Incidental Mutation 'R9712:Pdcd11'
ID 730297
Institutional Source Beutler Lab
Gene Symbol Pdcd11
Ensembl Gene ENSMUSG00000025047
Gene Name programmed cell death 11
Synonyms ALG-4, 1110021I22Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.967) question?
Stock # R9712 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 47079183-47119585 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 47117741 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1697 (K1697E)
Ref Sequence ENSEMBL: ENSMUSP00000072008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035822] [ENSMUST00000072141] [ENSMUST00000140512]
AlphaFold Q6NS46
Predicted Effect probably benign
Transcript: ENSMUST00000035822
SMART Domains Protein: ENSMUSP00000047278
Gene: ENSMUSG00000033033

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 6 256 2.3e-88 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072141
AA Change: K1697E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072008
Gene: ENSMUSG00000025047
AA Change: K1697E

DomainStartEndE-ValueType
low complexity region 53 76 N/A INTRINSIC
S1 81 171 1.05e-7 SMART
S1 185 258 2.32e-9 SMART
S1 279 346 1.44e-5 SMART
S1 363 436 8.55e-8 SMART
S1 451 522 3.89e-20 SMART
S1 540 611 1.14e-17 SMART
S1 634 707 2.76e-2 SMART
S1 727 798 2.02e-18 SMART
low complexity region 813 823 N/A INTRINSIC
S1 844 911 6.13e0 SMART
Blast:S1 923 993 8e-39 BLAST
low complexity region 1018 1032 N/A INTRINSIC
S1 1045 1120 1.3e-7 SMART
S1 1158 1233 6.09e-4 SMART
S1 1239 1309 4.14e-6 SMART
S1 1333 1407 1.57e-6 SMART
low complexity region 1433 1473 N/A INTRINSIC
coiled coil region 1557 1588 N/A INTRINSIC
HAT 1591 1622 6.53e2 SMART
HAT 1624 1661 4.12e1 SMART
HAT 1663 1694 3.49e2 SMART
HAT 1696 1728 3.18e-1 SMART
HAT 1730 1764 2.25e2 SMART
HAT 1766 1798 8.52e-2 SMART
HAT 1800 1835 1.33e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140512
SMART Domains Protein: ENSMUSP00000121661
Gene: ENSMUSG00000033033

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 6 258 2.9e-93 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PDCD11 is a NF-kappa-B (NFKB1; 164011)-binding protein that colocalizes with U3 RNA (MIM 180710) in the nucleolus and is required for rRNA maturation and generation of 18S rRNA (Sweet et al., 2003 [PubMed 14624448]; Sweet et al., 2008 [PubMed 17654514]).[supplied by OMIM, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik A T 19: 3,765,784 (GRCm39) M20L probably benign Het
Aadacl4fm1 C T 4: 144,255,354 (GRCm39) A258V probably benign Het
Abca8b T A 11: 109,833,163 (GRCm39) D1241V probably benign Het
Adam20 G A 8: 41,248,490 (GRCm39) R200H probably benign Het
Adcy10 T C 1: 165,340,681 (GRCm39) F229L probably damaging Het
Adsl A T 15: 80,839,840 (GRCm39) N126I probably benign Het
Ahnak GATCTCTAT GAT 19: 8,984,393 (GRCm39) probably benign Het
Ahnak AGATCTC A 19: 8,984,392 (GRCm39) probably benign Het
Aktip G A 8: 91,856,355 (GRCm39) P41S probably damaging Het
Alkbh3 C A 2: 93,811,318 (GRCm39) R258L probably damaging Het
Arfgap3 A G 15: 83,197,734 (GRCm39) Y341H probably benign Het
Arhgef26 C T 3: 62,331,034 (GRCm39) L583F probably damaging Het
Arhgef40 T C 14: 52,226,415 (GRCm39) I153T probably damaging Het
Atp1a1 T C 3: 101,498,757 (GRCm39) S179G probably benign Het
Bok T C 1: 93,614,229 (GRCm39) S21P probably damaging Het
Ccdc136 A G 6: 29,417,441 (GRCm39) E754G probably benign Het
Cers3 A G 7: 66,423,378 (GRCm39) K108E probably benign Het
Cmya5 T C 13: 93,201,881 (GRCm39) probably null Het
Col19a1 T C 1: 24,367,148 (GRCm39) E478G possibly damaging Het
Colec10 T A 15: 54,323,180 (GRCm39) S134R possibly damaging Het
Ctnnb1 A T 9: 120,784,895 (GRCm39) I514F probably damaging Het
Cux1 C T 5: 136,338,673 (GRCm39) E664K probably benign Het
Dars1 T C 1: 128,333,199 (GRCm39) Q75R probably benign Het
Disp1 T A 1: 182,917,379 (GRCm39) S16C probably damaging Het
Dnah7a A T 1: 53,598,299 (GRCm39) V1412E probably benign Het
Ect2l C T 10: 18,044,182 (GRCm39) V226I probably benign Het
Ep400 T A 5: 110,904,509 (GRCm39) H30L unknown Het
Ephx4 A G 5: 107,567,647 (GRCm39) I202V probably benign Het
Exoc3 A T 13: 74,341,027 (GRCm39) F259Y probably damaging Het
Ezr T C 17: 7,020,394 (GRCm39) E229G probably damaging Het
Fat1 A T 8: 45,470,417 (GRCm39) I1472L probably benign Het
Fsd1l T G 4: 53,679,972 (GRCm39) D223E probably benign Het
Gata6 A T 18: 11,059,064 (GRCm39) D377V possibly damaging Het
Gm12185 A T 11: 48,798,216 (GRCm39) M759K probably benign Het
Gm9922 C T 14: 101,966,893 (GRCm39) A120T unknown Het
Hectd4 A T 5: 121,448,744 (GRCm39) Y364F probably benign Het
Hnrnph1 A G 11: 50,276,696 (GRCm39) S465G unknown Het
Ifi204 T C 1: 173,576,924 (GRCm39) Y559C probably damaging Het
Ift88 T C 14: 57,718,853 (GRCm39) S613P probably damaging Het
Kif21a G C 15: 90,869,528 (GRCm39) A441G probably damaging Het
Kif21a G T 15: 90,879,715 (GRCm39) T191K probably benign Het
Lrit1 T A 14: 36,782,084 (GRCm39) C252* probably null Het
Ncbp1 T A 4: 46,144,837 (GRCm39) D29E probably benign Het
Nlrp10 A T 7: 108,524,735 (GRCm39) D248E probably damaging Het
Nphp4 T G 4: 152,631,521 (GRCm39) V807G probably benign Het
Nsd1 T C 13: 55,393,856 (GRCm39) S589P possibly damaging Het
Oas1b T A 5: 120,952,550 (GRCm39) N80K probably damaging Het
Oprk1 T A 1: 5,669,096 (GRCm39) C181S probably damaging Het
Oprl1 T A 2: 181,360,212 (GRCm39) N89K probably damaging Het
Or5w12 A T 2: 87,502,105 (GRCm39) I202N probably benign Het
Or8k53 G A 2: 86,177,583 (GRCm39) H176Y probably benign Het
Pdp1 G A 4: 11,961,607 (GRCm39) H254Y probably benign Het
Pds5b A T 5: 150,729,128 (GRCm39) D1419V possibly damaging Het
Per1 G T 11: 68,991,475 (GRCm39) G3V probably benign Het
Pex16 C A 2: 92,206,988 (GRCm39) N55K probably damaging Het
Phldb2 C A 16: 45,595,340 (GRCm39) L862F probably benign Het
Pld5 T A 1: 175,791,572 (GRCm39) D478V probably benign Het
Pms2 T C 5: 143,851,614 (GRCm39) I177T probably damaging Het
Pou1f1 A T 16: 65,326,758 (GRCm39) E119D probably benign Het
Ppp2r1a A C 17: 21,179,058 (GRCm39) E295A probably damaging Het
Qrfprl A G 6: 65,433,124 (GRCm39) I315V probably benign Het
Rad51ap2 A T 12: 11,507,593 (GRCm39) N505I possibly damaging Het
Rasal3 A C 17: 32,615,536 (GRCm39) V434G probably damaging Het
Rasgrf2 C T 13: 92,136,092 (GRCm39) V6M Het
Rwdd1 A T 10: 33,877,152 (GRCm39) D197E Het
Scn11a A T 9: 119,619,076 (GRCm39) C755* probably null Het
Skil T C 3: 31,171,009 (GRCm39) S443P probably benign Het
Slc12a6 T C 2: 112,186,817 (GRCm39) C939R probably damaging Het
Slc25a36 A G 9: 96,961,230 (GRCm39) S269P probably benign Het
Srrm4 T A 5: 116,620,452 (GRCm39) H92L unknown Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Tbc1d4 A T 14: 101,744,846 (GRCm39) V260E probably benign Het
Tbc1d8 T C 1: 39,424,313 (GRCm39) N593D probably damaging Het
Trex1 C A 9: 108,887,805 (GRCm39) R62L probably damaging Het
Trpm3 A T 19: 22,692,716 (GRCm39) D269V possibly damaging Het
Trpv4 G T 5: 114,771,211 (GRCm39) Y439* probably null Het
Ttn G A 2: 76,564,592 (GRCm39) T28515I probably damaging Het
Ucn2 G A 9: 108,815,571 (GRCm39) G111D probably damaging Het
Uhrf2 A G 19: 30,033,881 (GRCm39) I212V possibly damaging Het
Usp24 T A 4: 106,204,564 (GRCm39) M261K probably benign Het
Vmn1r235 A T 17: 21,481,960 (GRCm39) D95V probably benign Het
Vwf G A 6: 125,601,536 (GRCm39) R826Q Het
Zfp1002 C T 2: 150,096,496 (GRCm39) R311Q probably benign Het
Zfp28 T C 7: 6,396,878 (GRCm39) C438R probably damaging Het
Other mutations in Pdcd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00646:Pdcd11 APN 19 47,105,767 (GRCm39) missense possibly damaging 0.83
IGL00656:Pdcd11 APN 19 47,086,609 (GRCm39) missense probably damaging 1.00
IGL00754:Pdcd11 APN 19 47,092,221 (GRCm39) missense possibly damaging 0.86
IGL00907:Pdcd11 APN 19 47,096,003 (GRCm39) missense probably benign 0.16
IGL00987:Pdcd11 APN 19 47,102,989 (GRCm39) intron probably benign
IGL01346:Pdcd11 APN 19 47,098,053 (GRCm39) missense probably benign 0.03
IGL01529:Pdcd11 APN 19 47,098,068 (GRCm39) missense probably benign 0.01
IGL01670:Pdcd11 APN 19 47,094,743 (GRCm39) missense probably damaging 0.98
IGL01917:Pdcd11 APN 19 47,089,604 (GRCm39) missense possibly damaging 0.92
IGL02096:Pdcd11 APN 19 47,094,860 (GRCm39) missense probably benign 0.10
IGL02300:Pdcd11 APN 19 47,115,381 (GRCm39) missense probably benign
IGL02515:Pdcd11 APN 19 47,113,516 (GRCm39) missense probably damaging 1.00
IGL02886:Pdcd11 APN 19 47,102,064 (GRCm39) missense possibly damaging 0.95
IGL03158:Pdcd11 APN 19 47,116,500 (GRCm39) missense possibly damaging 0.91
R0100:Pdcd11 UTSW 19 47,091,105 (GRCm39) missense probably benign 0.00
R0100:Pdcd11 UTSW 19 47,091,105 (GRCm39) missense probably benign 0.00
R0128:Pdcd11 UTSW 19 47,108,301 (GRCm39) missense probably benign 0.15
R0139:Pdcd11 UTSW 19 47,099,398 (GRCm39) critical splice acceptor site probably null
R0227:Pdcd11 UTSW 19 47,101,876 (GRCm39) intron probably benign
R0316:Pdcd11 UTSW 19 47,101,611 (GRCm39) missense probably damaging 0.97
R0480:Pdcd11 UTSW 19 47,113,476 (GRCm39) intron probably benign
R0577:Pdcd11 UTSW 19 47,087,271 (GRCm39) missense probably benign 0.01
R0725:Pdcd11 UTSW 19 47,115,730 (GRCm39) missense probably benign 0.17
R1344:Pdcd11 UTSW 19 47,118,516 (GRCm39) missense probably damaging 1.00
R1418:Pdcd11 UTSW 19 47,118,516 (GRCm39) missense probably damaging 1.00
R1856:Pdcd11 UTSW 19 47,086,626 (GRCm39) missense probably benign 0.00
R2146:Pdcd11 UTSW 19 47,093,191 (GRCm39) missense probably benign 0.00
R2147:Pdcd11 UTSW 19 47,093,191 (GRCm39) missense probably benign 0.00
R2447:Pdcd11 UTSW 19 47,102,995 (GRCm39) missense probably benign 0.01
R2916:Pdcd11 UTSW 19 47,101,876 (GRCm39) intron probably benign
R3177:Pdcd11 UTSW 19 47,101,703 (GRCm39) missense probably damaging 1.00
R3277:Pdcd11 UTSW 19 47,101,703 (GRCm39) missense probably damaging 1.00
R3712:Pdcd11 UTSW 19 47,115,684 (GRCm39) intron probably benign
R4495:Pdcd11 UTSW 19 47,099,445 (GRCm39) missense probably benign
R4697:Pdcd11 UTSW 19 47,114,786 (GRCm39) missense possibly damaging 0.83
R4941:Pdcd11 UTSW 19 47,108,325 (GRCm39) missense probably damaging 1.00
R4953:Pdcd11 UTSW 19 47,116,404 (GRCm39) missense probably benign 0.04
R5048:Pdcd11 UTSW 19 47,095,554 (GRCm39) missense probably benign
R5049:Pdcd11 UTSW 19 47,095,554 (GRCm39) missense probably benign
R5103:Pdcd11 UTSW 19 47,112,893 (GRCm39) missense probably benign 0.00
R5107:Pdcd11 UTSW 19 47,094,893 (GRCm39) missense probably damaging 1.00
R5139:Pdcd11 UTSW 19 47,095,554 (GRCm39) missense probably benign
R5261:Pdcd11 UTSW 19 47,101,976 (GRCm39) missense probably benign
R5302:Pdcd11 UTSW 19 47,096,083 (GRCm39) missense probably damaging 1.00
R5592:Pdcd11 UTSW 19 47,091,164 (GRCm39) missense probably benign
R5769:Pdcd11 UTSW 19 47,091,076 (GRCm39) missense possibly damaging 0.92
R5791:Pdcd11 UTSW 19 47,099,430 (GRCm39) missense possibly damaging 0.65
R5809:Pdcd11 UTSW 19 47,082,247 (GRCm39) missense probably benign 0.01
R5899:Pdcd11 UTSW 19 47,093,198 (GRCm39) missense possibly damaging 0.93
R5901:Pdcd11 UTSW 19 47,116,771 (GRCm39) missense possibly damaging 0.76
R5947:Pdcd11 UTSW 19 47,117,702 (GRCm39) missense probably benign 0.20
R6177:Pdcd11 UTSW 19 47,108,722 (GRCm39) missense probably damaging 1.00
R6489:Pdcd11 UTSW 19 47,098,191 (GRCm39) missense probably damaging 1.00
R6575:Pdcd11 UTSW 19 47,098,117 (GRCm39) missense probably damaging 0.98
R6578:Pdcd11 UTSW 19 47,099,520 (GRCm39) missense probably benign 0.11
R7009:Pdcd11 UTSW 19 47,101,581 (GRCm39) missense probably benign 0.17
R7015:Pdcd11 UTSW 19 47,086,665 (GRCm39) missense probably benign 0.00
R7060:Pdcd11 UTSW 19 47,099,418 (GRCm39) missense probably benign 0.30
R7260:Pdcd11 UTSW 19 47,117,673 (GRCm39) missense possibly damaging 0.62
R7392:Pdcd11 UTSW 19 47,116,436 (GRCm39) missense probably damaging 1.00
R7601:Pdcd11 UTSW 19 47,094,808 (GRCm39) missense not run
R7759:Pdcd11 UTSW 19 47,101,637 (GRCm39) missense possibly damaging 0.88
R7760:Pdcd11 UTSW 19 47,101,637 (GRCm39) missense possibly damaging 0.88
R7785:Pdcd11 UTSW 19 47,093,125 (GRCm39) missense probably benign 0.00
R7793:Pdcd11 UTSW 19 47,094,871 (GRCm39) missense probably benign 0.00
R7810:Pdcd11 UTSW 19 47,086,659 (GRCm39) missense possibly damaging 0.81
R7863:Pdcd11 UTSW 19 47,085,403 (GRCm39) missense probably damaging 1.00
R7950:Pdcd11 UTSW 19 47,101,876 (GRCm39) intron probably benign
R8062:Pdcd11 UTSW 19 47,119,152 (GRCm39) missense possibly damaging 0.50
R8184:Pdcd11 UTSW 19 47,101,791 (GRCm39) nonsense probably null
R8278:Pdcd11 UTSW 19 47,094,736 (GRCm39) missense probably damaging 1.00
R8404:Pdcd11 UTSW 19 47,093,231 (GRCm39) missense probably damaging 0.98
R8508:Pdcd11 UTSW 19 47,108,245 (GRCm39) missense probably damaging 1.00
R8525:Pdcd11 UTSW 19 47,081,337 (GRCm39) missense possibly damaging 0.52
R8787:Pdcd11 UTSW 19 47,097,019 (GRCm39) missense probably damaging 1.00
R9019:Pdcd11 UTSW 19 47,101,658 (GRCm39) missense probably damaging 1.00
R9534:Pdcd11 UTSW 19 47,108,718 (GRCm39) missense probably benign 0.01
R9660:Pdcd11 UTSW 19 47,082,191 (GRCm39) missense possibly damaging 0.67
RF010:Pdcd11 UTSW 19 47,101,890 (GRCm39) frame shift probably null
RF027:Pdcd11 UTSW 19 47,101,888 (GRCm39) frame shift probably null
RF039:Pdcd11 UTSW 19 47,101,894 (GRCm39) frame shift probably null
RF061:Pdcd11 UTSW 19 47,101,884 (GRCm39) frame shift probably null
X0065:Pdcd11 UTSW 19 47,085,335 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTCGTGTTCTACCCACC -3'
(R):5'- GAGACTGGGAAGCTCATCAG -3'

Sequencing Primer
(F):5'- GTTCTACCCACCCCCTCAGAG -3'
(R):5'- GGAGCTTCCCTAGTGATCCC -3'
Posted On 2022-10-06