Incidental Mutation 'R9712:Vwf'
ID 730251
Institutional Source Beutler Lab
Gene Symbol Vwf
Ensembl Gene ENSMUSG00000001930
Gene Name Von Willebrand factor
Synonyms 6820430P06Rik, B130011O06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_011708; MGI: 98941

Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R9712 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 125546774-125686679 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 125624573 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 826 (R826Q)
Ref Sequence ENSEMBL: ENSMUSP00000107873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112254]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: R826Q

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 6.9e-15 PFAM
VWC 353 413 8.71e-1 SMART
VWD 380 543 2.93e-52 SMART
C8 580 652 3.82e-25 SMART
Pfam:TIL 655 710 4.1e-14 PFAM
EGF_like 790 825 4.37e1 SMART
VWC 832 901 3.29e-3 SMART
VWD 859 1015 5.15e-39 SMART
C8 1056 1130 1.01e-33 SMART
Pfam:TIL 1144 1199 1.3e-9 PFAM
VWA 1278 1461 1.81e-20 SMART
low complexity region 1464 1477 N/A INTRINSIC
VWA 1499 1672 8.43e-39 SMART
VWA 1692 1875 2.83e-31 SMART
VWC 1882 1949 2.99e0 SMART
VWD 1941 2104 5.03e-42 SMART
C8 2135 2203 1.29e-13 SMART
Pfam:TIL 2206 2257 8.3e-8 PFAM
VWC 2260 2328 3.16e-16 SMART
low complexity region 2417 2428 N/A INTRINSIC
VWC 2434 2497 2.61e-17 SMART
VWC 2513 2577 3.37e0 SMART
VWC 2585 2647 2.55e-11 SMART
CT 2730 2815 1.37e-31 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik A T 19: 3,715,784 M20L probably benign Het
9430007A20Rik C T 4: 144,528,784 A258V probably benign Het
Abca8b T A 11: 109,942,337 D1241V probably benign Het
Adam20 G A 8: 40,795,453 R200H probably benign Het
Adcy10 T C 1: 165,513,112 F229L probably damaging Het
Adsl A T 15: 80,955,639 N126I probably benign Het
Ahnak AGATCTC A 19: 9,007,028 probably benign Het
Ahnak GATCTCTAT GAT 19: 9,007,029 probably benign Het
Aktip G A 8: 91,129,727 P41S probably damaging Het
Alkbh3 C A 2: 93,980,973 R258L probably damaging Het
Arfgap3 A G 15: 83,313,533 Y341H probably benign Het
Arhgef26 C T 3: 62,423,613 L583F probably damaging Het
Arhgef40 T C 14: 51,988,958 I153T probably damaging Het
Atp1a1 T C 3: 101,591,441 S179G probably benign Het
Bok T C 1: 93,686,507 S21P probably damaging Het
C130060K24Rik A G 6: 65,456,140 I315V probably benign Het
Ccdc136 A G 6: 29,417,442 E754G probably benign Het
Cers3 A G 7: 66,773,630 K108E probably benign Het
Cmya5 T C 13: 93,065,373 probably null Het
Col19a1 T C 1: 24,328,067 E478G possibly damaging Het
Colec10 T A 15: 54,459,784 S134R possibly damaging Het
Ctnnb1 A T 9: 120,955,829 I514F probably damaging Het
Cux1 C T 5: 136,309,819 E664K probably benign Het
Dars T C 1: 128,405,462 Q75R probably benign Het
Disp1 T A 1: 183,135,815 S16C probably damaging Het
Dnah7a A T 1: 53,559,140 V1412E probably benign Het
Ect2l C T 10: 18,168,434 V226I probably benign Het
Ep400 T A 5: 110,756,643 H30L unknown Het
Ephx4 A G 5: 107,419,781 I202V probably benign Het
Exoc3 A T 13: 74,192,908 F259Y probably damaging Het
Ezr T C 17: 6,752,995 E229G probably damaging Het
Fat1 A T 8: 45,017,380 I1472L probably benign Het
Fsd1l T G 4: 53,679,972 D223E probably benign Het
Gata6 A T 18: 11,059,064 D377V possibly damaging Het
Gm12185 A T 11: 48,907,389 M759K probably benign Het
Gm21994 C T 2: 150,254,576 R311Q probably benign Het
Gm9922 C T 14: 101,729,457 A120T unknown Het
Hectd4 A T 5: 121,310,681 Y364F probably benign Het
Hnrnph1 A G 11: 50,385,869 S465G unknown Het
Ifi204 T C 1: 173,749,358 Y559C probably damaging Het
Ift88 T C 14: 57,481,396 S613P probably damaging Het
Kif21a G C 15: 90,985,325 A441G probably damaging Het
Kif21a G T 15: 90,995,512 T191K probably benign Het
Lrit1 T A 14: 37,060,127 C252* probably null Het
Ncbp1 T A 4: 46,144,837 D29E probably benign Het
Nlrp10 A T 7: 108,925,528 D248E probably damaging Het
Nphp4 T G 4: 152,547,064 V807G probably benign Het
Nsd1 T C 13: 55,246,043 S589P possibly damaging Het
Oas1b T A 5: 120,814,485 N80K probably damaging Het
Olfr1055 G A 2: 86,347,239 H176Y probably benign Het
Olfr1135 A T 2: 87,671,761 I202N probably benign Het
Oprk1 T A 1: 5,598,873 C181S probably damaging Het
Oprl1 T A 2: 181,718,419 N89K probably damaging Het
Pdcd11 A G 19: 47,129,302 K1697E probably damaging Het
Pdp1 G A 4: 11,961,607 H254Y probably benign Het
Pds5b A T 5: 150,805,663 D1419V possibly damaging Het
Per1 G T 11: 69,100,649 G3V probably benign Het
Pex16 C A 2: 92,376,643 N55K probably damaging Het
Phldb2 C A 16: 45,774,977 L862F probably benign Het
Pld5 T A 1: 175,964,006 D478V probably benign Het
Pms2 T C 5: 143,914,796 I177T probably damaging Het
Pou1f1 A T 16: 65,529,872 E119D probably benign Het
Ppp2r1a A C 17: 20,958,796 E295A probably damaging Het
Rad51ap2 A T 12: 11,457,592 N505I possibly damaging Het
Rasal3 A C 17: 32,396,562 V434G probably damaging Het
Rasgrf2 C T 13: 91,987,973 V6M Het
Rwdd1 A T 10: 34,001,156 D197E Het
Scn11a A T 9: 119,790,010 C755* probably null Het
Skil T C 3: 31,116,860 S443P probably benign Het
Slc12a6 T C 2: 112,356,472 C939R probably damaging Het
Slc25a36 A G 9: 97,079,177 S269P probably benign Het
Srrm4 T A 5: 116,482,393 H92L unknown Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,301,649 probably benign Het
Tbc1d4 A T 14: 101,507,410 V260E probably benign Het
Tbc1d8 T C 1: 39,385,232 N593D probably damaging Het
Trex1 C A 9: 109,058,737 R62L probably damaging Het
Trpm3 A T 19: 22,715,352 D269V possibly damaging Het
Trpv4 G T 5: 114,633,150 Y439* probably null Het
Ttn G A 2: 76,734,248 T28515I probably damaging Het
Ucn2 G A 9: 108,986,503 G111D probably damaging Het
Uhrf2 A G 19: 30,056,481 I212V possibly damaging Het
Usp24 T A 4: 106,347,367 M261K probably benign Het
Vmn1r235 A T 17: 21,261,698 D95V probably benign Het
Zfp28 T C 7: 6,393,879 C438R probably damaging Het
Other mutations in Vwf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Vwf APN 6 125658872 missense unknown
IGL00561:Vwf APN 6 125642721 missense possibly damaging 0.88
IGL01104:Vwf APN 6 125683556 missense probably damaging 1.00
IGL01404:Vwf APN 6 125677970 missense probably damaging 1.00
IGL01539:Vwf APN 6 125590262 missense possibly damaging 0.85
IGL01550:Vwf APN 6 125679289 missense probably benign 0.00
IGL01563:Vwf APN 6 125591165 missense probably damaging 1.00
IGL01637:Vwf APN 6 125645736 missense probably damaging 1.00
IGL01720:Vwf APN 6 125642835 missense possibly damaging 0.69
IGL01834:Vwf APN 6 125590170 splice site probably benign
IGL02103:Vwf APN 6 125646355 missense probably damaging 1.00
IGL02120:Vwf APN 6 125616034 missense probably benign 0.26
IGL02174:Vwf APN 6 125555395 missense probably damaging 1.00
IGL02203:Vwf APN 6 125642406 missense probably damaging 1.00
IGL02420:Vwf APN 6 125677916 missense probably benign 0.00
IGL02723:Vwf APN 6 125642930 missense possibly damaging 0.85
IGL02818:Vwf APN 6 125663548 missense probably benign
IGL02931:Vwf APN 6 125615968 missense possibly damaging 0.68
IGL03015:Vwf APN 6 125684138 splice site probably benign
IGL03038:Vwf APN 6 125604157 missense possibly damaging 0.92
IGL03060:Vwf APN 6 125663560 missense probably damaging 1.00
IGL03114:Vwf APN 6 125599363 nonsense probably null
IGL03266:Vwf APN 6 125678077 splice site probably benign
gingerman UTSW 6 125662963 critical splice acceptor site probably null
R0605_vwf_644 UTSW 6 125685837 missense probably benign 0.02
R1575_Vwf_091 UTSW 6 125663571 nonsense probably null
R1628_Vwf_608 UTSW 6 125647738 unclassified probably benign
R1669_Vwf_448 UTSW 6 125647906 missense possibly damaging 0.92
R1833_Vwf_948 UTSW 6 125642037 missense probably benign 0.14
R2130_vwf_946 UTSW 6 125657057 missense probably damaging 1.00
R6360_Vwf_065 UTSW 6 125683526 missense probably benign 0.13
R7900_Vwf_938 UTSW 6 125628476 critical splice donor site probably null
Russiahouse UTSW 6 125639341 nonsense probably null
B5639:Vwf UTSW 6 125642984 missense probably damaging 1.00
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0087:Vwf UTSW 6 125645954 missense probably benign 0.03
R0194:Vwf UTSW 6 125643297 missense probably benign
R0206:Vwf UTSW 6 125637456 missense probably damaging 1.00
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0390:Vwf UTSW 6 125626361 nonsense probably null
R0427:Vwf UTSW 6 125673939 missense probably benign
R0437:Vwf UTSW 6 125566318 missense probably damaging 1.00
R0470:Vwf UTSW 6 125628428 missense possibly damaging 0.70
R0499:Vwf UTSW 6 125638114 missense probably benign 0.10
R0554:Vwf UTSW 6 125642781 missense probably benign 0.13
R0605:Vwf UTSW 6 125685837 missense probably benign 0.02
R0711:Vwf UTSW 6 125626271 missense probably benign 0.01
R0723:Vwf UTSW 6 125566262 missense probably benign 0.01
R0973:Vwf UTSW 6 125643006 missense probably damaging 1.00
R1054:Vwf UTSW 6 125590227 missense probably damaging 1.00
R1115:Vwf UTSW 6 125655065 missense unknown
R1156:Vwf UTSW 6 125637488 missense probably damaging 1.00
R1191:Vwf UTSW 6 125599252 missense probably damaging 1.00
R1240:Vwf UTSW 6 125603308 splice site probably null
R1398:Vwf UTSW 6 125603457 missense probably benign 0.02
R1435:Vwf UTSW 6 125642249 nonsense probably null
R1528:Vwf UTSW 6 125608291 missense possibly damaging 0.69
R1575:Vwf UTSW 6 125655251 missense unknown
R1575:Vwf UTSW 6 125663571 nonsense probably null
R1628:Vwf UTSW 6 125647738 unclassified probably benign
R1669:Vwf UTSW 6 125647906 missense possibly damaging 0.92
R1699:Vwf UTSW 6 125643069 missense probably damaging 1.00
R1699:Vwf UTSW 6 125685900 missense possibly damaging 0.74
R1725:Vwf UTSW 6 125646282 missense probably benign 0.05
R1742:Vwf UTSW 6 125667550 missense probably benign 0.02
R1809:Vwf UTSW 6 125590175 splice site probably benign
R1833:Vwf UTSW 6 125642037 missense probably benign 0.14
R1866:Vwf UTSW 6 125667529 missense possibly damaging 0.62
R1870:Vwf UTSW 6 125642939 missense probably damaging 1.00
R1874:Vwf UTSW 6 125628372 missense probably benign 0.00
R1941:Vwf UTSW 6 125639279 missense possibly damaging 0.64
R2061:Vwf UTSW 6 125591188 missense probably damaging 0.98
R2103:Vwf UTSW 6 125646330 missense probably benign 0.31
R2104:Vwf UTSW 6 125646330 missense probably benign 0.31
R2130:Vwf UTSW 6 125657057 missense probably damaging 1.00
R2159:Vwf UTSW 6 125626341 missense probably damaging 0.99
R2178:Vwf UTSW 6 125642132 missense possibly damaging 0.90
R2656:Vwf UTSW 6 125555361 missense probably benign 0.00
R2913:Vwf UTSW 6 125685846 missense probably benign 0.08
R2917:Vwf UTSW 6 125608143 missense probably benign 0.07
R3726:Vwf UTSW 6 125677948 utr 3 prime probably benign
R3735:Vwf UTSW 6 125588613 missense probably damaging 1.00
R3774:Vwf UTSW 6 125649099 splice site probably null
R3934:Vwf UTSW 6 125555499 missense probably damaging 1.00
R4291:Vwf UTSW 6 125642322 missense probably damaging 1.00
R4384:Vwf UTSW 6 125655116 missense unknown
R4743:Vwf UTSW 6 125684091 critical splice acceptor site probably null
R4760:Vwf UTSW 6 125570604 missense probably damaging 1.00
R4776:Vwf UTSW 6 125566305 missense possibly damaging 0.53
R4791:Vwf UTSW 6 125643363 missense
R4871:Vwf UTSW 6 125686462 missense probably benign 0.25
R4894:Vwf UTSW 6 125645934 nonsense probably null
R4963:Vwf UTSW 6 125667483 nonsense probably null
R5010:Vwf UTSW 6 125566257 missense probably benign 0.15
R5289:Vwf UTSW 6 125667510 utr 3 prime probably benign
R5512:Vwf UTSW 6 125673887 utr 3 prime probably benign
R5523:Vwf UTSW 6 125643042 missense
R5642:Vwf UTSW 6 125603418 missense
R5860:Vwf UTSW 6 125643090 missense
R5860:Vwf UTSW 6 125679265 utr 3 prime probably benign
R5896:Vwf UTSW 6 125678762 critical splice acceptor site probably null
R5926:Vwf UTSW 6 125604174 missense probably damaging 1.00
R5976:Vwf UTSW 6 125603463 missense
R6053:Vwf UTSW 6 125600665 missense probably benign 0.21
R6151:Vwf UTSW 6 125657065 missense unknown
R6179:Vwf UTSW 6 125649289 missense unknown
R6181:Vwf UTSW 6 125566146 missense probably damaging 0.98
R6234:Vwf UTSW 6 125657165 missense unknown
R6360:Vwf UTSW 6 125683526 missense probably benign 0.13
R6412:Vwf UTSW 6 125679316 missense probably benign 0.00
R6464:Vwf UTSW 6 125639400 critical splice donor site probably null
R6522:Vwf UTSW 6 125662963 critical splice acceptor site probably null
R6766:Vwf UTSW 6 125639376 missense unknown
R6856:Vwf UTSW 6 125642150 nonsense probably null
R6877:Vwf UTSW 6 125657201 missense possibly damaging 0.48
R6896:Vwf UTSW 6 125566194 missense probably damaging 1.00
R7113:Vwf UTSW 6 125655044 missense
R7287:Vwf UTSW 6 125637467 missense
R7359:Vwf UTSW 6 125566257 missense
R7509:Vwf UTSW 6 125642169 missense
R7519:Vwf UTSW 6 125667543 missense
R7545:Vwf UTSW 6 125614097 missense
R7549:Vwf UTSW 6 125626267 missense
R7593:Vwf UTSW 6 125647768 missense
R7635:Vwf UTSW 6 125682734 missense
R7793:Vwf UTSW 6 125686520 missense
R7802:Vwf UTSW 6 125666677 missense
R7824:Vwf UTSW 6 125658815 missense
R7849:Vwf UTSW 6 125656803 missense
R7900:Vwf UTSW 6 125628476 critical splice donor site probably null
R7919:Vwf UTSW 6 125647859 missense
R7966:Vwf UTSW 6 125639341 nonsense probably null
R8101:Vwf UTSW 6 125570559 nonsense probably null
R8162:Vwf UTSW 6 125645836 splice site probably null
R8345:Vwf UTSW 6 125679302 missense
R8853:Vwf UTSW 6 125657264 missense
R9027:Vwf UTSW 6 125666663 missense
R9065:Vwf UTSW 6 125646299 missense
R9068:Vwf UTSW 6 125648829 unclassified probably benign
R9128:Vwf UTSW 6 125642730 missense
R9136:Vwf UTSW 6 125599393 splice site probably benign
R9164:Vwf UTSW 6 125565843 missense
R9177:Vwf UTSW 6 125604291 missense
R9334:Vwf UTSW 6 125677946 missense
R9508:Vwf UTSW 6 125555508 missense
R9553:Vwf UTSW 6 125600699 missense
R9660:Vwf UTSW 6 125591707 missense possibly damaging 0.61
R9706:Vwf UTSW 6 125624573 missense
R9708:Vwf UTSW 6 125657090 missense
R9714:Vwf UTSW 6 125624573 missense
R9728:Vwf UTSW 6 125591707 missense possibly damaging 0.61
R9758:Vwf UTSW 6 125626267 missense
X0021:Vwf UTSW 6 125646331 missense probably damaging 1.00
X0065:Vwf UTSW 6 125603433 missense probably null 0.05
Z1176:Vwf UTSW 6 125591231 missense
Z1176:Vwf UTSW 6 125603308 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTGGCTACTTCCTTGCTGAG -3'
(R):5'- TGTGACTGAGCAGTAATGGG -3'

Sequencing Primer
(F):5'- CTGAGGTTATCCCTGGCTCAG -3'
(R):5'- AAAGAGCACTGGGGTTCCC -3'
Posted On 2022-10-06