Incidental Mutation 'R9717:Wdr64'
ID 730500
Institutional Source Beutler Lab
Gene Symbol Wdr64
Ensembl Gene ENSMUSG00000026523
Gene Name WD repeat domain 64
Synonyms 4930415O10Rik, 4930511H01Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R9717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 175526159-175643300 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 175544854 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 96 (Y96H)
Ref Sequence ENSEMBL: ENSMUSP00000128678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094288] [ENSMUST00000171939] [ENSMUST00000194087]
AlphaFold Q9D565
Predicted Effect probably damaging
Transcript: ENSMUST00000094288
AA Change: Y96H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091846
Gene: ENSMUSG00000026523
AA Change: Y96H

DomainStartEndE-ValueType
WD40 118 159 2.65e1 SMART
WD40 162 200 2.13e1 SMART
low complexity region 259 271 N/A INTRINSIC
Blast:WD40 277 316 5e-19 BLAST
WD40 323 361 2.4e-1 SMART
WD40 365 404 8.29e-1 SMART
WD40 407 449 1.7e2 SMART
WD40 457 493 1.19e1 SMART
WD40 497 538 4.55e-3 SMART
WD40 643 684 3.31e0 SMART
WD40 742 806 7.4e0 SMART
Blast:WD40 811 851 7e-17 BLAST
WD40 864 903 4.62e-4 SMART
Blast:XPGN 921 964 9e-19 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000171939
AA Change: Y96H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128678
Gene: ENSMUSG00000026523
AA Change: Y96H

DomainStartEndE-ValueType
WD40 151 190 5.73e0 SMART
low complexity region 249 261 N/A INTRINSIC
Blast:WD40 267 306 4e-19 BLAST
WD40 313 351 2.4e-1 SMART
WD40 355 394 8.29e-1 SMART
WD40 397 439 1.7e2 SMART
WD40 447 483 1.19e1 SMART
WD40 487 528 4.55e-3 SMART
WD40 633 674 3.31e0 SMART
WD40 732 796 7.4e0 SMART
Blast:WD40 801 841 5e-17 BLAST
WD40 854 893 4.62e-4 SMART
Blast:XPGN 911 954 1e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000194087
AA Change: Y96H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141740
Gene: ENSMUSG00000026523
AA Change: Y96H

DomainStartEndE-ValueType
WD40 151 190 3.6e-2 SMART
low complexity region 249 261 N/A INTRINSIC
Blast:WD40 267 305 5e-19 BLAST
WD40 313 351 1.5e-3 SMART
WD40 355 394 5.2e-3 SMART
WD40 397 439 1.1e0 SMART
WD40 447 483 7.6e-2 SMART
WD40 487 528 2.9e-5 SMART
WD40 633 674 2.1e-2 SMART
WD40 732 796 4.7e-2 SMART
Blast:WD40 801 841 6e-17 BLAST
WD40 854 893 2.9e-6 SMART
Blast:XPGN 911 954 1e-18 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,668,900 (GRCm39) N2552I probably damaging Het
Amph G T 13: 19,309,253 (GRCm39) A444S probably benign Het
Ankrd52 A G 10: 128,216,457 (GRCm39) N157S probably benign Het
Arhgap29 T C 3: 121,797,920 (GRCm39) F537L probably benign Het
Asic1 A C 15: 99,590,657 (GRCm39) T136P probably damaging Het
Atg2b T C 12: 105,605,561 (GRCm39) Y1468C probably benign Het
Atm A G 9: 53,427,817 (GRCm39) L431P probably damaging Het
Atosb T C 4: 43,036,050 (GRCm39) H227R probably damaging Het
Btaf1 A G 19: 36,922,646 (GRCm39) T17A probably benign Het
Car10 A G 11: 93,195,367 (GRCm39) N58S probably benign Het
Cd79b A T 11: 106,202,845 (GRCm39) D252E probably damaging Het
Cdipt C T 7: 126,576,202 (GRCm39) probably benign Het
Cebpe T C 14: 54,949,165 (GRCm39) D84G probably damaging Het
Cenpj T C 14: 56,790,453 (GRCm39) E532G probably benign Het
Cherp A G 8: 73,216,920 (GRCm39) probably null Het
Chuk T C 19: 44,071,109 (GRCm39) D532G possibly damaging Het
Clec1b C T 6: 129,374,603 (GRCm39) T9I probably benign Het
Clspn G T 4: 126,458,756 (GRCm39) A280S possibly damaging Het
Cts3 T G 13: 61,712,799 (GRCm39) Y307S probably benign Het
Cyp2c39 T C 19: 39,556,493 (GRCm39) M443T possibly damaging Het
Dhx57 C T 17: 80,582,447 (GRCm39) R386H probably damaging Het
Dhx58 A T 11: 100,592,133 (GRCm39) M305K probably benign Het
Dlgap3 T C 4: 127,129,287 (GRCm39) L894P probably damaging Het
Dnah3 A T 7: 119,574,299 (GRCm39) N2164K probably damaging Het
Dnajb14 A G 3: 137,608,044 (GRCm39) N183S probably benign Het
Drd5 G T 5: 38,478,090 (GRCm39) R361L probably damaging Het
Duoxa1 T C 2: 122,135,622 (GRCm39) E159G probably damaging Het
Exoc1 T A 5: 76,711,079 (GRCm39) S659R probably benign Het
Fbln7 T C 2: 128,719,314 (GRCm39) I37T probably benign Het
Fcgrt T G 7: 44,744,853 (GRCm39) E205A possibly damaging Het
Fcho2 A T 13: 98,900,202 (GRCm39) S304T probably damaging Het
Gbp9 C A 5: 105,253,587 (GRCm39) G43* probably null Het
Gucy2d A G 7: 98,123,868 (GRCm39) K151R probably benign Het
Heatr4 T A 12: 84,024,829 (GRCm39) I331F probably damaging Het
Hmcn1 G A 1: 150,485,378 (GRCm39) T4408I probably damaging Het
Hoxc9 C T 15: 102,890,551 (GRCm39) T156M probably benign Het
Hrnr A T 3: 93,227,987 (GRCm39) E35V probably damaging Het
Idua C T 5: 108,818,037 (GRCm39) Q70* probably null Het
Klf5 A T 14: 99,539,189 (GRCm39) I201F probably damaging Het
Lonrf1 T C 8: 36,701,164 (GRCm39) K349E probably damaging Het
Lrp1b A T 2: 41,158,395 (GRCm39) D1721E Het
Mdh1 T A 11: 21,521,870 (GRCm39) probably benign Het
Mllt11 T C 3: 95,127,521 (GRCm39) H83R probably benign Het
Mrgprb4 A C 7: 47,848,583 (GRCm39) I115S possibly damaging Het
Mrpl38 A G 11: 116,023,296 (GRCm39) F319S probably damaging Het
Naif1 A T 2: 32,344,907 (GRCm39) M204L probably benign Het
Ncan T A 8: 70,554,628 (GRCm39) D1063V probably damaging Het
Noto A T 6: 85,401,327 (GRCm39) R119W possibly damaging Het
Or4c115 G A 2: 88,927,573 (GRCm39) L233F probably benign Het
Or51h7 A T 7: 102,591,165 (GRCm39) D206E probably damaging Het
Or6c69 T A 10: 129,748,048 (GRCm39) Y33F probably damaging Het
Or8b3 A T 9: 38,314,841 (GRCm39) I224F probably damaging Het
Ovch2 A G 7: 107,393,584 (GRCm39) W181R probably damaging Het
Palm G C 10: 79,655,117 (GRCm39) G292R probably damaging Het
Pdgfrb T A 18: 61,205,787 (GRCm39) L591* probably null Het
Pik3c2g T C 6: 139,841,910 (GRCm39) S772P Het
Prx C A 7: 27,217,411 (GRCm39) D776E probably benign Het
Ptpra A G 2: 130,384,366 (GRCm39) E562G possibly damaging Het
Rbm4b A G 19: 4,807,359 (GRCm39) Y25C probably damaging Het
Reln T C 5: 22,136,427 (GRCm39) T2534A probably benign Het
Rnf123 T C 9: 107,954,963 (GRCm39) S14G probably benign Het
Rock2 A G 12: 17,015,602 (GRCm39) H833R probably benign Het
Rxfp3 A G 15: 11,037,111 (GRCm39) V87A possibly damaging Het
S100b G A 10: 76,092,936 (GRCm39) G23D probably damaging Het
Scn9a T A 2: 66,357,002 (GRCm39) M1100L probably benign Het
Septin11 T A 5: 93,296,266 (GRCm39) S55T possibly damaging Het
Speer4a3 T C 5: 26,154,829 (GRCm39) E257G probably damaging Het
Sv2b T A 7: 74,769,676 (GRCm39) Q622L probably benign Het
Taar7a T C 10: 23,868,799 (GRCm39) D194G probably benign Het
Trappc3 T C 4: 126,169,014 (GRCm39) I168T probably benign Het
Trim27 T C 13: 21,374,296 (GRCm39) probably null Het
Wdr49 G A 3: 75,304,359 (GRCm39) T109I probably benign Het
Zfp219 A T 14: 52,247,049 (GRCm39) L26Q probably damaging Het
Zfp758 T A 17: 22,593,829 (GRCm39) V105D possibly damaging Het
Zfp975 C G 7: 42,312,332 (GRCm39) E94Q possibly damaging Het
Zfyve9 C T 4: 108,539,334 (GRCm39) A289T probably benign Het
Zscan5b T C 7: 6,234,525 (GRCm39) S184P possibly damaging Het
Other mutations in Wdr64
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Wdr64 APN 1 175,526,366 (GRCm39) missense probably benign 0.00
IGL00902:Wdr64 APN 1 175,556,391 (GRCm39) missense probably damaging 1.00
IGL01347:Wdr64 APN 1 175,547,899 (GRCm39) missense probably benign 0.12
IGL01353:Wdr64 APN 1 175,559,151 (GRCm39) missense probably damaging 0.96
IGL01583:Wdr64 APN 1 175,594,722 (GRCm39) critical splice donor site probably null
IGL01643:Wdr64 APN 1 175,599,877 (GRCm39) missense probably damaging 1.00
IGL01673:Wdr64 APN 1 175,627,922 (GRCm39) missense possibly damaging 0.68
IGL01992:Wdr64 APN 1 175,533,637 (GRCm39) missense probably damaging 1.00
IGL02613:Wdr64 APN 1 175,594,613 (GRCm39) nonsense probably null
IGL02834:Wdr64 APN 1 175,633,415 (GRCm39) splice site probably benign
IGL03214:Wdr64 APN 1 175,571,201 (GRCm39) splice site probably benign
IGL03305:Wdr64 APN 1 175,583,152 (GRCm39) missense possibly damaging 0.94
IGL03308:Wdr64 APN 1 175,594,562 (GRCm39) unclassified probably benign
PIT4418001:Wdr64 UTSW 1 175,571,160 (GRCm39) nonsense probably null
R0036:Wdr64 UTSW 1 175,556,496 (GRCm39) nonsense probably null
R0041:Wdr64 UTSW 1 175,554,037 (GRCm39) nonsense probably null
R0041:Wdr64 UTSW 1 175,554,037 (GRCm39) nonsense probably null
R0079:Wdr64 UTSW 1 175,622,668 (GRCm39) missense probably benign 0.02
R0380:Wdr64 UTSW 1 175,597,208 (GRCm39) splice site probably benign
R0486:Wdr64 UTSW 1 175,622,769 (GRCm39) splice site probably benign
R0520:Wdr64 UTSW 1 175,553,958 (GRCm39) missense probably damaging 1.00
R0598:Wdr64 UTSW 1 175,633,465 (GRCm39) missense probably damaging 1.00
R0711:Wdr64 UTSW 1 175,599,751 (GRCm39) missense probably benign 0.39
R0746:Wdr64 UTSW 1 175,620,539 (GRCm39) missense possibly damaging 0.92
R0927:Wdr64 UTSW 1 175,620,647 (GRCm39) missense probably damaging 0.97
R0947:Wdr64 UTSW 1 175,603,315 (GRCm39) missense probably benign
R1014:Wdr64 UTSW 1 175,583,192 (GRCm39) missense probably damaging 1.00
R1332:Wdr64 UTSW 1 175,622,706 (GRCm39) missense possibly damaging 0.82
R1416:Wdr64 UTSW 1 175,633,568 (GRCm39) missense probably benign 0.01
R1421:Wdr64 UTSW 1 175,594,716 (GRCm39) missense possibly damaging 0.85
R1467:Wdr64 UTSW 1 175,603,288 (GRCm39) missense probably benign 0.00
R1467:Wdr64 UTSW 1 175,603,288 (GRCm39) missense probably benign 0.00
R1796:Wdr64 UTSW 1 175,544,897 (GRCm39) missense probably damaging 1.00
R1797:Wdr64 UTSW 1 175,639,585 (GRCm39) missense probably damaging 1.00
R2145:Wdr64 UTSW 1 175,594,661 (GRCm39) missense probably benign 0.01
R2321:Wdr64 UTSW 1 175,622,653 (GRCm39) missense possibly damaging 0.57
R2449:Wdr64 UTSW 1 175,526,479 (GRCm39) missense probably benign
R4049:Wdr64 UTSW 1 175,633,422 (GRCm39) missense probably benign 0.21
R4155:Wdr64 UTSW 1 175,597,172 (GRCm39) missense probably benign 0.03
R4624:Wdr64 UTSW 1 175,599,829 (GRCm39) missense probably benign
R4661:Wdr64 UTSW 1 175,554,060 (GRCm39) missense probably damaging 1.00
R4711:Wdr64 UTSW 1 175,626,795 (GRCm39) missense probably damaging 1.00
R4891:Wdr64 UTSW 1 175,526,345 (GRCm39) unclassified probably benign
R4925:Wdr64 UTSW 1 175,552,268 (GRCm39) splice site probably null
R4943:Wdr64 UTSW 1 175,547,882 (GRCm39) missense probably benign 0.01
R5000:Wdr64 UTSW 1 175,553,941 (GRCm39) splice site probably null
R5001:Wdr64 UTSW 1 175,620,525 (GRCm39) critical splice acceptor site probably null
R5143:Wdr64 UTSW 1 175,553,979 (GRCm39) missense probably damaging 1.00
R5395:Wdr64 UTSW 1 175,583,164 (GRCm39) missense probably damaging 1.00
R5813:Wdr64 UTSW 1 175,639,623 (GRCm39) missense possibly damaging 0.89
R6014:Wdr64 UTSW 1 175,633,556 (GRCm39) missense possibly damaging 0.56
R6417:Wdr64 UTSW 1 175,553,956 (GRCm39) missense probably damaging 1.00
R6456:Wdr64 UTSW 1 175,613,175 (GRCm39) critical splice donor site probably null
R6555:Wdr64 UTSW 1 175,547,856 (GRCm39) missense probably damaging 1.00
R6576:Wdr64 UTSW 1 175,633,494 (GRCm39) missense possibly damaging 0.82
R6797:Wdr64 UTSW 1 175,638,176 (GRCm39) critical splice donor site probably null
R6891:Wdr64 UTSW 1 175,533,634 (GRCm39) missense probably damaging 1.00
R6959:Wdr64 UTSW 1 175,533,555 (GRCm39) missense probably damaging 1.00
R7205:Wdr64 UTSW 1 175,617,499 (GRCm39) missense probably benign 0.34
R7252:Wdr64 UTSW 1 175,603,240 (GRCm39) missense probably benign 0.00
R7552:Wdr64 UTSW 1 175,613,147 (GRCm39) missense possibly damaging 0.71
R7732:Wdr64 UTSW 1 175,617,495 (GRCm39) missense probably benign
R7777:Wdr64 UTSW 1 175,617,564 (GRCm39) missense possibly damaging 0.71
R7780:Wdr64 UTSW 1 175,556,542 (GRCm39) missense probably damaging 1.00
R7810:Wdr64 UTSW 1 175,559,092 (GRCm39) missense probably benign 0.01
R7833:Wdr64 UTSW 1 175,591,511 (GRCm39) missense probably damaging 1.00
R7843:Wdr64 UTSW 1 175,639,668 (GRCm39) missense probably benign 0.00
R7887:Wdr64 UTSW 1 175,613,111 (GRCm39) missense not run
R7991:Wdr64 UTSW 1 175,554,051 (GRCm39) missense probably benign 0.36
R8124:Wdr64 UTSW 1 175,626,844 (GRCm39) splice site probably null
R8129:Wdr64 UTSW 1 175,603,154 (GRCm39) missense probably damaging 0.96
R8673:Wdr64 UTSW 1 175,633,584 (GRCm39) missense probably damaging 1.00
R8728:Wdr64 UTSW 1 175,559,079 (GRCm39) missense probably benign 0.01
R8786:Wdr64 UTSW 1 175,636,327 (GRCm39) nonsense probably null
R8822:Wdr64 UTSW 1 175,544,920 (GRCm39) missense probably damaging 1.00
R8842:Wdr64 UTSW 1 175,599,893 (GRCm39) missense probably benign 0.02
R8887:Wdr64 UTSW 1 175,599,850 (GRCm39) missense probably benign 0.17
R9014:Wdr64 UTSW 1 175,526,395 (GRCm39) missense probably benign
R9330:Wdr64 UTSW 1 175,554,024 (GRCm39) missense possibly damaging 0.93
R9332:Wdr64 UTSW 1 175,599,871 (GRCm39) missense possibly damaging 0.71
R9465:Wdr64 UTSW 1 175,618,823 (GRCm39) missense possibly damaging 0.53
R9716:Wdr64 UTSW 1 175,622,658 (GRCm39) missense probably benign
Z1088:Wdr64 UTSW 1 175,533,551 (GRCm39) missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TTGGTGCGTGATGACTCCTC -3'
(R):5'- CTTTAGAAATAGTGTGTTCCCAGTG -3'

Sequencing Primer
(F):5'- GGAAAAGTGTCAATGTCTCCTCTGC -3'
(R):5'- AGAAATAGTGTGTTCCCAGTGCTCAG -3'
Posted On 2022-10-06