Mutagenetix > Incidental Mutation

Incidental Mutation 'R9712:Exoc3'

730272

Institutional Source

Beutler Lab

Gene Symbol

Exoc3

Ensembl Gene

ENSMUSG00000034152

Gene Name

exocyst complex component 3

Synonyms

Sec6l1, E430013E20Rik, 2810050O03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.967) question?

Stock #

R9712 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

74169488-74208732 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 74192908 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 259 (F259Y)

Ref Sequence

ENSEMBL: ENSMUSP00000039416 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035934] [ENSMUST00000222213]

AlphaFold

Q6KAR6

Predicted Effect

probably damaging
Transcript: ENSMUST00000035934
AA Change: F259Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000039416
Gene: ENSMUSG00000034152
AA Change: F259Y

Domain	Start	End	E-Value	Type
Pfam:Sec6	187	743	1.7e-162	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000222213

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	A	T	19: 3,715,784	M20L	probably benign	Het
9430007A20Rik	C	T	4: 144,528,784	A258V	probably benign	Het
Abca8b	T	A	11: 109,942,337	D1241V	probably benign	Het
Adam20	G	A	8: 40,795,453	R200H	probably benign	Het
Adcy10	T	C	1: 165,513,112	F229L	probably damaging	Het
Adsl	A	T	15: 80,955,639	N126I	probably benign	Het
Ahnak	AGATCTC	A	19: 9,007,028		probably benign	Het
Ahnak	GATCTCTAT	GAT	19: 9,007,029		probably benign	Het
Aktip	G	A	8: 91,129,727	P41S	probably damaging	Het
Alkbh3	C	A	2: 93,980,973	R258L	probably damaging	Het
Arfgap3	A	G	15: 83,313,533	Y341H	probably benign	Het
Arhgef26	C	T	3: 62,423,613	L583F	probably damaging	Het
Arhgef40	T	C	14: 51,988,958	I153T	probably damaging	Het
Atp1a1	T	C	3: 101,591,441	S179G	probably benign	Het
Bok	T	C	1: 93,686,507	S21P	probably damaging	Het
C130060K24Rik	A	G	6: 65,456,140	I315V	probably benign	Het
Ccdc136	A	G	6: 29,417,442	E754G	probably benign	Het
Cers3	A	G	7: 66,773,630	K108E	probably benign	Het
Cmya5	T	C	13: 93,065,373		probably null	Het
Col19a1	T	C	1: 24,328,067	E478G	possibly damaging	Het
Colec10	T	A	15: 54,459,784	S134R	possibly damaging	Het
Ctnnb1	A	T	9: 120,955,829	I514F	probably damaging	Het
Cux1	C	T	5: 136,309,819	E664K	probably benign	Het
Dars	T	C	1: 128,405,462	Q75R	probably benign	Het
Disp1	T	A	1: 183,135,815	S16C	probably damaging	Het
Dnah7a	A	T	1: 53,559,140	V1412E	probably benign	Het
Ect2l	C	T	10: 18,168,434	V226I	probably benign	Het
Ep400	T	A	5: 110,756,643	H30L	unknown	Het
Ephx4	A	G	5: 107,419,781	I202V	probably benign	Het
Ezr	T	C	17: 6,752,995	E229G	probably damaging	Het
Fat1	A	T	8: 45,017,380	I1472L	probably benign	Het
Fsd1l	T	G	4: 53,679,972	D223E	probably benign	Het
Gata6	A	T	18: 11,059,064	D377V	possibly damaging	Het
Gm12185	A	T	11: 48,907,389	M759K	probably benign	Het
Gm21994	C	T	2: 150,254,576	R311Q	probably benign	Het
Gm9922	C	T	14: 101,729,457	A120T	unknown	Het
Hectd4	A	T	5: 121,310,681	Y364F	probably benign	Het
Hnrnph1	A	G	11: 50,385,869	S465G	unknown	Het
Ifi204	T	C	1: 173,749,358	Y559C	probably damaging	Het
Ift88	T	C	14: 57,481,396	S613P	probably damaging	Het
Kif21a	G	C	15: 90,985,325	A441G	probably damaging	Het
Kif21a	G	T	15: 90,995,512	T191K	probably benign	Het
Lrit1	T	A	14: 37,060,127	C252*	probably null	Het
Ncbp1	T	A	4: 46,144,837	D29E	probably benign	Het
Nlrp10	A	T	7: 108,925,528	D248E	probably damaging	Het
Nphp4	T	G	4: 152,547,064	V807G	probably benign	Het
Nsd1	T	C	13: 55,246,043	S589P	possibly damaging	Het
Oas1b	T	A	5: 120,814,485	N80K	probably damaging	Het
Olfr1055	G	A	2: 86,347,239	H176Y	probably benign	Het
Olfr1135	A	T	2: 87,671,761	I202N	probably benign	Het
Oprk1	T	A	1: 5,598,873	C181S	probably damaging	Het
Oprl1	T	A	2: 181,718,419	N89K	probably damaging	Het
Pdcd11	A	G	19: 47,129,302	K1697E	probably damaging	Het
Pdp1	G	A	4: 11,961,607	H254Y	probably benign	Het
Pds5b	A	T	5: 150,805,663	D1419V	possibly damaging	Het
Per1	G	T	11: 69,100,649	G3V	probably benign	Het
Pex16	C	A	2: 92,376,643	N55K	probably damaging	Het
Phldb2	C	A	16: 45,774,977	L862F	probably benign	Het
Pld5	T	A	1: 175,964,006	D478V	probably benign	Het
Pms2	T	C	5: 143,914,796	I177T	probably damaging	Het
Pou1f1	A	T	16: 65,529,872	E119D	probably benign	Het
Ppp2r1a	A	C	17: 20,958,796	E295A	probably damaging	Het
Rad51ap2	A	T	12: 11,457,592	N505I	possibly damaging	Het
Rasal3	A	C	17: 32,396,562	V434G	probably damaging	Het
Rasgrf2	C	T	13: 91,987,973	V6M		Het
Rwdd1	A	T	10: 34,001,156	D197E		Het
Scn11a	A	T	9: 119,790,010	C755*	probably null	Het
Skil	T	C	3: 31,116,860	S443P	probably benign	Het
Slc12a6	T	C	2: 112,356,472	C939R	probably damaging	Het
Slc25a36	A	G	9: 97,079,177	S269P	probably benign	Het
Srrm4	T	A	5: 116,482,393	H92L	unknown	Het
Styk1	CTCTTCATGATTTTCTT	CTCTT	6: 131,301,649		probably benign	Het
Tbc1d4	A	T	14: 101,507,410	V260E	probably benign	Het
Tbc1d8	T	C	1: 39,385,232	N593D	probably damaging	Het
Trex1	C	A	9: 109,058,737	R62L	probably damaging	Het
Trpm3	A	T	19: 22,715,352	D269V	possibly damaging	Het
Trpv4	G	T	5: 114,633,150	Y439*	probably null	Het
Ttn	G	A	2: 76,734,248	T28515I	probably damaging	Het
Ucn2	G	A	9: 108,986,503	G111D	probably damaging	Het
Uhrf2	A	G	19: 30,056,481	I212V	possibly damaging	Het
Usp24	T	A	4: 106,347,367	M261K	probably benign	Het
Vmn1r235	A	T	17: 21,261,698	D95V	probably benign	Het
Vwf	G	A	6: 125,624,573	R826Q		Het
Zfp28	T	C	7: 6,393,879	C438R	probably damaging	Het

Other mutations in Exoc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00695:Exoc3	APN	13	74206906	critical splice donor site	probably null
IGL01444:Exoc3	APN	13	74206935	missense	probably damaging	1.00
IGL02095:Exoc3	APN	13	74180536	missense	probably damaging	1.00
IGL02370:Exoc3	APN	13	74192761	missense	probably benign	0.02
IGL02704:Exoc3	APN	13	74174144	missense	probably benign	0.00
IGL03113:Exoc3	APN	13	74193113	nonsense	probably null
R0037:Exoc3	UTSW	13	74199539	missense	probably damaging	0.99
R0565:Exoc3	UTSW	13	74182275	critical splice donor site	probably null
R1282:Exoc3	UTSW	13	74182292	missense	probably benign	0.30
R1438:Exoc3	UTSW	13	74190179	missense	probably damaging	1.00
R1694:Exoc3	UTSW	13	74190065	splice site	probably null
R1913:Exoc3	UTSW	13	74182316	missense	probably damaging	1.00
R1915:Exoc3	UTSW	13	74173294	critical splice donor site	probably null
R2039:Exoc3	UTSW	13	74192977	missense	probably benign
R4272:Exoc3	UTSW	13	74192644	missense	probably damaging	1.00
R4852:Exoc3	UTSW	13	74199645	missense	probably damaging	1.00
R5698:Exoc3	UTSW	13	74174015	missense	probably benign	0.13
R5909:Exoc3	UTSW	13	74199524	missense	probably damaging	0.98
R5969:Exoc3	UTSW	13	74172186	nonsense	probably null
R6248:Exoc3	UTSW	13	74182281	missense	probably benign	0.40
R6433:Exoc3	UTSW	13	74189187	missense	possibly damaging	0.93
R6599:Exoc3	UTSW	13	74189158	splice site	probably null
R6861:Exoc3	UTSW	13	74189200	missense	probably benign
R7000:Exoc3	UTSW	13	74182166	missense	probably benign	0.41
R7384:Exoc3	UTSW	13	74172156	missense	probably benign	0.00
R8098:Exoc3	UTSW	13	74172152	missense	probably benign
R8146:Exoc3	UTSW	13	74192665	missense	probably benign	0.00
R9548:Exoc3	UTSW	13	74182166	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- CTGATGCAAGGTCCTGCATC -3'
(R):5'- ATGGTGCTGCAAAGATCACTG -3'

Sequencing Primer
(F):5'- GCTCAGGAGGTTCTTAAAGATCTC -3'
(R):5'- TGCAAAGATCACTGGTCACTGTC -3'

Posted On

2022-10-06