Incidental Mutation 'R9712:Rasal3'
ID 730290
Institutional Source Beutler Lab
Gene Symbol Rasal3
Ensembl Gene ENSMUSG00000052142
Gene Name RAS protein activator like 3
Synonyms A430107D22Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R9712 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 32609633-32622557 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 32615536 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 434 (V434G)
Ref Sequence ENSEMBL: ENSMUSP00000123141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063824] [ENSMUST00000135618] [ENSMUST00000136375] [ENSMUST00000137458]
AlphaFold Q8C2K5
Predicted Effect possibly damaging
Transcript: ENSMUST00000063824
AA Change: V432G

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000064084
Gene: ENSMUSG00000052142
AA Change: V432G

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
low complexity region 120 137 N/A INTRINSIC
PH 165 323 3.94e0 SMART
Blast:RasGAP 354 381 9e-8 BLAST
low complexity region 385 402 N/A INTRINSIC
RasGAP 433 755 2.03e-81 SMART
low complexity region 826 839 N/A INTRINSIC
coiled coil region 932 1013 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000135618
AA Change: V410G

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116107
Gene: ENSMUSG00000052142
AA Change: V410G

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
PH 143 301 3.94e0 SMART
Blast:RasGAP 332 359 9e-8 BLAST
low complexity region 363 380 N/A INTRINSIC
RasGAP 411 733 2.03e-81 SMART
low complexity region 804 817 N/A INTRINSIC
coiled coil region 910 991 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000136375
AA Change: V410G

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118738
Gene: ENSMUSG00000052142
AA Change: V410G

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
PH 143 301 3.94e0 SMART
Blast:RasGAP 332 359 7e-8 BLAST
low complexity region 363 380 N/A INTRINSIC
Pfam:RasGAP 483 579 6.4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000137458
AA Change: V434G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123141
Gene: ENSMUSG00000052142
AA Change: V434G

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 119 140 N/A INTRINSIC
PH 167 325 3.94e0 SMART
Blast:RasGAP 356 383 9e-8 BLAST
low complexity region 387 404 N/A INTRINSIC
RasGAP 435 757 2.03e-81 SMART
low complexity region 828 841 N/A INTRINSIC
coiled coil region 934 1015 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the Ras GTPase-activating proteins (RasGAP) family and encodes a protein with pleckstrin homology (PH), C2, and Ras GTPase-activation protein (RasGAP) domains. This protein is localized near or at the plasma membrane when expressed exogenously. Reduced expression of this gene in some cell lines resulted in increased levels of the active form of Ras (Ras-GTP), suggesting that this gene may play a role in negatively regulating the Ras signaling pathway. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced NT T cells in the liver, increased granulocytes in the bone marrow and decreased susceptibility to alpha-GalCer-induced liver injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik A T 19: 3,765,784 (GRCm39) M20L probably benign Het
Aadacl4fm1 C T 4: 144,255,354 (GRCm39) A258V probably benign Het
Abca8b T A 11: 109,833,163 (GRCm39) D1241V probably benign Het
Adam20 G A 8: 41,248,490 (GRCm39) R200H probably benign Het
Adcy10 T C 1: 165,340,681 (GRCm39) F229L probably damaging Het
Adsl A T 15: 80,839,840 (GRCm39) N126I probably benign Het
Ahnak GATCTCTAT GAT 19: 8,984,393 (GRCm39) probably benign Het
Ahnak AGATCTC A 19: 8,984,392 (GRCm39) probably benign Het
Aktip G A 8: 91,856,355 (GRCm39) P41S probably damaging Het
Alkbh3 C A 2: 93,811,318 (GRCm39) R258L probably damaging Het
Arfgap3 A G 15: 83,197,734 (GRCm39) Y341H probably benign Het
Arhgef26 C T 3: 62,331,034 (GRCm39) L583F probably damaging Het
Arhgef40 T C 14: 52,226,415 (GRCm39) I153T probably damaging Het
Atp1a1 T C 3: 101,498,757 (GRCm39) S179G probably benign Het
Bok T C 1: 93,614,229 (GRCm39) S21P probably damaging Het
Ccdc136 A G 6: 29,417,441 (GRCm39) E754G probably benign Het
Cers3 A G 7: 66,423,378 (GRCm39) K108E probably benign Het
Cmya5 T C 13: 93,201,881 (GRCm39) probably null Het
Col19a1 T C 1: 24,367,148 (GRCm39) E478G possibly damaging Het
Colec10 T A 15: 54,323,180 (GRCm39) S134R possibly damaging Het
Ctnnb1 A T 9: 120,784,895 (GRCm39) I514F probably damaging Het
Cux1 C T 5: 136,338,673 (GRCm39) E664K probably benign Het
Dars1 T C 1: 128,333,199 (GRCm39) Q75R probably benign Het
Disp1 T A 1: 182,917,379 (GRCm39) S16C probably damaging Het
Dnah7a A T 1: 53,598,299 (GRCm39) V1412E probably benign Het
Ect2l C T 10: 18,044,182 (GRCm39) V226I probably benign Het
Ep400 T A 5: 110,904,509 (GRCm39) H30L unknown Het
Ephx4 A G 5: 107,567,647 (GRCm39) I202V probably benign Het
Exoc3 A T 13: 74,341,027 (GRCm39) F259Y probably damaging Het
Ezr T C 17: 7,020,394 (GRCm39) E229G probably damaging Het
Fat1 A T 8: 45,470,417 (GRCm39) I1472L probably benign Het
Fsd1l T G 4: 53,679,972 (GRCm39) D223E probably benign Het
Gata6 A T 18: 11,059,064 (GRCm39) D377V possibly damaging Het
Gm12185 A T 11: 48,798,216 (GRCm39) M759K probably benign Het
Gm9922 C T 14: 101,966,893 (GRCm39) A120T unknown Het
Hectd4 A T 5: 121,448,744 (GRCm39) Y364F probably benign Het
Hnrnph1 A G 11: 50,276,696 (GRCm39) S465G unknown Het
Ifi204 T C 1: 173,576,924 (GRCm39) Y559C probably damaging Het
Ift88 T C 14: 57,718,853 (GRCm39) S613P probably damaging Het
Kif21a G C 15: 90,869,528 (GRCm39) A441G probably damaging Het
Kif21a G T 15: 90,879,715 (GRCm39) T191K probably benign Het
Lrit1 T A 14: 36,782,084 (GRCm39) C252* probably null Het
Ncbp1 T A 4: 46,144,837 (GRCm39) D29E probably benign Het
Nlrp10 A T 7: 108,524,735 (GRCm39) D248E probably damaging Het
Nphp4 T G 4: 152,631,521 (GRCm39) V807G probably benign Het
Nsd1 T C 13: 55,393,856 (GRCm39) S589P possibly damaging Het
Oas1b T A 5: 120,952,550 (GRCm39) N80K probably damaging Het
Oprk1 T A 1: 5,669,096 (GRCm39) C181S probably damaging Het
Oprl1 T A 2: 181,360,212 (GRCm39) N89K probably damaging Het
Or5w12 A T 2: 87,502,105 (GRCm39) I202N probably benign Het
Or8k53 G A 2: 86,177,583 (GRCm39) H176Y probably benign Het
Pdcd11 A G 19: 47,117,741 (GRCm39) K1697E probably damaging Het
Pdp1 G A 4: 11,961,607 (GRCm39) H254Y probably benign Het
Pds5b A T 5: 150,729,128 (GRCm39) D1419V possibly damaging Het
Per1 G T 11: 68,991,475 (GRCm39) G3V probably benign Het
Pex16 C A 2: 92,206,988 (GRCm39) N55K probably damaging Het
Phldb2 C A 16: 45,595,340 (GRCm39) L862F probably benign Het
Pld5 T A 1: 175,791,572 (GRCm39) D478V probably benign Het
Pms2 T C 5: 143,851,614 (GRCm39) I177T probably damaging Het
Pou1f1 A T 16: 65,326,758 (GRCm39) E119D probably benign Het
Ppp2r1a A C 17: 21,179,058 (GRCm39) E295A probably damaging Het
Qrfprl A G 6: 65,433,124 (GRCm39) I315V probably benign Het
Rad51ap2 A T 12: 11,507,593 (GRCm39) N505I possibly damaging Het
Rasgrf2 C T 13: 92,136,092 (GRCm39) V6M Het
Rwdd1 A T 10: 33,877,152 (GRCm39) D197E Het
Scn11a A T 9: 119,619,076 (GRCm39) C755* probably null Het
Skil T C 3: 31,171,009 (GRCm39) S443P probably benign Het
Slc12a6 T C 2: 112,186,817 (GRCm39) C939R probably damaging Het
Slc25a36 A G 9: 96,961,230 (GRCm39) S269P probably benign Het
Srrm4 T A 5: 116,620,452 (GRCm39) H92L unknown Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Tbc1d4 A T 14: 101,744,846 (GRCm39) V260E probably benign Het
Tbc1d8 T C 1: 39,424,313 (GRCm39) N593D probably damaging Het
Trex1 C A 9: 108,887,805 (GRCm39) R62L probably damaging Het
Trpm3 A T 19: 22,692,716 (GRCm39) D269V possibly damaging Het
Trpv4 G T 5: 114,771,211 (GRCm39) Y439* probably null Het
Ttn G A 2: 76,564,592 (GRCm39) T28515I probably damaging Het
Ucn2 G A 9: 108,815,571 (GRCm39) G111D probably damaging Het
Uhrf2 A G 19: 30,033,881 (GRCm39) I212V possibly damaging Het
Usp24 T A 4: 106,204,564 (GRCm39) M261K probably benign Het
Vmn1r235 A T 17: 21,481,960 (GRCm39) D95V probably benign Het
Vwf G A 6: 125,601,536 (GRCm39) R826Q Het
Zfp1002 C T 2: 150,096,496 (GRCm39) R311Q probably benign Het
Zfp28 T C 7: 6,396,878 (GRCm39) C438R probably damaging Het
Other mutations in Rasal3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Rasal3 APN 17 32,616,379 (GRCm39) missense possibly damaging 0.89
IGL02291:Rasal3 APN 17 32,612,711 (GRCm39) unclassified probably benign
IGL02346:Rasal3 APN 17 32,618,323 (GRCm39) missense probably damaging 1.00
IGL02422:Rasal3 APN 17 32,617,947 (GRCm39) missense probably benign 0.11
Beaten UTSW 17 32,610,318 (GRCm39) missense probably benign 0.05
bent UTSW 17 32,615,755 (GRCm39) missense probably damaging 1.00
bowed UTSW 17 32,615,764 (GRCm39) missense probably damaging 1.00
kinked UTSW 17 32,615,324 (GRCm39) nonsense probably null
whipped UTSW 17 32,612,502 (GRCm39) frame shift probably null
R0057:Rasal3 UTSW 17 32,610,357 (GRCm39) missense probably benign 0.00
R0133:Rasal3 UTSW 17 32,622,357 (GRCm39) start codon destroyed probably null 0.89
R0180:Rasal3 UTSW 17 32,618,379 (GRCm39) missense probably benign
R0403:Rasal3 UTSW 17 32,611,764 (GRCm39) splice site probably null
R0452:Rasal3 UTSW 17 32,614,791 (GRCm39) splice site probably benign
R0600:Rasal3 UTSW 17 32,612,500 (GRCm39) missense probably damaging 0.99
R0760:Rasal3 UTSW 17 32,611,146 (GRCm39) missense probably benign 0.00
R1438:Rasal3 UTSW 17 32,612,509 (GRCm39) splice site probably null
R1669:Rasal3 UTSW 17 32,622,072 (GRCm39) missense possibly damaging 0.81
R1914:Rasal3 UTSW 17 32,615,324 (GRCm39) nonsense probably null
R1928:Rasal3 UTSW 17 32,616,327 (GRCm39) missense probably damaging 1.00
R2002:Rasal3 UTSW 17 32,612,585 (GRCm39) missense probably damaging 1.00
R3053:Rasal3 UTSW 17 32,622,413 (GRCm39) missense probably benign 0.03
R3770:Rasal3 UTSW 17 32,611,125 (GRCm39) missense probably damaging 0.99
R3870:Rasal3 UTSW 17 32,612,522 (GRCm39) missense possibly damaging 0.94
R4491:Rasal3 UTSW 17 32,610,359 (GRCm39) missense probably damaging 0.99
R4783:Rasal3 UTSW 17 32,615,755 (GRCm39) missense probably damaging 1.00
R4788:Rasal3 UTSW 17 32,618,312 (GRCm39) missense probably benign 0.00
R4903:Rasal3 UTSW 17 32,616,357 (GRCm39) missense probably damaging 1.00
R5185:Rasal3 UTSW 17 32,615,764 (GRCm39) missense probably damaging 1.00
R5372:Rasal3 UTSW 17 32,610,318 (GRCm39) missense probably benign 0.05
R5433:Rasal3 UTSW 17 32,612,575 (GRCm39) missense probably benign 0.00
R5472:Rasal3 UTSW 17 32,615,643 (GRCm39) missense probably damaging 1.00
R5920:Rasal3 UTSW 17 32,614,143 (GRCm39) missense probably damaging 1.00
R6436:Rasal3 UTSW 17 32,616,478 (GRCm39) missense probably damaging 1.00
R6837:Rasal3 UTSW 17 32,622,044 (GRCm39) missense probably benign 0.17
R7047:Rasal3 UTSW 17 32,615,458 (GRCm39) missense probably damaging 1.00
R7109:Rasal3 UTSW 17 32,611,683 (GRCm39) missense probably damaging 1.00
R7179:Rasal3 UTSW 17 32,611,391 (GRCm39) missense probably damaging 0.99
R7571:Rasal3 UTSW 17 32,614,835 (GRCm39) missense possibly damaging 0.76
R7768:Rasal3 UTSW 17 32,615,767 (GRCm39) missense probably damaging 0.96
R7874:Rasal3 UTSW 17 32,615,681 (GRCm39) missense possibly damaging 0.75
R8155:Rasal3 UTSW 17 32,616,381 (GRCm39) missense possibly damaging 0.93
R8265:Rasal3 UTSW 17 32,614,794 (GRCm39) critical splice donor site probably null
R8544:Rasal3 UTSW 17 32,611,093 (GRCm39) missense probably benign
R8677:Rasal3 UTSW 17 32,615,828 (GRCm39) missense probably benign 0.03
R8695:Rasal3 UTSW 17 32,611,736 (GRCm39) missense possibly damaging 0.93
R9037:Rasal3 UTSW 17 32,614,094 (GRCm39) missense probably benign 0.01
R9307:Rasal3 UTSW 17 32,612,502 (GRCm39) frame shift probably null
R9417:Rasal3 UTSW 17 32,615,441 (GRCm39) missense probably benign 0.13
R9486:Rasal3 UTSW 17 32,617,910 (GRCm39) missense probably benign 0.07
RF004:Rasal3 UTSW 17 32,610,081 (GRCm39) missense probably damaging 1.00
X0027:Rasal3 UTSW 17 32,611,500 (GRCm39) missense probably benign 0.00
X0027:Rasal3 UTSW 17 32,610,193 (GRCm39) missense probably damaging 1.00
X0065:Rasal3 UTSW 17 32,622,260 (GRCm39) missense probably damaging 1.00
Z1177:Rasal3 UTSW 17 32,618,284 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GTAGTTAGGGCTTCTCACCTGC -3'
(R):5'- CAACTCTTCTGGGCTGAACG -3'

Sequencing Primer
(F):5'- TAGCACGCGCACCATGG -3'
(R):5'- TGAACGCTTCCACTTCGAGG -3'
Posted On 2022-10-06