Mutagenetix > Incidental Mutation

Incidental Mutation 'R9712:Rasal3'

730290

Institutional Source

Beutler Lab

Gene Symbol

Rasal3

Ensembl Gene

ENSMUSG00000052142

Gene Name

RAS protein activator like 3

Synonyms

A430107D22Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R9712 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

32390659-32403583 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 32396562 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 434 (V434G)

Ref Sequence

ENSEMBL: ENSMUSP00000123141 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063824] [ENSMUST00000135618] [ENSMUST00000136375] [ENSMUST00000137458]

AlphaFold

Q8C2K5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000063824
AA Change: V432G

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000064084
Gene: ENSMUSG00000052142
AA Change: V432G

Domain	Start	End	E-Value	Type
low complexity region	57	72	N/A	INTRINSIC
low complexity region	120	137	N/A	INTRINSIC
PH	165	323	3.94e0	SMART
Blast:RasGAP	354	381	9e-8	BLAST
low complexity region	385	402	N/A	INTRINSIC
RasGAP	433	755	2.03e-81	SMART
low complexity region	826	839	N/A	INTRINSIC
coiled coil region	932	1013	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000135618
AA Change: V410G

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000116107
Gene: ENSMUSG00000052142
AA Change: V410G

Domain	Start	End	E-Value	Type
low complexity region	35	50	N/A	INTRINSIC
low complexity region	98	115	N/A	INTRINSIC
PH	143	301	3.94e0	SMART
Blast:RasGAP	332	359	9e-8	BLAST
low complexity region	363	380	N/A	INTRINSIC
RasGAP	411	733	2.03e-81	SMART
low complexity region	804	817	N/A	INTRINSIC
coiled coil region	910	991	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000136375
AA Change: V410G

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000118738
Gene: ENSMUSG00000052142
AA Change: V410G

Domain	Start	End	E-Value	Type
low complexity region	35	50	N/A	INTRINSIC
low complexity region	98	115	N/A	INTRINSIC
PH	143	301	3.94e0	SMART
Blast:RasGAP	332	359	7e-8	BLAST
low complexity region	363	380	N/A	INTRINSIC
Pfam:RasGAP	483	579	6.4e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000137458
AA Change: V434G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000123141
Gene: ENSMUSG00000052142
AA Change: V434G

Domain	Start	End	E-Value	Type
low complexity region	35	50	N/A	INTRINSIC
low complexity region	119	140	N/A	INTRINSIC
PH	167	325	3.94e0	SMART
Blast:RasGAP	356	383	9e-8	BLAST
low complexity region	387	404	N/A	INTRINSIC
RasGAP	435	757	2.03e-81	SMART
low complexity region	828	841	N/A	INTRINSIC
coiled coil region	934	1015	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the Ras GTPase-activating proteins (RasGAP) family and encodes a protein with pleckstrin homology (PH), C2, and Ras GTPase-activation protein (RasGAP) domains. This protein is localized near or at the plasma membrane when expressed exogenously. Reduced expression of this gene in some cell lines resulted in increased levels of the active form of Ras (Ras-GTP), suggesting that this gene may play a role in negatively regulating the Ras signaling pathway. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced NT T cells in the liver, increased granulocytes in the bone marrow and decreased susceptibility to alpha-GalCer-induced liver injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	A	T	19: 3,715,784	M20L	probably benign	Het
9430007A20Rik	C	T	4: 144,528,784	A258V	probably benign	Het
Abca8b	T	A	11: 109,942,337	D1241V	probably benign	Het
Adam20	G	A	8: 40,795,453	R200H	probably benign	Het
Adcy10	T	C	1: 165,513,112	F229L	probably damaging	Het
Adsl	A	T	15: 80,955,639	N126I	probably benign	Het
Ahnak	AGATCTC	A	19: 9,007,028		probably benign	Het
Ahnak	GATCTCTAT	GAT	19: 9,007,029		probably benign	Het
Aktip	G	A	8: 91,129,727	P41S	probably damaging	Het
Alkbh3	C	A	2: 93,980,973	R258L	probably damaging	Het
Arfgap3	A	G	15: 83,313,533	Y341H	probably benign	Het
Arhgef26	C	T	3: 62,423,613	L583F	probably damaging	Het
Arhgef40	T	C	14: 51,988,958	I153T	probably damaging	Het
Atp1a1	T	C	3: 101,591,441	S179G	probably benign	Het
Bok	T	C	1: 93,686,507	S21P	probably damaging	Het
C130060K24Rik	A	G	6: 65,456,140	I315V	probably benign	Het
Ccdc136	A	G	6: 29,417,442	E754G	probably benign	Het
Cers3	A	G	7: 66,773,630	K108E	probably benign	Het
Cmya5	T	C	13: 93,065,373		probably null	Het
Col19a1	T	C	1: 24,328,067	E478G	possibly damaging	Het
Colec10	T	A	15: 54,459,784	S134R	possibly damaging	Het
Ctnnb1	A	T	9: 120,955,829	I514F	probably damaging	Het
Cux1	C	T	5: 136,309,819	E664K	probably benign	Het
Dars	T	C	1: 128,405,462	Q75R	probably benign	Het
Disp1	T	A	1: 183,135,815	S16C	probably damaging	Het
Dnah7a	A	T	1: 53,559,140	V1412E	probably benign	Het
Ect2l	C	T	10: 18,168,434	V226I	probably benign	Het
Ep400	T	A	5: 110,756,643	H30L	unknown	Het
Ephx4	A	G	5: 107,419,781	I202V	probably benign	Het
Exoc3	A	T	13: 74,192,908	F259Y	probably damaging	Het
Ezr	T	C	17: 6,752,995	E229G	probably damaging	Het
Fat1	A	T	8: 45,017,380	I1472L	probably benign	Het
Fsd1l	T	G	4: 53,679,972	D223E	probably benign	Het
Gata6	A	T	18: 11,059,064	D377V	possibly damaging	Het
Gm12185	A	T	11: 48,907,389	M759K	probably benign	Het
Gm21994	C	T	2: 150,254,576	R311Q	probably benign	Het
Gm9922	C	T	14: 101,729,457	A120T	unknown	Het
Hectd4	A	T	5: 121,310,681	Y364F	probably benign	Het
Hnrnph1	A	G	11: 50,385,869	S465G	unknown	Het
Ifi204	T	C	1: 173,749,358	Y559C	probably damaging	Het
Ift88	T	C	14: 57,481,396	S613P	probably damaging	Het
Kif21a	G	C	15: 90,985,325	A441G	probably damaging	Het
Kif21a	G	T	15: 90,995,512	T191K	probably benign	Het
Lrit1	T	A	14: 37,060,127	C252*	probably null	Het
Ncbp1	T	A	4: 46,144,837	D29E	probably benign	Het
Nlrp10	A	T	7: 108,925,528	D248E	probably damaging	Het
Nphp4	T	G	4: 152,547,064	V807G	probably benign	Het
Nsd1	T	C	13: 55,246,043	S589P	possibly damaging	Het
Oas1b	T	A	5: 120,814,485	N80K	probably damaging	Het
Olfr1055	G	A	2: 86,347,239	H176Y	probably benign	Het
Olfr1135	A	T	2: 87,671,761	I202N	probably benign	Het
Oprk1	T	A	1: 5,598,873	C181S	probably damaging	Het
Oprl1	T	A	2: 181,718,419	N89K	probably damaging	Het
Pdcd11	A	G	19: 47,129,302	K1697E	probably damaging	Het
Pdp1	G	A	4: 11,961,607	H254Y	probably benign	Het
Pds5b	A	T	5: 150,805,663	D1419V	possibly damaging	Het
Per1	G	T	11: 69,100,649	G3V	probably benign	Het
Pex16	C	A	2: 92,376,643	N55K	probably damaging	Het
Phldb2	C	A	16: 45,774,977	L862F	probably benign	Het
Pld5	T	A	1: 175,964,006	D478V	probably benign	Het
Pms2	T	C	5: 143,914,796	I177T	probably damaging	Het
Pou1f1	A	T	16: 65,529,872	E119D	probably benign	Het
Ppp2r1a	A	C	17: 20,958,796	E295A	probably damaging	Het
Rad51ap2	A	T	12: 11,457,592	N505I	possibly damaging	Het
Rasgrf2	C	T	13: 91,987,973	V6M		Het
Rwdd1	A	T	10: 34,001,156	D197E		Het
Scn11a	A	T	9: 119,790,010	C755*	probably null	Het
Skil	T	C	3: 31,116,860	S443P	probably benign	Het
Slc12a6	T	C	2: 112,356,472	C939R	probably damaging	Het
Slc25a36	A	G	9: 97,079,177	S269P	probably benign	Het
Srrm4	T	A	5: 116,482,393	H92L	unknown	Het
Styk1	CTCTTCATGATTTTCTT	CTCTT	6: 131,301,649		probably benign	Het
Tbc1d4	A	T	14: 101,507,410	V260E	probably benign	Het
Tbc1d8	T	C	1: 39,385,232	N593D	probably damaging	Het
Trex1	C	A	9: 109,058,737	R62L	probably damaging	Het
Trpm3	A	T	19: 22,715,352	D269V	possibly damaging	Het
Trpv4	G	T	5: 114,633,150	Y439*	probably null	Het
Ttn	G	A	2: 76,734,248	T28515I	probably damaging	Het
Ucn2	G	A	9: 108,986,503	G111D	probably damaging	Het
Uhrf2	A	G	19: 30,056,481	I212V	possibly damaging	Het
Usp24	T	A	4: 106,347,367	M261K	probably benign	Het
Vmn1r235	A	T	17: 21,261,698	D95V	probably benign	Het
Vwf	G	A	6: 125,624,573	R826Q		Het
Zfp28	T	C	7: 6,393,879	C438R	probably damaging	Het

Other mutations in Rasal3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01126:Rasal3	APN	17	32397405	missense	possibly damaging	0.89
IGL02291:Rasal3	APN	17	32393737	unclassified	probably benign
IGL02346:Rasal3	APN	17	32399349	missense	probably damaging	1.00
IGL02422:Rasal3	APN	17	32398973	missense	probably benign	0.11
Beaten	UTSW	17	32391344	missense	probably benign	0.05
bent	UTSW	17	32396781	missense	probably damaging	1.00
bowed	UTSW	17	32396790	missense	probably damaging	1.00
kinked	UTSW	17	32396350	nonsense	probably null
whipped	UTSW	17	32393528	frame shift	probably null
R0057:Rasal3	UTSW	17	32391383	missense	probably benign	0.00
R0133:Rasal3	UTSW	17	32403383	start codon destroyed	probably null	0.89
R0180:Rasal3	UTSW	17	32399405	missense	probably benign
R0403:Rasal3	UTSW	17	32392790	splice site	probably null
R0452:Rasal3	UTSW	17	32395817	splice site	probably benign
R0600:Rasal3	UTSW	17	32393526	missense	probably damaging	0.99
R0760:Rasal3	UTSW	17	32392172	missense	probably benign	0.00
R1438:Rasal3	UTSW	17	32393535	splice site	probably null
R1669:Rasal3	UTSW	17	32403098	missense	possibly damaging	0.81
R1914:Rasal3	UTSW	17	32396350	nonsense	probably null
R1928:Rasal3	UTSW	17	32397353	missense	probably damaging	1.00
R2002:Rasal3	UTSW	17	32393611	missense	probably damaging	1.00
R3053:Rasal3	UTSW	17	32403439	missense	probably benign	0.03
R3770:Rasal3	UTSW	17	32392151	missense	probably damaging	0.99
R3870:Rasal3	UTSW	17	32393548	missense	possibly damaging	0.94
R4491:Rasal3	UTSW	17	32391385	missense	probably damaging	0.99
R4783:Rasal3	UTSW	17	32396781	missense	probably damaging	1.00
R4788:Rasal3	UTSW	17	32399338	missense	probably benign	0.00
R4903:Rasal3	UTSW	17	32397383	missense	probably damaging	1.00
R5185:Rasal3	UTSW	17	32396790	missense	probably damaging	1.00
R5372:Rasal3	UTSW	17	32391344	missense	probably benign	0.05
R5433:Rasal3	UTSW	17	32393601	missense	probably benign	0.00
R5472:Rasal3	UTSW	17	32396669	missense	probably damaging	1.00
R5920:Rasal3	UTSW	17	32395169	missense	probably damaging	1.00
R6436:Rasal3	UTSW	17	32397504	missense	probably damaging	1.00
R6837:Rasal3	UTSW	17	32403070	missense	probably benign	0.17
R7047:Rasal3	UTSW	17	32396484	missense	probably damaging	1.00
R7109:Rasal3	UTSW	17	32392709	missense	probably damaging	1.00
R7179:Rasal3	UTSW	17	32392417	missense	probably damaging	0.99
R7571:Rasal3	UTSW	17	32395861	missense	possibly damaging	0.76
R7768:Rasal3	UTSW	17	32396793	missense	probably damaging	0.96
R7874:Rasal3	UTSW	17	32396707	missense	possibly damaging	0.75
R8155:Rasal3	UTSW	17	32397407	missense	possibly damaging	0.93
R8265:Rasal3	UTSW	17	32395820	critical splice donor site	probably null
R8544:Rasal3	UTSW	17	32392119	missense	probably benign
R8677:Rasal3	UTSW	17	32396854	missense	probably benign	0.03
R8695:Rasal3	UTSW	17	32392762	missense	possibly damaging	0.93
R9037:Rasal3	UTSW	17	32395120	missense	probably benign	0.01
R9307:Rasal3	UTSW	17	32393528	frame shift	probably null
R9417:Rasal3	UTSW	17	32396467	missense	probably benign	0.13
R9486:Rasal3	UTSW	17	32398936	missense	probably benign	0.07
RF004:Rasal3	UTSW	17	32391107	missense	probably damaging	1.00
X0027:Rasal3	UTSW	17	32391219	missense	probably damaging	1.00
X0027:Rasal3	UTSW	17	32392526	missense	probably benign	0.00
X0065:Rasal3	UTSW	17	32403286	missense	probably damaging	1.00
Z1177:Rasal3	UTSW	17	32399310	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GTAGTTAGGGCTTCTCACCTGC -3'
(R):5'- CAACTCTTCTGGGCTGAACG -3'

Sequencing Primer
(F):5'- TAGCACGCGCACCATGG -3'
(R):5'- TGAACGCTTCCACTTCGAGG -3'

Posted On

2022-10-06