Incidental Mutation 'R9712:Per1'
ID 730268
Institutional Source Beutler Lab
Gene Symbol Per1
Ensembl Gene ENSMUSG00000020893
Gene Name period circadian clock 1
Synonyms mPer1, m-rigui, Hftm
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.570) question?
Stock # R9712 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 68986043-69000786 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 68991475 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 3 (G3V)
Ref Sequence ENSEMBL: ENSMUSP00000021271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021271] [ENSMUST00000101004] [ENSMUST00000102605] [ENSMUST00000132462] [ENSMUST00000142392] [ENSMUST00000166748]
AlphaFold O35973
PDB Structure Unwinding the Differences of the Mammalian PERIOD Clock Proteins from Crystal Structure to Cellular Function [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000021271
AA Change: G3V

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021271
Gene: ENSMUSG00000020893
AA Change: G3V

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
PAS 208 275 4.19e0 SMART
PAS 348 414 1.12e-4 SMART
PAC 422 465 1.6e0 SMART
low complexity region 473 481 N/A INTRINSIC
low complexity region 513 543 N/A INTRINSIC
low complexity region 571 578 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
low complexity region 747 772 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 817 844 N/A INTRINSIC
low complexity region 852 877 N/A INTRINSIC
low complexity region 890 901 N/A INTRINSIC
low complexity region 945 972 N/A INTRINSIC
low complexity region 996 1013 N/A INTRINSIC
Pfam:Period_C 1031 1222 1.5e-78 PFAM
low complexity region 1270 1280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101004
AA Change: G3V

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000098566
Gene: ENSMUSG00000020893
AA Change: G3V

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
PAS 208 275 4.19e0 SMART
PAS 348 414 1.12e-4 SMART
PAC 422 465 1.6e0 SMART
low complexity region 473 481 N/A INTRINSIC
low complexity region 513 543 N/A INTRINSIC
low complexity region 571 578 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
low complexity region 747 772 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102605
AA Change: G3V

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099665
Gene: ENSMUSG00000020893
AA Change: G3V

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
Blast:PAS 203 255 1e-23 BLAST
PAS 328 394 1.12e-4 SMART
PAC 402 445 1.6e0 SMART
low complexity region 453 461 N/A INTRINSIC
low complexity region 493 523 N/A INTRINSIC
low complexity region 551 558 N/A INTRINSIC
low complexity region 632 646 N/A INTRINSIC
low complexity region 727 752 N/A INTRINSIC
low complexity region 774 788 N/A INTRINSIC
low complexity region 797 824 N/A INTRINSIC
low complexity region 832 857 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
low complexity region 925 952 N/A INTRINSIC
low complexity region 976 993 N/A INTRINSIC
Pfam:Period_C 1011 1210 7.5e-75 PFAM
low complexity region 1250 1260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132462
AA Change: G3V

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122164
Gene: ENSMUSG00000020893
AA Change: G3V

DomainStartEndE-ValueType
low complexity region 48 81 N/A INTRINSIC
low complexity region 86 104 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142392
AA Change: G3V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121713
Gene: ENSMUSG00000020893
AA Change: G3V

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
PAS 208 275 4.19e0 SMART
PAS 348 414 1.12e-4 SMART
PAC 422 465 1.6e0 SMART
low complexity region 473 481 N/A INTRINSIC
low complexity region 513 543 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166748
AA Change: G3V

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132635
Gene: ENSMUSG00000020893
AA Change: G3V

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
PAS 208 275 4.19e0 SMART
PAS 348 414 1.12e-4 SMART
PAC 422 465 1.6e0 SMART
low complexity region 473 481 N/A INTRINSIC
low complexity region 513 543 N/A INTRINSIC
low complexity region 571 578 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
low complexity region 747 772 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 817 844 N/A INTRINSIC
low complexity region 852 877 N/A INTRINSIC
low complexity region 890 901 N/A INTRINSIC
low complexity region 945 972 N/A INTRINSIC
low complexity region 996 1013 N/A INTRINSIC
Pfam:Period_C 1031 1230 5.2e-75 PFAM
low complexity region 1270 1280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene may increase the risk of getting certain cancers. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice display a persistent circadian rhythm, but they have a shorter period and their ability to maintain the precision and the stability of the period is impaired. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(3) Gene trapped(5)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik A T 19: 3,765,784 (GRCm39) M20L probably benign Het
Aadacl4fm1 C T 4: 144,255,354 (GRCm39) A258V probably benign Het
Abca8b T A 11: 109,833,163 (GRCm39) D1241V probably benign Het
Adam20 G A 8: 41,248,490 (GRCm39) R200H probably benign Het
Adcy10 T C 1: 165,340,681 (GRCm39) F229L probably damaging Het
Adsl A T 15: 80,839,840 (GRCm39) N126I probably benign Het
Ahnak GATCTCTAT GAT 19: 8,984,393 (GRCm39) probably benign Het
Ahnak AGATCTC A 19: 8,984,392 (GRCm39) probably benign Het
Aktip G A 8: 91,856,355 (GRCm39) P41S probably damaging Het
Alkbh3 C A 2: 93,811,318 (GRCm39) R258L probably damaging Het
Arfgap3 A G 15: 83,197,734 (GRCm39) Y341H probably benign Het
Arhgef26 C T 3: 62,331,034 (GRCm39) L583F probably damaging Het
Arhgef40 T C 14: 52,226,415 (GRCm39) I153T probably damaging Het
Atp1a1 T C 3: 101,498,757 (GRCm39) S179G probably benign Het
Bok T C 1: 93,614,229 (GRCm39) S21P probably damaging Het
Ccdc136 A G 6: 29,417,441 (GRCm39) E754G probably benign Het
Cers3 A G 7: 66,423,378 (GRCm39) K108E probably benign Het
Cmya5 T C 13: 93,201,881 (GRCm39) probably null Het
Col19a1 T C 1: 24,367,148 (GRCm39) E478G possibly damaging Het
Colec10 T A 15: 54,323,180 (GRCm39) S134R possibly damaging Het
Ctnnb1 A T 9: 120,784,895 (GRCm39) I514F probably damaging Het
Cux1 C T 5: 136,338,673 (GRCm39) E664K probably benign Het
Dars1 T C 1: 128,333,199 (GRCm39) Q75R probably benign Het
Disp1 T A 1: 182,917,379 (GRCm39) S16C probably damaging Het
Dnah7a A T 1: 53,598,299 (GRCm39) V1412E probably benign Het
Ect2l C T 10: 18,044,182 (GRCm39) V226I probably benign Het
Ep400 T A 5: 110,904,509 (GRCm39) H30L unknown Het
Ephx4 A G 5: 107,567,647 (GRCm39) I202V probably benign Het
Exoc3 A T 13: 74,341,027 (GRCm39) F259Y probably damaging Het
Ezr T C 17: 7,020,394 (GRCm39) E229G probably damaging Het
Fat1 A T 8: 45,470,417 (GRCm39) I1472L probably benign Het
Fsd1l T G 4: 53,679,972 (GRCm39) D223E probably benign Het
Gata6 A T 18: 11,059,064 (GRCm39) D377V possibly damaging Het
Gm12185 A T 11: 48,798,216 (GRCm39) M759K probably benign Het
Gm9922 C T 14: 101,966,893 (GRCm39) A120T unknown Het
Hectd4 A T 5: 121,448,744 (GRCm39) Y364F probably benign Het
Hnrnph1 A G 11: 50,276,696 (GRCm39) S465G unknown Het
Ifi204 T C 1: 173,576,924 (GRCm39) Y559C probably damaging Het
Ift88 T C 14: 57,718,853 (GRCm39) S613P probably damaging Het
Kif21a G C 15: 90,869,528 (GRCm39) A441G probably damaging Het
Kif21a G T 15: 90,879,715 (GRCm39) T191K probably benign Het
Lrit1 T A 14: 36,782,084 (GRCm39) C252* probably null Het
Ncbp1 T A 4: 46,144,837 (GRCm39) D29E probably benign Het
Nlrp10 A T 7: 108,524,735 (GRCm39) D248E probably damaging Het
Nphp4 T G 4: 152,631,521 (GRCm39) V807G probably benign Het
Nsd1 T C 13: 55,393,856 (GRCm39) S589P possibly damaging Het
Oas1b T A 5: 120,952,550 (GRCm39) N80K probably damaging Het
Oprk1 T A 1: 5,669,096 (GRCm39) C181S probably damaging Het
Oprl1 T A 2: 181,360,212 (GRCm39) N89K probably damaging Het
Or5w12 A T 2: 87,502,105 (GRCm39) I202N probably benign Het
Or8k53 G A 2: 86,177,583 (GRCm39) H176Y probably benign Het
Pdcd11 A G 19: 47,117,741 (GRCm39) K1697E probably damaging Het
Pdp1 G A 4: 11,961,607 (GRCm39) H254Y probably benign Het
Pds5b A T 5: 150,729,128 (GRCm39) D1419V possibly damaging Het
Pex16 C A 2: 92,206,988 (GRCm39) N55K probably damaging Het
Phldb2 C A 16: 45,595,340 (GRCm39) L862F probably benign Het
Pld5 T A 1: 175,791,572 (GRCm39) D478V probably benign Het
Pms2 T C 5: 143,851,614 (GRCm39) I177T probably damaging Het
Pou1f1 A T 16: 65,326,758 (GRCm39) E119D probably benign Het
Ppp2r1a A C 17: 21,179,058 (GRCm39) E295A probably damaging Het
Qrfprl A G 6: 65,433,124 (GRCm39) I315V probably benign Het
Rad51ap2 A T 12: 11,507,593 (GRCm39) N505I possibly damaging Het
Rasal3 A C 17: 32,615,536 (GRCm39) V434G probably damaging Het
Rasgrf2 C T 13: 92,136,092 (GRCm39) V6M Het
Rwdd1 A T 10: 33,877,152 (GRCm39) D197E Het
Scn11a A T 9: 119,619,076 (GRCm39) C755* probably null Het
Skil T C 3: 31,171,009 (GRCm39) S443P probably benign Het
Slc12a6 T C 2: 112,186,817 (GRCm39) C939R probably damaging Het
Slc25a36 A G 9: 96,961,230 (GRCm39) S269P probably benign Het
Srrm4 T A 5: 116,620,452 (GRCm39) H92L unknown Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Tbc1d4 A T 14: 101,744,846 (GRCm39) V260E probably benign Het
Tbc1d8 T C 1: 39,424,313 (GRCm39) N593D probably damaging Het
Trex1 C A 9: 108,887,805 (GRCm39) R62L probably damaging Het
Trpm3 A T 19: 22,692,716 (GRCm39) D269V possibly damaging Het
Trpv4 G T 5: 114,771,211 (GRCm39) Y439* probably null Het
Ttn G A 2: 76,564,592 (GRCm39) T28515I probably damaging Het
Ucn2 G A 9: 108,815,571 (GRCm39) G111D probably damaging Het
Uhrf2 A G 19: 30,033,881 (GRCm39) I212V possibly damaging Het
Usp24 T A 4: 106,204,564 (GRCm39) M261K probably benign Het
Vmn1r235 A T 17: 21,481,960 (GRCm39) D95V probably benign Het
Vwf G A 6: 125,601,536 (GRCm39) R826Q Het
Zfp1002 C T 2: 150,096,496 (GRCm39) R311Q probably benign Het
Zfp28 T C 7: 6,396,878 (GRCm39) C438R probably damaging Het
Other mutations in Per1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01817:Per1 APN 11 68,995,025 (GRCm39) missense probably damaging 1.00
IGL01907:Per1 APN 11 68,996,425 (GRCm39) missense probably benign 0.00
IGL02078:Per1 APN 11 68,995,125 (GRCm39) missense probably damaging 1.00
IGL02296:Per1 APN 11 68,993,001 (GRCm39) missense probably damaging 1.00
IGL02677:Per1 APN 11 68,997,486 (GRCm39) missense probably benign 0.07
0152:Per1 UTSW 11 68,994,848 (GRCm39) splice site probably benign
IGL03048:Per1 UTSW 11 68,995,552 (GRCm39) missense probably damaging 0.99
P0043:Per1 UTSW 11 68,992,869 (GRCm39) splice site probably benign
R0089:Per1 UTSW 11 68,994,869 (GRCm39) missense probably benign 0.27
R0116:Per1 UTSW 11 68,992,706 (GRCm39) splice site probably benign
R0395:Per1 UTSW 11 68,993,103 (GRCm39) missense probably damaging 1.00
R0531:Per1 UTSW 11 68,995,016 (GRCm39) missense probably damaging 1.00
R0681:Per1 UTSW 11 68,992,027 (GRCm39) missense probably damaging 1.00
R0788:Per1 UTSW 11 68,992,185 (GRCm39) splice site probably benign
R1233:Per1 UTSW 11 68,993,037 (GRCm39) missense probably damaging 1.00
R1554:Per1 UTSW 11 68,994,453 (GRCm39) missense probably damaging 1.00
R3793:Per1 UTSW 11 69,000,127 (GRCm39) missense probably benign 0.30
R4706:Per1 UTSW 11 68,991,444 (GRCm39) start gained probably benign
R4716:Per1 UTSW 11 68,992,057 (GRCm39) missense probably damaging 1.00
R4965:Per1 UTSW 11 68,995,227 (GRCm39) missense probably benign 0.06
R5111:Per1 UTSW 11 68,991,612 (GRCm39) missense probably damaging 1.00
R5270:Per1 UTSW 11 68,994,424 (GRCm39) missense probably benign
R5583:Per1 UTSW 11 68,994,271 (GRCm39) missense probably damaging 1.00
R5588:Per1 UTSW 11 68,998,453 (GRCm39) missense probably damaging 1.00
R6184:Per1 UTSW 11 68,993,730 (GRCm39) missense probably damaging 1.00
R6430:Per1 UTSW 11 68,995,122 (GRCm39) missense probably damaging 1.00
R6819:Per1 UTSW 11 68,992,284 (GRCm39) missense probably damaging 1.00
R6911:Per1 UTSW 11 68,994,083 (GRCm39) missense probably damaging 1.00
R7158:Per1 UTSW 11 68,994,930 (GRCm39) unclassified probably benign
R7340:Per1 UTSW 11 68,994,008 (GRCm39) missense probably damaging 1.00
R7438:Per1 UTSW 11 68,995,561 (GRCm39) missense possibly damaging 0.79
R7513:Per1 UTSW 11 68,996,397 (GRCm39) missense probably benign 0.00
R7555:Per1 UTSW 11 68,997,339 (GRCm39) missense probably damaging 1.00
R7921:Per1 UTSW 11 68,991,605 (GRCm39) missense probably damaging 1.00
R8059:Per1 UTSW 11 68,997,309 (GRCm39) missense probably damaging 1.00
R8345:Per1 UTSW 11 68,998,382 (GRCm39) missense possibly damaging 0.63
R8408:Per1 UTSW 11 68,999,953 (GRCm39) missense possibly damaging 0.86
R9208:Per1 UTSW 11 68,995,636 (GRCm39) missense possibly damaging 0.50
R9424:Per1 UTSW 11 68,998,855 (GRCm39) missense probably damaging 0.98
R9555:Per1 UTSW 11 68,995,574 (GRCm39) missense probably benign 0.00
R9576:Per1 UTSW 11 68,998,855 (GRCm39) missense probably damaging 0.98
R9616:Per1 UTSW 11 68,993,554 (GRCm39) missense probably damaging 1.00
X0023:Per1 UTSW 11 68,993,950 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGGGGTTAATAGCTCAGC -3'
(R):5'- ATGAGAACTCCGCTGAGATGC -3'

Sequencing Primer
(F):5'- GCTTTTGCTAAACATTCCTTTTTGG -3'
(R):5'- TGAGATGCGCCCCTGGAC -3'
Posted On 2022-10-06