Incidental Mutation 'R9715:Scn7a'
ID 730376
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Name sodium channel, voltage-gated, type VII, alpha
Synonyms 1110034K09Rik, NaG, Nav2, Nax, Nav2.3, Scn6a
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R9715 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 66503770-66615254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 66519902 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 1001 (Y1001N)
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
AlphaFold B1AYL1
Predicted Effect possibly damaging
Transcript: ENSMUST00000042792
AA Change: Y1001N

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810
AA Change: Y1001N

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 C T 7: 45,629,359 (GRCm39) V1323I probably damaging Het
Adam20 G A 8: 41,248,490 (GRCm39) R200H probably benign Het
Ahnak GATCTCTAT GAT 19: 8,984,393 (GRCm39) probably benign Het
Cbr3 A G 16: 93,481,941 (GRCm39) D99G probably benign Het
Ccdc17 T A 4: 116,455,090 (GRCm39) L215Q probably damaging Het
Cep350 A G 1: 155,751,107 (GRCm39) Y2022H probably benign Het
Cimip2c G C 5: 30,641,261 (GRCm39) D170H possibly damaging Het
Cnbd2 T C 2: 156,183,547 (GRCm39) S338P probably benign Het
D5Ertd579e A T 5: 36,787,029 (GRCm39) V113D possibly damaging Het
Dhx30 A G 9: 109,916,718 (GRCm39) F570S probably damaging Het
Ephb1 T C 9: 101,848,384 (GRCm39) N679S probably damaging Het
Faxc T C 4: 21,993,307 (GRCm39) I317T probably damaging Het
Fgd5 T C 6: 91,965,290 (GRCm39) Y508H possibly damaging Het
Foxd2 G T 4: 114,765,195 (GRCm39) A275E unknown Het
Fut9 C A 4: 25,620,679 (GRCm39) S45I probably benign Het
Gm5148 T C 3: 37,768,801 (GRCm39) N140D unknown Het
Gpr37l1 C T 1: 135,089,391 (GRCm39) G225S probably damaging Het
Gramd1c G A 16: 43,825,840 (GRCm39) S107L possibly damaging Het
Gtpbp2 A G 17: 46,478,301 (GRCm39) D483G Het
Ik G A 18: 36,886,566 (GRCm39) R346H probably benign Het
Ino80e A T 7: 126,461,098 (GRCm39) Y50N unknown Het
Irag1 A T 7: 110,470,640 (GRCm39) S898T possibly damaging Het
Kbtbd2 A G 6: 56,756,566 (GRCm39) V390A probably benign Het
Limch1 A C 5: 67,156,360 (GRCm39) N276H probably damaging Het
Negr1 T G 3: 156,774,936 (GRCm39) probably null Het
Ngef G A 1: 87,431,010 (GRCm39) P269L probably damaging Het
Nlrp14 G A 7: 106,781,626 (GRCm39) M274I probably benign Het
Nr1d1 T C 11: 98,662,943 (GRCm39) I17V probably benign Het
Or10ad1b T A 15: 98,124,902 (GRCm39) D210V probably damaging Het
Or4k35 T C 2: 111,100,623 (GRCm39) I30V probably benign Het
Or5p64 A G 7: 107,855,198 (GRCm39) I49T probably benign Het
Ppip5k2 A G 1: 97,677,312 (GRCm39) V334A Het
Ppp1r9a G A 6: 5,045,936 (GRCm39) V467I probably damaging Het
Ppp2r2c A G 5: 37,097,488 (GRCm39) I225V possibly damaging Het
Ptpro A T 6: 137,345,108 (GRCm39) N38I probably damaging Het
Scn2a C A 2: 65,579,149 (GRCm39) Q1495K possibly damaging Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,103,382 (GRCm39) probably benign Het
Sh3bgrl2 T A 9: 83,430,513 (GRCm39) M1K probably null Het
Slc25a12 C T 2: 71,109,899 (GRCm39) V516M probably benign Het
Sptbn4 A G 7: 27,091,000 (GRCm39) L1402P probably damaging Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Svop A G 5: 114,198,169 (GRCm39) S135P probably benign Het
Sycp2 G T 2: 178,035,957 (GRCm39) D243E probably damaging Het
Tcerg1 T C 18: 42,706,413 (GRCm39) F1030S probably damaging Het
Tecta T A 9: 42,286,596 (GRCm39) N687Y probably damaging Het
Tep1 A T 14: 51,081,759 (GRCm39) H1230Q Het
Tfap2b T C 1: 19,284,373 (GRCm39) S94P probably damaging Het
Tll2 C A 19: 41,092,238 (GRCm39) G533V probably damaging Het
Vmn2r55 A G 7: 12,402,061 (GRCm39) V409A probably damaging Het
Wdr41 A G 13: 95,145,373 (GRCm39) E194G probably damaging Het
Zan G T 5: 137,398,817 (GRCm39) S4182R unknown Het
Zfpl1 T C 19: 6,134,074 (GRCm39) Y40C probably damaging Het
Znrf3 C A 11: 5,232,454 (GRCm39) R257L possibly damaging Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66,513,671 (GRCm39) splice site probably benign
IGL00432:Scn7a APN 2 66,572,326 (GRCm39) nonsense probably null
IGL00720:Scn7a APN 2 66,506,388 (GRCm39) missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66,522,908 (GRCm39) missense probably damaging 0.99
IGL00784:Scn7a APN 2 66,522,908 (GRCm39) missense probably damaging 0.99
IGL00926:Scn7a APN 2 66,514,475 (GRCm39) missense probably benign 0.06
IGL00963:Scn7a APN 2 66,534,289 (GRCm39) splice site probably benign
IGL01099:Scn7a APN 2 66,514,582 (GRCm39) missense probably damaging 1.00
IGL01326:Scn7a APN 2 66,582,604 (GRCm39) missense probably benign 0.13
IGL01538:Scn7a APN 2 66,534,196 (GRCm39) missense probably benign
IGL01624:Scn7a APN 2 66,582,269 (GRCm39) missense probably benign 0.07
IGL01794:Scn7a APN 2 66,505,853 (GRCm39) missense probably benign
IGL02100:Scn7a APN 2 66,505,843 (GRCm39) makesense probably null
IGL02326:Scn7a APN 2 66,530,392 (GRCm39) missense probably benign 0.00
IGL02472:Scn7a APN 2 66,582,658 (GRCm39) missense probably damaging 1.00
IGL02528:Scn7a APN 2 66,530,519 (GRCm39) missense probably damaging 1.00
IGL02798:Scn7a APN 2 66,544,219 (GRCm39) missense probably benign 0.00
IGL03026:Scn7a APN 2 66,506,442 (GRCm39) missense probably damaging 0.99
IGL03071:Scn7a APN 2 66,530,291 (GRCm39) missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66,528,160 (GRCm39) missense probably benign 0.01
IGL03180:Scn7a APN 2 66,506,578 (GRCm39) missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66,506,304 (GRCm39) missense probably benign 0.00
alert UTSW 2 66,510,590 (GRCm39) nonsense probably null
glimmer UTSW 2 66,574,047 (GRCm39) missense probably damaging 0.96
Uptick UTSW 2 66,530,393 (GRCm39) nonsense probably null
PIT4514001:Scn7a UTSW 2 66,514,523 (GRCm39) missense probably damaging 1.00
R0004:Scn7a UTSW 2 66,518,139 (GRCm39) missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66,544,381 (GRCm39) missense probably benign 0.04
R0230:Scn7a UTSW 2 66,556,628 (GRCm39) missense probably damaging 1.00
R0463:Scn7a UTSW 2 66,506,084 (GRCm39) missense probably benign 0.05
R0846:Scn7a UTSW 2 66,527,944 (GRCm39) missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66,510,639 (GRCm39) missense probably damaging 0.98
R1282:Scn7a UTSW 2 66,531,193 (GRCm39) missense probably damaging 0.98
R1467:Scn7a UTSW 2 66,519,902 (GRCm39) missense probably benign 0.01
R1467:Scn7a UTSW 2 66,519,902 (GRCm39) missense probably benign 0.01
R1501:Scn7a UTSW 2 66,530,507 (GRCm39) missense probably benign 0.37
R1672:Scn7a UTSW 2 66,527,944 (GRCm39) missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66,506,287 (GRCm39) missense probably damaging 0.99
R1712:Scn7a UTSW 2 66,535,447 (GRCm39) missense probably benign 0.05
R1758:Scn7a UTSW 2 66,531,231 (GRCm39) missense probably damaging 0.97
R1758:Scn7a UTSW 2 66,510,527 (GRCm39) missense probably benign 0.00
R1775:Scn7a UTSW 2 66,511,299 (GRCm39) missense probably benign 0.02
R1848:Scn7a UTSW 2 66,514,357 (GRCm39) critical splice donor site probably null
R1851:Scn7a UTSW 2 66,510,635 (GRCm39) missense probably benign
R1919:Scn7a UTSW 2 66,530,317 (GRCm39) missense probably damaging 1.00
R1932:Scn7a UTSW 2 66,506,446 (GRCm39) missense probably damaging 1.00
R1945:Scn7a UTSW 2 66,506,324 (GRCm39) missense probably damaging 1.00
R1970:Scn7a UTSW 2 66,514,633 (GRCm39) missense possibly damaging 0.89
R1998:Scn7a UTSW 2 66,513,613 (GRCm39) missense probably damaging 0.99
R2008:Scn7a UTSW 2 66,518,091 (GRCm39) missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66,567,780 (GRCm39) missense probably damaging 1.00
R2113:Scn7a UTSW 2 66,506,312 (GRCm39) missense probably damaging 1.00
R2128:Scn7a UTSW 2 66,528,330 (GRCm39) missense probably damaging 0.99
R2163:Scn7a UTSW 2 66,506,300 (GRCm39) missense probably damaging 0.97
R2421:Scn7a UTSW 2 66,556,646 (GRCm39) splice site probably benign
R2446:Scn7a UTSW 2 66,523,002 (GRCm39) missense probably damaging 0.98
R2922:Scn7a UTSW 2 66,530,551 (GRCm39) splice site probably benign
R3015:Scn7a UTSW 2 66,530,240 (GRCm39) missense probably benign 0.08
R3034:Scn7a UTSW 2 66,513,152 (GRCm39) missense probably damaging 1.00
R3419:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3429:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3430:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3434:Scn7a UTSW 2 66,505,847 (GRCm39) missense probably benign 0.01
R3803:Scn7a UTSW 2 66,510,590 (GRCm39) nonsense probably null
R3831:Scn7a UTSW 2 66,528,028 (GRCm39) missense probably damaging 0.96
R3833:Scn7a UTSW 2 66,528,028 (GRCm39) missense probably damaging 0.96
R4017:Scn7a UTSW 2 66,572,329 (GRCm39) missense probably damaging 1.00
R4244:Scn7a UTSW 2 66,572,345 (GRCm39) missense probably benign 0.00
R4245:Scn7a UTSW 2 66,572,345 (GRCm39) missense probably benign 0.00
R4276:Scn7a UTSW 2 66,514,407 (GRCm39) missense probably damaging 0.97
R4307:Scn7a UTSW 2 66,506,099 (GRCm39) missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66,567,815 (GRCm39) missense probably damaging 1.00
R4353:Scn7a UTSW 2 66,506,780 (GRCm39) missense probably benign 0.00
R4721:Scn7a UTSW 2 66,514,529 (GRCm39) missense probably damaging 1.00
R4722:Scn7a UTSW 2 66,531,228 (GRCm39) missense possibly damaging 0.95
R4781:Scn7a UTSW 2 66,534,104 (GRCm39) missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66,556,592 (GRCm39) missense probably damaging 1.00
R5362:Scn7a UTSW 2 66,530,342 (GRCm39) missense probably damaging 1.00
R5437:Scn7a UTSW 2 66,506,690 (GRCm39) missense probably damaging 1.00
R5729:Scn7a UTSW 2 66,572,301 (GRCm39) critical splice donor site probably null
R5777:Scn7a UTSW 2 66,522,913 (GRCm39) missense probably damaging 1.00
R5785:Scn7a UTSW 2 66,527,912 (GRCm39) missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66,574,047 (GRCm39) missense probably damaging 0.96
R5830:Scn7a UTSW 2 66,544,395 (GRCm39) nonsense probably null
R5877:Scn7a UTSW 2 66,530,217 (GRCm39) nonsense probably null
R5881:Scn7a UTSW 2 66,505,870 (GRCm39) missense probably benign 0.01
R5967:Scn7a UTSW 2 66,506,057 (GRCm39) missense probably damaging 1.00
R5988:Scn7a UTSW 2 66,556,558 (GRCm39) nonsense probably null
R6077:Scn7a UTSW 2 66,527,940 (GRCm39) missense probably damaging 1.00
R6135:Scn7a UTSW 2 66,534,244 (GRCm39) missense probably benign
R6242:Scn7a UTSW 2 66,531,110 (GRCm39) missense probably benign 0.00
R6264:Scn7a UTSW 2 66,505,870 (GRCm39) missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66,530,458 (GRCm39) missense probably damaging 0.98
R6544:Scn7a UTSW 2 66,514,444 (GRCm39) missense probably damaging 1.00
R6770:Scn7a UTSW 2 66,559,528 (GRCm39) splice site probably null
R6997:Scn7a UTSW 2 66,534,147 (GRCm39) missense probably damaging 1.00
R7014:Scn7a UTSW 2 66,572,303 (GRCm39) missense probably null 1.00
R7126:Scn7a UTSW 2 66,587,630 (GRCm39) missense possibly damaging 0.80
R7129:Scn7a UTSW 2 66,530,537 (GRCm39) missense probably benign 0.14
R7176:Scn7a UTSW 2 66,506,632 (GRCm39) missense probably damaging 1.00
R7185:Scn7a UTSW 2 66,518,139 (GRCm39) missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66,587,506 (GRCm39) missense probably damaging 1.00
R7332:Scn7a UTSW 2 66,522,898 (GRCm39) nonsense probably null
R7421:Scn7a UTSW 2 66,505,876 (GRCm39) missense probably benign 0.07
R7488:Scn7a UTSW 2 66,587,574 (GRCm39) missense probably benign 0.16
R7636:Scn7a UTSW 2 66,574,172 (GRCm39) missense possibly damaging 0.67
R7685:Scn7a UTSW 2 66,506,536 (GRCm39) missense probably damaging 1.00
R7711:Scn7a UTSW 2 66,531,221 (GRCm39) missense probably damaging 1.00
R7813:Scn7a UTSW 2 66,506,689 (GRCm39) missense probably damaging 1.00
R7833:Scn7a UTSW 2 66,506,494 (GRCm39) missense probably damaging 1.00
R7914:Scn7a UTSW 2 66,530,294 (GRCm39) missense probably damaging 0.97
R7953:Scn7a UTSW 2 66,587,670 (GRCm39) missense possibly damaging 0.90
R7970:Scn7a UTSW 2 66,506,173 (GRCm39) missense probably damaging 1.00
R8061:Scn7a UTSW 2 66,522,938 (GRCm39) missense probably damaging 1.00
R8121:Scn7a UTSW 2 66,531,203 (GRCm39) missense probably damaging 1.00
R8172:Scn7a UTSW 2 66,506,191 (GRCm39) missense possibly damaging 0.90
R8209:Scn7a UTSW 2 66,531,204 (GRCm39) missense possibly damaging 0.88
R8226:Scn7a UTSW 2 66,531,204 (GRCm39) missense possibly damaging 0.88
R8288:Scn7a UTSW 2 66,506,318 (GRCm39) missense probably damaging 1.00
R8431:Scn7a UTSW 2 66,534,164 (GRCm39) missense possibly damaging 0.62
R8678:Scn7a UTSW 2 66,574,041 (GRCm39) splice site probably benign
R8745:Scn7a UTSW 2 66,510,526 (GRCm39) missense probably benign
R8781:Scn7a UTSW 2 66,567,775 (GRCm39) missense probably benign 0.03
R8848:Scn7a UTSW 2 66,530,393 (GRCm39) nonsense probably null
R8878:Scn7a UTSW 2 66,506,199 (GRCm39) missense probably damaging 1.00
R8943:Scn7a UTSW 2 66,525,206 (GRCm39) synonymous silent
R8991:Scn7a UTSW 2 66,514,588 (GRCm39) missense possibly damaging 0.65
R9147:Scn7a UTSW 2 66,514,507 (GRCm39) missense possibly damaging 0.89
R9148:Scn7a UTSW 2 66,514,507 (GRCm39) missense possibly damaging 0.89
R9402:Scn7a UTSW 2 66,510,456 (GRCm39) missense probably damaging 1.00
R9501:Scn7a UTSW 2 66,582,579 (GRCm39) missense probably benign 0.00
R9546:Scn7a UTSW 2 66,582,603 (GRCm39) missense possibly damaging 0.93
X0060:Scn7a UTSW 2 66,520,026 (GRCm39) missense probably benign 0.01
X0066:Scn7a UTSW 2 66,510,536 (GRCm39) missense probably benign
Z1088:Scn7a UTSW 2 66,544,295 (GRCm39) missense probably damaging 0.98
Z1177:Scn7a UTSW 2 66,582,613 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAACAGAGGAGAATAGTGCTT -3'
(R):5'- ACTTTGCATACTGCCATGTAAAT -3'

Sequencing Primer
(F):5'- CTGACAGGTCTGAACTCAGTCAG -3'
(R):5'- TGCCATGTAAATTTTTAATTACAGGC -3'
Posted On 2022-10-06