complexity region 553 566 N/A INTRINSIC
coiled coil region 638 687 N/A INTRINSIC
internal_repeat_1 699 718 1.04e-8 PROSPERO
internal_repeat_1 727 746 1.04e-8 PROSPERO
low complexity region 755 776 N/A INTRINSIC
internal_repeat_2 810 829 7.68e-6 PROSPERO
low complexity region 902 919 N/A INTRINSIC
low complexity region 931 949 N/A INTRINSIC
transmembrane domain 969 991 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202726
SMART Domains Protein: ENSMUSP00000144577
Gene: ENSMUSG00000029769

DomainStartEndE-ValueType
coiled coil region 25 90 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik A T 19: 3,765,784 (GRCm39) M20L probably benign Het
Aadacl4fm1 C T 4: 144,255,354 (GRCm39) A258V probably benign Het
Abca8b T A 11: 109,833,163 (GRCm39) D1241V probably benign Het
Adam20 G A 8: 41,248,490 (GRCm39) R200H probably benign Het
Adcy10 T C 1: 165,340,681 (GRCm39) F229L probably damaging Het
Adsl A T 15: 80,839,840 (GRCm39) N126I probably benign Het
Ahnak GATCTCTAT GAT 19: 8,984,393 (GRCm39) probably benign Het
Ahnak AGATCTC A 19: 8,984,392 (GRCm39) probably benign Het
Aktip G A 8: 91,856,355 (GRCm39) P41S probably damaging Het
Alkbh3 C A 2: 93,811,318 (GRCm39) R258L probably damaging Het
Arfgap3 A G 15: 83,197,734 (GRCm39) Y341H probably benign Het
Arhgef26 C T 3: 62,331,034 (GRCm39) L583F probably damaging Het
Arhgef40 T C 14: 52,226,415 (GRCm39) I153T probably damaging Het
Atp1a1 T C 3: 101,498,757 (GRCm39) S179G probably benign Het
Bok T C 1: 93,614,229 (GRCm39) S21P probably damaging Het
Cers3 A G 7: 66,423,378 (GRCm39) K108E probably benign Het
Cmya5 T C 13: 93,201,881 (GRCm39) probably null Het
Col19a1 T C 1: 24,367,148 (GRCm39) E478G possibly damaging Het
Colec10 T A 15: 54,323,180 (GRCm39) S134R possibly damaging Het
Ctnnb1 A T 9: 120,784,895 (GRCm39) I514F probably damaging Het
Cux1 C T 5: 136,338,673 (GRCm39) E664K probably benign Het
Dars1 T C 1: 128,333,199 (GRCm39) Q75R probably benign Het
Disp1 T A 1: 182,917,379 (GRCm39) S16C probably damaging Het
Dnah7a A T 1: 53,598,299 (GRCm39) V1412E probably benign Het
Ect2l C T 10: 18,044,182 (GRCm39) V226I probably benign Het
Ep400 T A 5: 110,904,509 (GRCm39) H30L unknown Het
Ephx4 A G 5: 107,567,647 (GRCm39) I202V probably benign Het
Exoc3 A T 13: 74,341,027 (GRCm39) F259Y probably damaging Het
Ezr T C 17: 7,020,394 (GRCm39) E229G probably damaging Het
Fat1 A T 8: 45,470,417 (GRCm39) I1472L probably benign Het
Fsd1l T G 4: 53,679,972 (GRCm39) D223E probably benign Het
Gata6 A T 18: 11,059,064 (GRCm39) D377V possibly damaging Het
Gm12185 A T 11: 48,798,216 (GRCm39) M759K probably benign Het
Gm9922 C T 14: 101,966,893 (GRCm39) A120T unknown Het
Hectd4 A T 5: 121,448,744 (GRCm39) Y364F probably benign Het
Hnrnph1 A G 11: 50,276,696 (GRCm39) S465G unknown Het
Ifi204 T C 1: 173,576,924 (GRCm39) Y559C probably damaging Het
Ift88 T C 14: 57,718,853 (GRCm39) S613P probably damaging Het
Kif21a G C 15: 90,869,528 (GRCm39) A441G probably damaging Het
Kif21a G T 15: 90,879,715 (GRCm39) T191K probably benign Het
Lrit1 T A 14: 36,782,084 (GRCm39) C252* probably null Het
Ncbp1 T A 4: 46,144,837 (GRCm39) D29E probably benign Het
Nlrp10 A T 7: 108,524,735 (GRCm39) D248E probably damaging Het
Nphp4 T G 4: 152,631,521 (GRCm39) V807G probably benign Het
Nsd1 T C 13: 55,393,856 (GRCm39) S589P possibly damaging Het
Oas1b T A 5: 120,952,550 (GRCm39) N80K probably damaging Het
Oprk1 T A 1: 5,669,096 (GRCm39) C181S probably damaging Het
Oprl1 T A 2: 181,360,212 (GRCm39) N89K probably damaging Het
Or5w12 A T 2: 87,502,105 (GRCm39) I202N probably benign Het
Or8k53 G A 2: 86,177,583 (GRCm39) H176Y probably benign Het
Pdcd11 A G 19: 47,117,741 (GRCm39) K1697E probably damaging Het
Pdp1 G A 4: 11,961,607 (GRCm39) H254Y probably benign Het
Pds5b A T 5: 150,729,128 (GRCm39) D1419V possibly damaging Het
Per1 G T 11: 68,991,475 (GRCm39) G3V probably benign Het
Pex16 C A 2: 92,206,988 (GRCm39) N55K probably damaging Het
Phldb2 C A 16: 45,595,340 (GRCm39) L862F probably benign Het
Pld5 T A 1: 175,791,572 (GRCm39) D478V probably benign Het
Pms2 T C 5: 143,851,614 (GRCm39) I177T probably damaging Het
Pou1f1 A T 16: 65,326,758 (GRCm39) E119D probably benign Het
Ppp2r1a A C 17: 21,179,058 (GRCm39) E295A probably damaging Het
Qrfprl A G 6: 65,433,124 (GRCm39) I315V probably benign Het
Rad51ap2 A T 12: 11,507,593 (GRCm39) N505I possibly damaging Het
Rasal3 A C 17: 32,615,536 (GRCm39) V434G probably damaging Het
Rasgrf2 C T 13: 92,136,092 (GRCm39) V6M Het
Rwdd1 A T 10: 33,877,152 (GRCm39) D197E Het
Scn11a A T 9: 119,619,076 (GRCm39) C755* probably null Het
Skil T C 3: 31,171,009 (GRCm39) S443P probably benign Het
Slc12a6 T C 2: 112,186,817 (GRCm39) C939R probably damaging Het
Slc25a36 A G 9: 96,961,230 (GRCm39) S269P probably benign Het
Srrm4 T A 5: 116,620,452 (GRCm39) H92L unknown Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Tbc1d4 A T 14: 101,744,846 (GRCm39) V260E probably benign Het
Tbc1d8 T C 1: 39,424,313 (GRCm39) N593D probably damaging Het
Trex1 C A 9: 108,887,805 (GRCm39) R62L probably damaging Het
Trpm3 A T 19: 22,692,716 (GRCm39) D269V possibly damaging Het
Trpv4 G T 5: 114,771,211 (GRCm39) Y439* probably null Het
Ttn G A 2: 76,564,592 (GRCm39) T28515I probably damaging Het
Ucn2 G A 9: 108,815,571 (GRCm39) G111D probably damaging Het
Uhrf2 A G 19: 30,033,881 (GRCm39) I212V possibly damaging Het
Usp24 T A 4: 106,204,564 (GRCm39) M261K probably benign Het
Vmn1r235 A T 17: 21,481,960 (GRCm39) D95V probably benign Het
Vwf G A 6: 125,601,536 (GRCm39) R826Q Het
Zfp1002 C T 2: 150,096,496 (GRCm39) R311Q probably benign Het
Zfp28 T C 7: 6,396,878 (GRCm39) C438R probably damaging Het
Other mutations in Ccdc136
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Ccdc136 APN 6 29,420,257 (GRCm39) missense probably damaging 0.96
IGL01325:Ccdc136 APN 6 29,412,949 (GRCm39) missense probably benign 0.00
IGL01608:Ccdc136 APN 6 29,406,113 (GRCm39) missense possibly damaging 0.90
IGL02305:Ccdc136 APN 6 29,406,173 (GRCm39) missense probably damaging 1.00
IGL03354:Ccdc136 APN 6 29,419,102 (GRCm39) missense probably damaging 1.00
dimensionless UTSW 6 29,412,449 (GRCm39) missense probably benign 0.03
punctate UTSW 6 29,410,204 (GRCm39) missense probably damaging 0.99
PIT4515001:Ccdc136 UTSW 6 29,417,225 (GRCm39) missense probably benign 0.42
R0436:Ccdc136 UTSW 6 29,414,933 (GRCm39) missense probably damaging 1.00
R0709:Ccdc136 UTSW 6 29,414,969 (GRCm39) missense possibly damaging 0.64
R1451:Ccdc136 UTSW 6 29,419,376 (GRCm39) missense probably benign 0.09
R1593:Ccdc136 UTSW 6 29,415,583 (GRCm39) missense probably damaging 1.00
R1966:Ccdc136 UTSW 6 29,418,091 (GRCm39) missense probably damaging 1.00
R2113:Ccdc136 UTSW 6 29,413,031 (GRCm39) missense possibly damaging 0.51
R3845:Ccdc136 UTSW 6 29,417,176 (GRCm39) missense probably benign 0.20
R4668:Ccdc136 UTSW 6 29,411,280 (GRCm39) missense probably damaging 0.99
R5037:Ccdc136 UTSW 6 29,417,122 (GRCm39) missense probably damaging 1.00
R5085:Ccdc136 UTSW 6 29,419,313 (GRCm39) missense probably damaging 1.00
R5314:Ccdc136 UTSW 6 29,417,497 (GRCm39) missense probably benign 0.07
R5340:Ccdc136 UTSW 6 29,411,859 (GRCm39) missense possibly damaging 0.84
R5702:Ccdc136 UTSW 6 29,412,981 (GRCm39) missense probably damaging 0.99
R6108:Ccdc136 UTSW 6 29,412,449 (GRCm39) missense probably benign 0.03
R6313:Ccdc136 UTSW 6 29,410,204 (GRCm39) missense probably damaging 0.99
R6640:Ccdc136 UTSW 6 29,412,959 (GRCm39) missense possibly damaging 0.95
R6765:Ccdc136 UTSW 6 29,405,940 (GRCm39) missense probably benign
R7910:Ccdc136 UTSW 6 29,420,033 (GRCm39) missense probably benign 0.08
R7914:Ccdc136 UTSW 6 29,419,306 (GRCm39) missense probably damaging 1.00
R8030:Ccdc136 UTSW 6 29,417,141 (GRCm39) missense probably benign 0.07
R8414:Ccdc136 UTSW 6 29,412,929 (GRCm39) missense probably damaging 1.00
R8925:Ccdc136 UTSW 6 29,406,109 (GRCm39) missense probably damaging 0.98
R8927:Ccdc136 UTSW 6 29,406,109 (GRCm39) missense probably damaging 0.98
R9147:Ccdc136 UTSW 6 29,418,070 (GRCm39) missense probably damaging 1.00
R9148:Ccdc136 UTSW 6 29,418,070 (GRCm39) missense probably damaging 1.00
R9255:Ccdc136 UTSW 6 29,409,237 (GRCm39) missense probably benign
R9279:Ccdc136 UTSW 6 29,421,982 (GRCm39) intron probably benign
R9364:Ccdc136 UTSW 6 29,405,960 (GRCm39) missense probably damaging 1.00
R9623:Ccdc136 UTSW 6 29,405,939 (GRCm39) missense probably benign 0.00
R9799:Ccdc136 UTSW 6 29,417,505 (GRCm39) missense probably damaging 1.00
X0025:Ccdc136 UTSW 6 29,409,242 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- ATGCAGGTGCTCCAAACTC -3'
(R):5'- TTCAGAGGAACCCACCTTCC -3'

Sequencing Primer
(F):5'- TTTGAGTACTGCGGGAAGAACTC -3'
(R):5'- CCTGCCTGACCAATAACCTGG -3'
Posted On 2022-10-06