Mutagenetix > Incidental Mutation

Incidental Mutation 'R9712:Kif21a'

730284

Institutional Source

Beutler Lab

Gene Symbol

Kif21a

Ensembl Gene

ENSMUSG00000022629

Gene Name

kinesin family member 21A

Synonyms

N-5 kinesin

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9712 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

90933276-91049948 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 90995512 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 191 (T191K)

Ref Sequence

ENSEMBL: ENSMUSP00000104911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067205] [ENSMUST00000088614] [ENSMUST00000100304] [ENSMUST00000109287] [ENSMUST00000109288]

AlphaFold

Q9QXL2

Predicted Effect

probably damaging
Transcript: ENSMUST00000067205
AA Change: T191K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000066911
Gene: ENSMUSG00000022629
AA Change: T191K

Domain	Start	End	E-Value	Type
KISc	7	379	8.97e-163	SMART
Blast:KISc	469	513	9e-9	BLAST
low complexity region	514	525	N/A	INTRINSIC
low complexity region	542	557	N/A	INTRINSIC
low complexity region	571	585	N/A	INTRINSIC
low complexity region	589	628	N/A	INTRINSIC
low complexity region	700	713	N/A	INTRINSIC
coiled coil region	924	1008	N/A	INTRINSIC
coiled coil region	1043	1066	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1251	1271	N/A	INTRINSIC
WD40	1290	1327	1.21e-7	SMART
WD40	1330	1368	7.28e-2	SMART
WD40	1394	1432	3.33e-1	SMART
WD40	1435	1477	7e-4	SMART
WD40	1485	1523	2.4e-1	SMART
WD40	1527	1566	1.48e-2	SMART
WD40	1569	1606	2.07e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000088614
AA Change: T191K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000085985
Gene: ENSMUSG00000022629
AA Change: T191K

Domain	Start	End	E-Value	Type
KISc	7	379	8.97e-163	SMART
Blast:KISc	469	513	1e-8	BLAST
low complexity region	514	525	N/A	INTRINSIC
low complexity region	542	564	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
low complexity region	602	641	N/A	INTRINSIC
low complexity region	713	726	N/A	INTRINSIC
coiled coil region	937	1021	N/A	INTRINSIC
coiled coil region	1056	1079	N/A	INTRINSIC
low complexity region	1114	1125	N/A	INTRINSIC
low complexity region	1271	1283	N/A	INTRINSIC
low complexity region	1300	1316	N/A	INTRINSIC
WD40	1334	1371	1.21e-7	SMART
WD40	1374	1412	7.28e-2	SMART
WD40	1438	1476	3.33e-1	SMART
WD40	1479	1521	7e-4	SMART
WD40	1529	1567	2.4e-1	SMART
WD40	1571	1610	1.48e-2	SMART
WD40	1613	1650	2.07e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000100304
AA Change: T191K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000097877
Gene: ENSMUSG00000022629
AA Change: T191K

Domain	Start	End	E-Value	Type
KISc	7	379	8.97e-163	SMART
Blast:KISc	469	513	1e-8	BLAST
low complexity region	514	525	N/A	INTRINSIC
low complexity region	542	564	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
low complexity region	602	641	N/A	INTRINSIC
low complexity region	713	726	N/A	INTRINSIC
coiled coil region	937	1021	N/A	INTRINSIC
coiled coil region	1056	1079	N/A	INTRINSIC
low complexity region	1271	1283	N/A	INTRINSIC
low complexity region	1300	1316	N/A	INTRINSIC
WD40	1334	1371	1.21e-7	SMART
WD40	1374	1412	7.28e-2	SMART
WD40	1438	1476	3.33e-1	SMART
WD40	1479	1521	7e-4	SMART
WD40	1529	1567	2.4e-1	SMART
WD40	1571	1610	1.48e-2	SMART
WD40	1613	1650	2.07e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109287
AA Change: T191K

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000104910
Gene: ENSMUSG00000022629
AA Change: T191K

Domain	Start	End	E-Value	Type
KISc	7	379	8.97e-163	SMART
Blast:KISc	469	513	9e-9	BLAST
low complexity region	514	525	N/A	INTRINSIC
low complexity region	542	557	N/A	INTRINSIC
low complexity region	571	585	N/A	INTRINSIC
low complexity region	589	628	N/A	INTRINSIC
low complexity region	700	713	N/A	INTRINSIC
coiled coil region	924	1008	N/A	INTRINSIC
coiled coil region	1043	1066	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC
WD40	1229	1266	1.21e-7	SMART
WD40	1269	1307	7.28e-2	SMART
WD40	1333	1371	3.33e-1	SMART
WD40	1374	1416	7e-4	SMART
WD40	1424	1462	2.4e-1	SMART
WD40	1466	1505	1.48e-2	SMART
WD40	1508	1545	2.07e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109288
AA Change: T191K

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000104911
Gene: ENSMUSG00000022629
AA Change: T191K

Domain	Start	End	E-Value	Type
KISc	7	379	8.97e-163	SMART
Blast:KISc	469	513	9e-9	BLAST
low complexity region	514	525	N/A	INTRINSIC
low complexity region	542	557	N/A	INTRINSIC
low complexity region	571	585	N/A	INTRINSIC
low complexity region	589	628	N/A	INTRINSIC
low complexity region	700	713	N/A	INTRINSIC
coiled coil region	924	1008	N/A	INTRINSIC
coiled coil region	1043	1066	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
WD40	1235	1272	1.21e-7	SMART
WD40	1275	1313	7.28e-2	SMART
WD40	1339	1377	3.33e-1	SMART
WD40	1380	1422	7e-4	SMART
WD40	1430	1468	2.4e-1	SMART
WD40	1472	1511	1.48e-2	SMART
WD40	1514	1551	2.07e-6	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KIF4 subfamily of kinesin-like motor proteins. The encoded protein is characterized by an N-terminal motor domain a coiled-coil stalk domain and a C-terminal WD-40 repeat domain. This protein may be involved in microtubule dependent transport. Mutations in this gene are the cause of congenital fibrosis of extraocular muscles-1. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	A	T	19: 3,715,784	M20L	probably benign	Het
9430007A20Rik	C	T	4: 144,528,784	A258V	probably benign	Het
Abca8b	T	A	11: 109,942,337	D1241V	probably benign	Het
Adam20	G	A	8: 40,795,453	R200H	probably benign	Het
Adcy10	T	C	1: 165,513,112	F229L	probably damaging	Het
Adsl	A	T	15: 80,955,639	N126I	probably benign	Het
Ahnak	AGATCTC	A	19: 9,007,028		probably benign	Het
Ahnak	GATCTCTAT	GAT	19: 9,007,029		probably benign	Het
Aktip	G	A	8: 91,129,727	P41S	probably damaging	Het
Alkbh3	C	A	2: 93,980,973	R258L	probably damaging	Het
Arfgap3	A	G	15: 83,313,533	Y341H	probably benign	Het
Arhgef26	C	T	3: 62,423,613	L583F	probably damaging	Het
Arhgef40	T	C	14: 51,988,958	I153T	probably damaging	Het
Atp1a1	T	C	3: 101,591,441	S179G	probably benign	Het
Bok	T	C	1: 93,686,507	S21P	probably damaging	Het
C130060K24Rik	A	G	6: 65,456,140	I315V	probably benign	Het
Ccdc136	A	G	6: 29,417,442	E754G	probably benign	Het
Cers3	A	G	7: 66,773,630	K108E	probably benign	Het
Cmya5	T	C	13: 93,065,373		probably null	Het
Col19a1	T	C	1: 24,328,067	E478G	possibly damaging	Het
Colec10	T	A	15: 54,459,784	S134R	possibly damaging	Het
Ctnnb1	A	T	9: 120,955,829	I514F	probably damaging	Het
Cux1	C	T	5: 136,309,819	E664K	probably benign	Het
Dars	T	C	1: 128,405,462	Q75R	probably benign	Het
Disp1	T	A	1: 183,135,815	S16C	probably damaging	Het
Dnah7a	A	T	1: 53,559,140	V1412E	probably benign	Het
Ect2l	C	T	10: 18,168,434	V226I	probably benign	Het
Ep400	T	A	5: 110,756,643	H30L	unknown	Het
Ephx4	A	G	5: 107,419,781	I202V	probably benign	Het
Exoc3	A	T	13: 74,192,908	F259Y	probably damaging	Het
Ezr	T	C	17: 6,752,995	E229G	probably damaging	Het
Fat1	A	T	8: 45,017,380	I1472L	probably benign	Het
Fsd1l	T	G	4: 53,679,972	D223E	probably benign	Het
Gata6	A	T	18: 11,059,064	D377V	possibly damaging	Het
Gm12185	A	T	11: 48,907,389	M759K	probably benign	Het
Gm21994	C	T	2: 150,254,576	R311Q	probably benign	Het
Gm9922	C	T	14: 101,729,457	A120T	unknown	Het
Hectd4	A	T	5: 121,310,681	Y364F	probably benign	Het
Hnrnph1	A	G	11: 50,385,869	S465G	unknown	Het
Ifi204	T	C	1: 173,749,358	Y559C	probably damaging	Het
Ift88	T	C	14: 57,481,396	S613P	probably damaging	Het
Lrit1	T	A	14: 37,060,127	C252*	probably null	Het
Ncbp1	T	A	4: 46,144,837	D29E	probably benign	Het
Nlrp10	A	T	7: 108,925,528	D248E	probably damaging	Het
Nphp4	T	G	4: 152,547,064	V807G	probably benign	Het
Nsd1	T	C	13: 55,246,043	S589P	possibly damaging	Het
Oas1b	T	A	5: 120,814,485	N80K	probably damaging	Het
Olfr1055	G	A	2: 86,347,239	H176Y	probably benign	Het
Olfr1135	A	T	2: 87,671,761	I202N	probably benign	Het
Oprk1	T	A	1: 5,598,873	C181S	probably damaging	Het
Oprl1	T	A	2: 181,718,419	N89K	probably damaging	Het
Pdcd11	A	G	19: 47,129,302	K1697E	probably damaging	Het
Pdp1	G	A	4: 11,961,607	H254Y	probably benign	Het
Pds5b	A	T	5: 150,805,663	D1419V	possibly damaging	Het
Per1	G	T	11: 69,100,649	G3V	probably benign	Het
Pex16	C	A	2: 92,376,643	N55K	probably damaging	Het
Phldb2	C	A	16: 45,774,977	L862F	probably benign	Het
Pld5	T	A	1: 175,964,006	D478V	probably benign	Het
Pms2	T	C	5: 143,914,796	I177T	probably damaging	Het
Pou1f1	A	T	16: 65,529,872	E119D	probably benign	Het
Ppp2r1a	A	C	17: 20,958,796	E295A	probably damaging	Het
Rad51ap2	A	T	12: 11,457,592	N505I	possibly damaging	Het
Rasal3	A	C	17: 32,396,562	V434G	probably damaging	Het
Rasgrf2	C	T	13: 91,987,973	V6M		Het
Rwdd1	A	T	10: 34,001,156	D197E		Het
Scn11a	A	T	9: 119,790,010	C755*	probably null	Het
Skil	T	C	3: 31,116,860	S443P	probably benign	Het
Slc12a6	T	C	2: 112,356,472	C939R	probably damaging	Het
Slc25a36	A	G	9: 97,079,177	S269P	probably benign	Het
Srrm4	T	A	5: 116,482,393	H92L	unknown	Het
Styk1	CTCTTCATGATTTTCTT	CTCTT	6: 131,301,649		probably benign	Het
Tbc1d4	A	T	14: 101,507,410	V260E	probably benign	Het
Tbc1d8	T	C	1: 39,385,232	N593D	probably damaging	Het
Trex1	C	A	9: 109,058,737	R62L	probably damaging	Het
Trpm3	A	T	19: 22,715,352	D269V	possibly damaging	Het
Trpv4	G	T	5: 114,633,150	Y439*	probably null	Het
Ttn	G	A	2: 76,734,248	T28515I	probably damaging	Het
Ucn2	G	A	9: 108,986,503	G111D	probably damaging	Het
Uhrf2	A	G	19: 30,056,481	I212V	possibly damaging	Het
Usp24	T	A	4: 106,347,367	M261K	probably benign	Het
Vmn1r235	A	T	17: 21,261,698	D95V	probably benign	Het
Vwf	G	A	6: 125,624,573	R826Q		Het
Zfp28	T	C	7: 6,393,879	C438R	probably damaging	Het

Other mutations in Kif21a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00539:Kif21a	APN	15	90937301	missense	probably damaging	1.00
IGL01476:Kif21a	APN	15	90943864	missense	possibly damaging	0.66
IGL01617:Kif21a	APN	15	90995637	splice site	probably benign
IGL01736:Kif21a	APN	15	90959745	missense	possibly damaging	0.59
IGL01923:Kif21a	APN	15	90956430	missense	probably damaging	0.96
IGL01985:Kif21a	APN	15	90991767	missense	probably damaging	1.00
IGL02304:Kif21a	APN	15	90965535	missense	probably damaging	1.00
IGL02589:Kif21a	APN	15	90985286	missense	probably damaging	1.00
IGL03115:Kif21a	APN	15	90985395	missense	probably damaging	0.99
IGL03211:Kif21a	APN	15	90997963	missense	possibly damaging	0.73
IGL03372:Kif21a	APN	15	90956376	missense	probably benign	0.38
reflex	UTSW	15	90968358	missense	probably null	1.00
R0052:Kif21a	UTSW	15	90970857	missense	probably damaging	0.98
R0052:Kif21a	UTSW	15	90970857	missense	probably damaging	0.98
R0304:Kif21a	UTSW	15	90976521	splice site	probably null
R0378:Kif21a	UTSW	15	90969774	splice site	probably null
R0420:Kif21a	UTSW	15	90968054	unclassified	probably benign
R0536:Kif21a	UTSW	15	90959683	splice site	probably benign
R0826:Kif21a	UTSW	15	90997541	critical splice donor site	probably null
R0971:Kif21a	UTSW	15	90940581	missense	possibly damaging	0.46
R1052:Kif21a	UTSW	15	90935650	missense	probably benign	0.17
R1168:Kif21a	UTSW	15	90993753	missense	probably damaging	1.00
R1324:Kif21a	UTSW	15	90948322	critical splice donor site	probably null
R1471:Kif21a	UTSW	15	90956419	missense	probably benign	0.04
R1625:Kif21a	UTSW	15	90942175	missense	probably damaging	1.00
R1636:Kif21a	UTSW	15	90984805	splice site	probably benign
R1647:Kif21a	UTSW	15	90994367	missense	probably damaging	1.00
R1648:Kif21a	UTSW	15	90994367	missense	probably damaging	1.00
R1699:Kif21a	UTSW	15	90959743	missense	probably damaging	0.99
R1703:Kif21a	UTSW	15	90949047	splice site	probably null
R1795:Kif21a	UTSW	15	90972727	splice site	probably null
R1812:Kif21a	UTSW	15	90971766	missense	possibly damaging	0.63
R1959:Kif21a	UTSW	15	90970848	missense	probably damaging	0.99
R1960:Kif21a	UTSW	15	90970848	missense	probably damaging	0.99
R1961:Kif21a	UTSW	15	90970848	missense	probably damaging	0.99
R1996:Kif21a	UTSW	15	90994371	nonsense	probably null
R2230:Kif21a	UTSW	15	90985362	nonsense	probably null
R2231:Kif21a	UTSW	15	90985362	nonsense	probably null
R2232:Kif21a	UTSW	15	90985362	nonsense	probably null
R2424:Kif21a	UTSW	15	90971196	missense	probably damaging	1.00
R2429:Kif21a	UTSW	15	90998005	missense	probably damaging	1.00
R2513:Kif21a	UTSW	15	90994391	missense	possibly damaging	0.96
R2846:Kif21a	UTSW	15	90934464	missense	probably benign
R3027:Kif21a	UTSW	15	90972642	missense	probably damaging	0.99
R3624:Kif21a	UTSW	15	90965595	missense	probably damaging	0.99
R3820:Kif21a	UTSW	15	90968074	missense	probably benign	0.17
R3923:Kif21a	UTSW	15	90937294	missense	possibly damaging	0.46
R3962:Kif21a	UTSW	15	90985409	missense	probably damaging	1.00
R4355:Kif21a	UTSW	15	90970833	missense	probably benign	0.17
R4516:Kif21a	UTSW	15	90971142	missense	probably benign	0.38
R4530:Kif21a	UTSW	15	90968089	splice site	probably null
R4612:Kif21a	UTSW	15	90968223	splice site	probably null
R4674:Kif21a	UTSW	15	90940545	missense	possibly damaging	0.66
R4675:Kif21a	UTSW	15	90940545	missense	possibly damaging	0.66
R4698:Kif21a	UTSW	15	90956305	missense	possibly damaging	0.85
R4712:Kif21a	UTSW	15	90984755	missense	probably damaging	1.00
R4955:Kif21a	UTSW	15	90937190	missense	probably damaging	1.00
R4974:Kif21a	UTSW	15	90949010	missense	probably benign	0.16
R5034:Kif21a	UTSW	15	90968358	missense	probably null	1.00
R5165:Kif21a	UTSW	15	90956376	missense	probably benign	0.38
R5464:Kif21a	UTSW	15	90993855	missense	probably damaging	1.00
R5541:Kif21a	UTSW	15	90968113	missense	probably damaging	0.99
R5757:Kif21a	UTSW	15	90951345	missense	probably damaging	1.00
R5936:Kif21a	UTSW	15	90935647	missense	possibly damaging	0.95
R5976:Kif21a	UTSW	15	90935812	missense	probably damaging	1.00
R6074:Kif21a	UTSW	15	90980892	missense	probably benign
R6638:Kif21a	UTSW	15	90966407	missense	probably damaging	1.00
R6723:Kif21a	UTSW	15	90940446	missense	probably damaging	0.97
R6785:Kif21a	UTSW	15	90935730	missense	probably damaging	1.00
R6977:Kif21a	UTSW	15	90980837	missense	probably damaging	1.00
R7058:Kif21a	UTSW	15	90948903	splice site	probably null
R7147:Kif21a	UTSW	15	90980883	missense	probably benign	0.13
R7290:Kif21a	UTSW	15	90967229	nonsense	probably null
R7438:Kif21a	UTSW	15	90993796	missense	probably benign	0.37
R7593:Kif21a	UTSW	15	90943861	missense	probably benign	0.03
R7661:Kif21a	UTSW	15	90980919	missense	possibly damaging	0.89
R7891:Kif21a	UTSW	15	90956314	missense	probably damaging	1.00
R8137:Kif21a	UTSW	15	90968442	missense	probably benign
R8182:Kif21a	UTSW	15	90935761	missense	possibly damaging	0.77
R8303:Kif21a	UTSW	15	90971196	missense	probably damaging	0.99
R8388:Kif21a	UTSW	15	90959124	missense	possibly damaging	0.60
R8867:Kif21a	UTSW	15	90968179	missense	probably damaging	0.96
R8921:Kif21a	UTSW	15	90971727	missense	probably benign	0.04
R8984:Kif21a	UTSW	15	90956356	missense	probably benign	0.00
R9024:Kif21a	UTSW	15	90937196	nonsense	probably null
R9254:Kif21a	UTSW	15	90969827	missense	probably damaging	0.99
R9366:Kif21a	UTSW	15	90959748	missense	probably damaging	0.99
R9379:Kif21a	UTSW	15	90969827	missense	probably damaging	0.99
R9393:Kif21a	UTSW	15	90969778	missense	probably benign	0.00
R9518:Kif21a	UTSW	15	90956473	missense	probably damaging	1.00
R9712:Kif21a	UTSW	15	90985325	missense	probably damaging	0.98
R9721:Kif21a	UTSW	15	90971127	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCACCTGACACATCTTGCTAG -3'
(R):5'- GAGGCTCACAGAACCACTTC -3'

Sequencing Primer
(F):5'- TGACACATCTTGCTAGGACTC -3'
(R):5'- CGACAGAATTAACCATTTAATGTGTC -3'

Posted On

2022-10-06