Mutagenetix > Incidental Mutation

Incidental Mutation 'R9715:D5Ertd579e'

730388

Institutional Source

Beutler Lab

Gene Symbol

D5Ertd579e

Ensembl Gene

ENSMUSG00000029190

Gene Name

DNA segment, Chr 5, ERATO Doi 579, expressed

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.266) question?

Stock #

R9715 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

36600485-36696024 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 36629685 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 113 (V113D)

Ref Sequence

ENSEMBL: ENSMUSP00000031091 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031091]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031091
AA Change: V113D

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000031091
Gene: ENSMUSG00000029190
AA Change: V113D

Domain	Start	End	E-Value	Type
Pfam:DUF4603	23	1303	N/A	PFAM
low complexity region	1365	1376	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C02Rik	G	C	5: 30,483,917	D170H	possibly damaging	Het
Abcc6	C	T	7: 45,979,935	V1323I	probably damaging	Het
Adam20	G	A	8: 40,795,453	R200H	probably benign	Het
Ahnak	GATCTCTAT	GAT	19: 9,007,029		probably benign	Het
Cbr3	A	G	16: 93,685,053	D99G	probably benign	Het
Ccdc17	T	A	4: 116,597,893	L215Q	probably damaging	Het
Cep350	A	G	1: 155,875,361	Y2022H	probably benign	Het
Cnbd2	T	C	2: 156,341,627	S338P	probably benign	Het
Dhx30	A	G	9: 110,087,650	F570S	probably damaging	Het
Ephb1	T	C	9: 101,971,185	N679S	probably damaging	Het
Faxc	T	C	4: 21,993,307	I317T	probably damaging	Het
Fgd5	T	C	6: 91,988,309	Y508H	possibly damaging	Het
Foxd2	G	T	4: 114,907,998	A275E	unknown	Het
Fut9	C	A	4: 25,620,679	S45I	probably benign	Het
Gm5148	T	C	3: 37,714,652	N140D	unknown	Het
Gpr37l1	C	T	1: 135,161,653	G225S	probably damaging	Het
Gramd1c	G	A	16: 44,005,477	S107L	possibly damaging	Het
Gtpbp2	A	G	17: 46,167,375	D483G		Het
Ik	G	A	18: 36,753,513	R346H	probably benign	Het
Ino80e	A	T	7: 126,861,926	Y50N	unknown	Het
Kbtbd2	A	G	6: 56,779,581	V390A	probably benign	Het
Limch1	A	C	5: 66,999,017	N276H	probably damaging	Het
Mrvi1	A	T	7: 110,871,433	S898T	possibly damaging	Het
Negr1	T	G	3: 157,069,299		probably null	Het
Ngef	G	A	1: 87,503,288	P269L	probably damaging	Het
Nlrp14	G	A	7: 107,182,419	M274I	probably benign	Het
Nr1d1	T	C	11: 98,772,117	I17V	probably benign	Het
Olfr1277	T	C	2: 111,270,278	I30V	probably benign	Het
Olfr286	T	A	15: 98,227,021	D210V	probably damaging	Het
Olfr488	A	G	7: 108,255,991	I49T	probably benign	Het
Ppip5k2	A	G	1: 97,749,587	V334A		Het
Ppp1r9a	G	A	6: 5,045,936	V467I	probably damaging	Het
Ppp2r2c	A	G	5: 36,940,144	I225V	possibly damaging	Het
Ptpro	A	T	6: 137,368,110	N38I	probably damaging	Het
Scn2a	C	A	2: 65,748,805	Q1495K	possibly damaging	Het
Scn7a	A	T	2: 66,689,558	Y1001N	possibly damaging	Het
Sfi1	ACA	ACATCTTCCCAAAGCCAGTCA	11: 3,153,382		probably benign	Het
Sh3bgrl2	T	A	9: 83,548,460	M1K	probably null	Het
Slc25a12	C	T	2: 71,279,555	V516M	probably benign	Het
Sptbn4	A	G	7: 27,391,575	L1402P	probably damaging	Het
Styk1	CTCTTCATGATTTTCTT	CTCTT	6: 131,301,649		probably benign	Het
Svop	A	G	5: 114,060,108	S135P	probably benign	Het
Sycp2	G	T	2: 178,394,164	D243E	probably damaging	Het
Tcerg1	T	C	18: 42,573,348	F1030S	probably damaging	Het
Tecta	T	A	9: 42,375,300	N687Y	probably damaging	Het
Tep1	A	T	14: 50,844,302	H1230Q		Het
Tfap2b	T	C	1: 19,214,149	S94P	probably damaging	Het
Tll2	C	A	19: 41,103,799	G533V	probably damaging	Het
Vmn2r55	A	G	7: 12,668,134	V409A	probably damaging	Het
Wdr41	A	G	13: 95,008,865	E194G	probably damaging	Het
Zan	G	T	5: 137,400,555	S4182R	unknown	Het
Zfpl1	T	C	19: 6,084,044	Y40C	probably damaging	Het
Znrf3	C	A	11: 5,282,454	R257L	possibly damaging	Het

Other mutations in D5Ertd579e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01433:D5Ertd579e	APN	5	36618754	missense	probably damaging	0.99
IGL01925:D5Ertd579e	APN	5	36614284	missense	possibly damaging	0.67
IGL01933:D5Ertd579e	APN	5	36615756	missense	probably benign
IGL02164:D5Ertd579e	APN	5	36614959	missense	probably damaging	1.00
IGL02399:D5Ertd579e	APN	5	36616185	missense	probably damaging	1.00
IGL02896:D5Ertd579e	APN	5	36613982	missense	possibly damaging	0.70
IGL03141:D5Ertd579e	APN	5	36613277	missense	possibly damaging	0.94
IGL03235:D5Ertd579e	APN	5	36618828	splice site	probably benign
R0201:D5Ertd579e	UTSW	5	36616465	missense	probably damaging	1.00
R0377:D5Ertd579e	UTSW	5	36604567	missense	probably benign	0.12
R0830:D5Ertd579e	UTSW	5	36613757	missense	probably damaging	1.00
R0926:D5Ertd579e	UTSW	5	36672866	missense	probably damaging	1.00
R1350:D5Ertd579e	UTSW	5	36613737	missense	probably damaging	1.00
R1448:D5Ertd579e	UTSW	5	36602739	missense	probably benign
R1672:D5Ertd579e	UTSW	5	36613277	missense	possibly damaging	0.50
R1676:D5Ertd579e	UTSW	5	36616109	missense	probably benign	0.01
R1693:D5Ertd579e	UTSW	5	36614097	missense	probably damaging	0.98
R1698:D5Ertd579e	UTSW	5	36604530	missense	probably benign
R1868:D5Ertd579e	UTSW	5	36616427	missense	probably damaging	0.99
R1909:D5Ertd579e	UTSW	5	36614058	missense	probably benign	0.21
R2034:D5Ertd579e	UTSW	5	36613538	nonsense	probably null
R2080:D5Ertd579e	UTSW	5	36616206	missense	probably benign	0.01
R2105:D5Ertd579e	UTSW	5	36613449	missense	probably benign	0.12
R2197:D5Ertd579e	UTSW	5	36614793	missense	possibly damaging	0.69
R4212:D5Ertd579e	UTSW	5	36614479	missense	probably damaging	0.99
R4452:D5Ertd579e	UTSW	5	36616470	missense	probably damaging	1.00
R4626:D5Ertd579e	UTSW	5	36614559	missense	possibly damaging	0.92
R4804:D5Ertd579e	UTSW	5	36629652	splice site	probably null
R4898:D5Ertd579e	UTSW	5	36614941	missense	probably damaging	0.99
R4917:D5Ertd579e	UTSW	5	36615816	missense	probably damaging	1.00
R4960:D5Ertd579e	UTSW	5	36616227	nonsense	probably null
R4973:D5Ertd579e	UTSW	5	36672905	missense	probably benign
R5092:D5Ertd579e	UTSW	5	36602703	missense	probably benign	0.18
R5474:D5Ertd579e	UTSW	5	36615257	missense	probably damaging	1.00
R5475:D5Ertd579e	UTSW	5	36615257	missense	probably damaging	1.00
R5476:D5Ertd579e	UTSW	5	36615257	missense	probably damaging	1.00
R5477:D5Ertd579e	UTSW	5	36615257	missense	probably damaging	1.00
R5801:D5Ertd579e	UTSW	5	36604569	missense	probably damaging	1.00
R6019:D5Ertd579e	UTSW	5	36629692	missense	possibly damaging	0.90
R6184:D5Ertd579e	UTSW	5	36629783	missense	probably damaging	0.99
R6213:D5Ertd579e	UTSW	5	36602634	missense	probably damaging	1.00
R6244:D5Ertd579e	UTSW	5	36615276	missense	probably damaging	0.98
R6276:D5Ertd579e	UTSW	5	36604514	missense	possibly damaging	0.66
R6285:D5Ertd579e	UTSW	5	36615577	missense	probably damaging	1.00
R6358:D5Ertd579e	UTSW	5	36616236	splice site	probably null
R6875:D5Ertd579e	UTSW	5	36604657	splice site	probably null
R6967:D5Ertd579e	UTSW	5	36615756	missense	probably benign
R7139:D5Ertd579e	UTSW	5	36613976	missense	probably damaging	1.00
R7329:D5Ertd579e	UTSW	5	36616395	missense	probably benign	0.21
R7464:D5Ertd579e	UTSW	5	36613785	missense	probably damaging	0.99
R7664:D5Ertd579e	UTSW	5	36614617	missense	probably benign	0.00
R7762:D5Ertd579e	UTSW	5	36613381	missense
R7951:D5Ertd579e	UTSW	5	36615173	missense	probably benign
R8175:D5Ertd579e	UTSW	5	36615470	missense	probably damaging	1.00
R8217:D5Ertd579e	UTSW	5	36614058	missense	probably benign	0.00
R8233:D5Ertd579e	UTSW	5	36615244	missense	probably damaging	0.99
R8281:D5Ertd579e	UTSW	5	36613320	missense
R8398:D5Ertd579e	UTSW	5	36614277	nonsense	probably null
R8673:D5Ertd579e	UTSW	5	36672807	missense	probably benign	0.03
R8771:D5Ertd579e	UTSW	5	36604596	missense	probably damaging	1.00
R8853:D5Ertd579e	UTSW	5	36629680	missense	probably damaging	0.99
R9106:D5Ertd579e	UTSW	5	36616338	missense	probably benign	0.39
R9121:D5Ertd579e	UTSW	5	36615434	missense	probably damaging	1.00
R9413:D5Ertd579e	UTSW	5	36614934	missense	probably damaging	1.00
R9569:D5Ertd579e	UTSW	5	36602635	missense	probably damaging	0.97
R9723:D5Ertd579e	UTSW	5	36614940	missense	probably damaging	0.99
RF022:D5Ertd579e	UTSW	5	36614662	missense	probably damaging	1.00
X0019:D5Ertd579e	UTSW	5	36613958	missense	probably damaging	1.00
Z1176:D5Ertd579e	UTSW	5	36615762	missense	probably benign	0.00
Z1189:D5Ertd579e	UTSW	5	36614906	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAGGACCTGAGTCTAAAACAATG -3'
(R):5'- TGCAGGGCTCCTTAAACTG -3'

Sequencing Primer
(F):5'- ATATTGAGTTCCAGGCCAGC -3'
(R):5'- CAGGGCTCCTTAAACTGGTTTTCTAG -3'

Posted On

2022-10-06