Mutagenetix > Incidental Mutation

Incidental Mutation 'R9712:Nsd1'

730271

Institutional Source

Beutler Lab

Gene Symbol

Nsd1

Ensembl Gene

ENSMUSG00000021488

Gene Name

nuclear receptor-binding SET-domain protein 1

Synonyms

KMT3B

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9712 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

55209782-55318325 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 55246043 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 589 (S589P)

Ref Sequence

ENSEMBL: ENSMUSP00000097089 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099490] [ENSMUST00000224973]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099490
AA Change: S589P

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000097089
Gene: ENSMUSG00000021488
AA Change: S589P

Domain	Start	End	E-Value	Type
low complexity region	177	187	N/A	INTRINSIC
low complexity region	281	289	N/A	INTRINSIC
PWWP	322	388	1.97e-3	SMART
low complexity region	635	644	N/A	INTRINSIC
low complexity region	980	1000	N/A	INTRINSIC
low complexity region	1296	1309	N/A	INTRINSIC
PHD	1546	1588	4.25e-8	SMART
PHD	1593	1640	3.79e-5	SMART
RING	1594	1639	1.08e-1	SMART
PHD	1641	1694	1.09e1	SMART
PHD	1710	1750	1.02e-10	SMART
PWWP	1755	1817	8.87e-29	SMART
AWS	1891	1942	3.02e-22	SMART
SET	1943	2066	1e-45	SMART
PostSET	2067	2083	3.99e-3	SMART
PHD	2121	2164	1.08e-9	SMART
low complexity region	2224	2237	N/A	INTRINSIC
low complexity region	2276	2286	N/A	INTRINSIC
low complexity region	2335	2356	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000224973
AA Change: S486P

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a SET domain, 2 LXXLL motifs, 3 nuclear translocation signals (NLSs), 4 plant homeodomain (PHD) finger regions, and a proline-rich region. The encoded protein enhances androgen receptor (AR) transactivation, and this enhancement can be increased further in the presence of other androgen receptor associated coregulators. This protein may act as a nucleus-localized, basic transcriptional factor and also as a bifunctional transcriptional regulator. Mutations of this gene have been associated with Sotos syndrome and Weaver syndrome. One version of childhood acute myeloid leukemia is the result of a cryptic translocation with the breakpoints occurring within nuclear receptor-binding Su-var, enhancer of zeste, and trithorax domain protein 1 on chromosome 5 and nucleoporin, 98-kd on chromosome 11. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit excess apoptosis and retarded growth, fail to complete gastrulation, and are resorbed by embryonic day 10. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	A	T	19: 3,715,784	M20L	probably benign	Het
9430007A20Rik	C	T	4: 144,528,784	A258V	probably benign	Het
Abca8b	T	A	11: 109,942,337	D1241V	probably benign	Het
Adam20	G	A	8: 40,795,453	R200H	probably benign	Het
Adcy10	T	C	1: 165,513,112	F229L	probably damaging	Het
Adsl	A	T	15: 80,955,639	N126I	probably benign	Het
Ahnak	AGATCTC	A	19: 9,007,028		probably benign	Het
Ahnak	GATCTCTAT	GAT	19: 9,007,029		probably benign	Het
Aktip	G	A	8: 91,129,727	P41S	probably damaging	Het
Alkbh3	C	A	2: 93,980,973	R258L	probably damaging	Het
Arfgap3	A	G	15: 83,313,533	Y341H	probably benign	Het
Arhgef26	C	T	3: 62,423,613	L583F	probably damaging	Het
Arhgef40	T	C	14: 51,988,958	I153T	probably damaging	Het
Atp1a1	T	C	3: 101,591,441	S179G	probably benign	Het
Bok	T	C	1: 93,686,507	S21P	probably damaging	Het
C130060K24Rik	A	G	6: 65,456,140	I315V	probably benign	Het
Ccdc136	A	G	6: 29,417,442	E754G	probably benign	Het
Cers3	A	G	7: 66,773,630	K108E	probably benign	Het
Cmya5	T	C	13: 93,065,373		probably null	Het
Col19a1	T	C	1: 24,328,067	E478G	possibly damaging	Het
Colec10	T	A	15: 54,459,784	S134R	possibly damaging	Het
Ctnnb1	A	T	9: 120,955,829	I514F	probably damaging	Het
Cux1	C	T	5: 136,309,819	E664K	probably benign	Het
Dars	T	C	1: 128,405,462	Q75R	probably benign	Het
Disp1	T	A	1: 183,135,815	S16C	probably damaging	Het
Dnah7a	A	T	1: 53,559,140	V1412E	probably benign	Het
Ect2l	C	T	10: 18,168,434	V226I	probably benign	Het
Ep400	T	A	5: 110,756,643	H30L	unknown	Het
Ephx4	A	G	5: 107,419,781	I202V	probably benign	Het
Exoc3	A	T	13: 74,192,908	F259Y	probably damaging	Het
Ezr	T	C	17: 6,752,995	E229G	probably damaging	Het
Fat1	A	T	8: 45,017,380	I1472L	probably benign	Het
Fsd1l	T	G	4: 53,679,972	D223E	probably benign	Het
Gata6	A	T	18: 11,059,064	D377V	possibly damaging	Het
Gm12185	A	T	11: 48,907,389	M759K	probably benign	Het
Gm21994	C	T	2: 150,254,576	R311Q	probably benign	Het
Gm9922	C	T	14: 101,729,457	A120T	unknown	Het
Hectd4	A	T	5: 121,310,681	Y364F	probably benign	Het
Hnrnph1	A	G	11: 50,385,869	S465G	unknown	Het
Ifi204	T	C	1: 173,749,358	Y559C	probably damaging	Het
Ift88	T	C	14: 57,481,396	S613P	probably damaging	Het
Kif21a	G	C	15: 90,985,325	A441G	probably damaging	Het
Kif21a	G	T	15: 90,995,512	T191K	probably benign	Het
Lrit1	T	A	14: 37,060,127	C252*	probably null	Het
Ncbp1	T	A	4: 46,144,837	D29E	probably benign	Het
Nlrp10	A	T	7: 108,925,528	D248E	probably damaging	Het
Nphp4	T	G	4: 152,547,064	V807G	probably benign	Het
Oas1b	T	A	5: 120,814,485	N80K	probably damaging	Het
Olfr1055	G	A	2: 86,347,239	H176Y	probably benign	Het
Olfr1135	A	T	2: 87,671,761	I202N	probably benign	Het
Oprk1	T	A	1: 5,598,873	C181S	probably damaging	Het
Oprl1	T	A	2: 181,718,419	N89K	probably damaging	Het
Pdcd11	A	G	19: 47,129,302	K1697E	probably damaging	Het
Pdp1	G	A	4: 11,961,607	H254Y	probably benign	Het
Pds5b	A	T	5: 150,805,663	D1419V	possibly damaging	Het
Per1	G	T	11: 69,100,649	G3V	probably benign	Het
Pex16	C	A	2: 92,376,643	N55K	probably damaging	Het
Phldb2	C	A	16: 45,774,977	L862F	probably benign	Het
Pld5	T	A	1: 175,964,006	D478V	probably benign	Het
Pms2	T	C	5: 143,914,796	I177T	probably damaging	Het
Pou1f1	A	T	16: 65,529,872	E119D	probably benign	Het
Ppp2r1a	A	C	17: 20,958,796	E295A	probably damaging	Het
Rad51ap2	A	T	12: 11,457,592	N505I	possibly damaging	Het
Rasal3	A	C	17: 32,396,562	V434G	probably damaging	Het
Rasgrf2	C	T	13: 91,987,973	V6M		Het
Rwdd1	A	T	10: 34,001,156	D197E		Het
Scn11a	A	T	9: 119,790,010	C755*	probably null	Het
Skil	T	C	3: 31,116,860	S443P	probably benign	Het
Slc12a6	T	C	2: 112,356,472	C939R	probably damaging	Het
Slc25a36	A	G	9: 97,079,177	S269P	probably benign	Het
Srrm4	T	A	5: 116,482,393	H92L	unknown	Het
Styk1	CTCTTCATGATTTTCTT	CTCTT	6: 131,301,649		probably benign	Het
Tbc1d4	A	T	14: 101,507,410	V260E	probably benign	Het
Tbc1d8	T	C	1: 39,385,232	N593D	probably damaging	Het
Trex1	C	A	9: 109,058,737	R62L	probably damaging	Het
Trpm3	A	T	19: 22,715,352	D269V	possibly damaging	Het
Trpv4	G	T	5: 114,633,150	Y439*	probably null	Het
Ttn	G	A	2: 76,734,248	T28515I	probably damaging	Het
Ucn2	G	A	9: 108,986,503	G111D	probably damaging	Het
Uhrf2	A	G	19: 30,056,481	I212V	possibly damaging	Het
Usp24	T	A	4: 106,347,367	M261K	probably benign	Het
Vmn1r235	A	T	17: 21,261,698	D95V	probably benign	Het
Vwf	G	A	6: 125,624,573	R826Q		Het
Zfp28	T	C	7: 6,393,879	C438R	probably damaging	Het

Other mutations in Nsd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Nsd1	APN	13	55238735	missense	probably damaging	1.00
IGL01060:Nsd1	APN	13	55263429	missense	probably damaging	1.00
IGL01125:Nsd1	APN	13	55245617	missense	probably damaging	1.00
IGL01746:Nsd1	APN	13	55276515	splice site	probably null
IGL02437:Nsd1	APN	13	55313441	missense	probably damaging	1.00
IGL02530:Nsd1	APN	13	55302833	splice site	probably benign
IGL02557:Nsd1	APN	13	55312448	missense	probably damaging	1.00
IGL02572:Nsd1	APN	13	55296130	missense	probably damaging	1.00
IGL02665:Nsd1	APN	13	55296183	missense	probably damaging	1.00
IGL02870:Nsd1	APN	13	55313603	missense	probably benign	0.06
IGL03181:Nsd1	APN	13	55247045	missense	probably damaging	1.00
Amanuensis	UTSW	13	55261626	nonsense	probably null
handwriting	UTSW	13	55313546	missense
Prothonotary	UTSW	13	55282757	missense	probably damaging	1.00
scribe	UTSW	13	55291236	missense	probably damaging	1.00
stenographer	UTSW	13	55298376	splice site	probably null
PIT4480001:Nsd1	UTSW	13	55213918	missense	probably benign	0.11
R0316:Nsd1	UTSW	13	55213771	missense	probably damaging	0.98
R0519:Nsd1	UTSW	13	55312835	missense	probably benign	0.04
R0542:Nsd1	UTSW	13	55260458	missense	possibly damaging	0.93
R0563:Nsd1	UTSW	13	55246578	missense	possibly damaging	0.48
R0652:Nsd1	UTSW	13	55247586	missense	possibly damaging	0.92
R0906:Nsd1	UTSW	13	55277590	missense	probably benign	0.30
R1560:Nsd1	UTSW	13	55246720	nonsense	probably null
R1572:Nsd1	UTSW	13	55246969	missense	probably damaging	0.98
R1693:Nsd1	UTSW	13	55247261	missense	probably benign
R1697:Nsd1	UTSW	13	55214059	critical splice acceptor site	probably null
R1720:Nsd1	UTSW	13	55246898	missense	probably damaging	0.98
R1829:Nsd1	UTSW	13	55246369	missense	probably damaging	1.00
R1834:Nsd1	UTSW	13	55313351	missense	possibly damaging	0.52
R1842:Nsd1	UTSW	13	55246445	missense	probably damaging	1.00
R1880:Nsd1	UTSW	13	55213793	missense	probably damaging	0.99
R2022:Nsd1	UTSW	13	55213279	missense	probably damaging	0.99
R2075:Nsd1	UTSW	13	55310500	missense	possibly damaging	0.74
R2143:Nsd1	UTSW	13	55260397	missense	probably damaging	1.00
R2151:Nsd1	UTSW	13	55291236	missense	probably damaging	1.00
R2316:Nsd1	UTSW	13	55233966	missense	probably damaging	1.00
R2359:Nsd1	UTSW	13	55213711	missense	possibly damaging	0.90
R2361:Nsd1	UTSW	13	55213711	missense	possibly damaging	0.90
R2656:Nsd1	UTSW	13	55246868	missense	probably damaging	1.00
R2849:Nsd1	UTSW	13	55213692	missense	probably damaging	0.99
R3237:Nsd1	UTSW	13	55312888	missense	possibly damaging	0.92
R3772:Nsd1	UTSW	13	55246673	missense	probably benign	0.00
R3773:Nsd1	UTSW	13	55246673	missense	probably benign	0.00
R3849:Nsd1	UTSW	13	55246691	missense	probably benign	0.00
R3951:Nsd1	UTSW	13	55268454	missense	probably benign	0.05
R4036:Nsd1	UTSW	13	55213711	missense	possibly damaging	0.90
R4073:Nsd1	UTSW	13	55247728	missense	probably benign	0.28
R4080:Nsd1	UTSW	13	55301809	missense	probably damaging	0.96
R4226:Nsd1	UTSW	13	55260401	missense	probably damaging	1.00
R4485:Nsd1	UTSW	13	55245621	missense	probably benign
R4703:Nsd1	UTSW	13	55214063	missense	probably damaging	1.00
R4853:Nsd1	UTSW	13	55268504	missense	probably benign	0.30
R4915:Nsd1	UTSW	13	55247868	missense	possibly damaging	0.65
R4915:Nsd1	UTSW	13	55276528	missense	probably benign	0.00
R5264:Nsd1	UTSW	13	55247346	missense	possibly damaging	0.49
R5348:Nsd1	UTSW	13	55312334	missense	probably benign	0.00
R5473:Nsd1	UTSW	13	55247772	missense	probably damaging	1.00
R5498:Nsd1	UTSW	13	55213302	nonsense	probably null
R5503:Nsd1	UTSW	13	55245939	missense	probably damaging	1.00
R5511:Nsd1	UTSW	13	55312730	missense	probably benign	0.00
R5683:Nsd1	UTSW	13	55246148	missense	probably benign	0.00
R5778:Nsd1	UTSW	13	55306979	missense	probably damaging	1.00
R5793:Nsd1	UTSW	13	55248006	missense	probably benign
R5922:Nsd1	UTSW	13	55247475	missense	probably benign	0.01
R5956:Nsd1	UTSW	13	55263404	missense	probably damaging	1.00
R6053:Nsd1	UTSW	13	55293609	missense	probably damaging	1.00
R6141:Nsd1	UTSW	13	55291284	missense	probably damaging	1.00
R6158:Nsd1	UTSW	13	55245621	missense	probably benign
R6224:Nsd1	UTSW	13	55313132	missense	possibly damaging	0.85
R6396:Nsd1	UTSW	13	55238789	missense	probably damaging	1.00
R6598:Nsd1	UTSW	13	55293702	missense	possibly damaging	0.94
R7170:Nsd1	UTSW	13	55261626	nonsense	probably null
R7205:Nsd1	UTSW	13	55246470	missense	probably damaging	1.00
R7215:Nsd1	UTSW	13	55247641	missense	probably benign	0.00
R7337:Nsd1	UTSW	13	55246209	missense	probably damaging	1.00
R7432:Nsd1	UTSW	13	55213374	missense	probably benign
R7638:Nsd1	UTSW	13	55312328	missense	probably benign	0.01
R7647:Nsd1	UTSW	13	55299835	missense	probably damaging	0.96
R7658:Nsd1	UTSW	13	55277639	missense	probably damaging	1.00
R7884:Nsd1	UTSW	13	55313255	missense	probably damaging	0.99
R8032:Nsd1	UTSW	13	55310383	missense	probably damaging	1.00
R8113:Nsd1	UTSW	13	55245621	missense	probably benign
R8152:Nsd1	UTSW	13	55310367	missense	possibly damaging	0.49
R8183:Nsd1	UTSW	13	55312373	missense	probably damaging	1.00
R8432:Nsd1	UTSW	13	55247703	missense	possibly damaging	0.91
R8462:Nsd1	UTSW	13	55298376	splice site	probably null
R8469:Nsd1	UTSW	13	55277553	missense	possibly damaging	0.76
R8756:Nsd1	UTSW	13	55313693	missense	probably benign	0.00
R8867:Nsd1	UTSW	13	55282757	missense	probably damaging	1.00
R9035:Nsd1	UTSW	13	55245854	missense	possibly damaging	0.79
R9101:Nsd1	UTSW	13	55313546	missense
R9154:Nsd1	UTSW	13	55213440	missense	probably damaging	1.00
R9155:Nsd1	UTSW	13	55213440	missense	probably damaging	1.00
R9262:Nsd1	UTSW	13	55247058	missense	possibly damaging	0.92
R9592:Nsd1	UTSW	13	55276542	missense	probably damaging	1.00
R9604:Nsd1	UTSW	13	55233994	missense	probably benign	0.25
R9716:Nsd1	UTSW	13	55310500	missense	possibly damaging	0.74
R9787:Nsd1	UTSW	13	55313705	missense	probably benign	0.15
Z1088:Nsd1	UTSW	13	55213848	missense	possibly damaging	0.83
Z1176:Nsd1	UTSW	13	55245525	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATCTGGTGCCATTTGAATCAC -3'
(R):5'- TGCAGCCATCATCAGAAGTG -3'

Sequencing Primer
(F):5'- CTGGTGCCATTTGAATCACGTAAAG -3'
(R):5'- GTGGTACTCACACTGACAGAATTGC -3'

Posted On

2022-10-06