Incidental Mutation 'R9717:Lrp1b'
ID 730502
Institutional Source Beutler Lab
Gene Symbol Lrp1b
Ensembl Gene ENSMUSG00000049252
Gene Name low density lipoprotein-related protein 1B
Synonyms 9630004P12Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 40485258-42543636 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 41158395 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1721 (D1721E)
Ref Sequence ENSEMBL: ENSMUSP00000054275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052550] [ENSMUST00000167270]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000054275
Gene: ENSMUSG00000049252
AA Change: D1721E

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 35 46 N/A INTRINSIC
LDLa 62 102 2.97e-12 SMART
LDLa 107 146 1.31e-8 SMART
EGF 150 185 1.95e1 SMART
EGF_CA 186 225 8.37e-8 SMART
LY 256 300 4.06e1 SMART
LY 304 348 1.15e-5 SMART
LY 349 392 1.17e-11 SMART
LY 393 435 1.12e-8 SMART
LY 436 478 2.21e1 SMART
EGF 505 548 2.45e0 SMART
LY 579 621 1.32e-5 SMART
LY 622 665 1.88e-10 SMART
LY 668 717 1.47e-12 SMART
LY 718 760 5.78e-11 SMART
LY 761 802 1.45e0 SMART
EGF_like 828 865 4.55e1 SMART
LDLa 875 914 7.15e-15 SMART
LDLa 916 955 5.26e-13 SMART
LDLa 957 995 6.13e-14 SMART
LDLa 997 1035 6.47e-13 SMART
LDLa 1036 1075 1.76e-14 SMART
LDLa 1083 1121 2.29e-13 SMART
LDLa 1125 1164 3.36e-11 SMART
LDLa 1166 1206 2.57e-7 SMART
EGF 1206 1244 1.58e-3 SMART
EGF 1248 1284 4.56e0 SMART
LY 1311 1353 4.85e-4 SMART
LY 1358 1400 6.49e-14 SMART
LY 1401 1445 8.18e-11 SMART
LY 1446 1490 4.25e-9 SMART
LY 1492 1534 5.4e-2 SMART
EGF 1561 1601 9.41e-2 SMART
LY 1629 1671 3.03e-5 SMART
LY 1672 1716 1.22e-9 SMART
LY 1718 1756 1.02e-2 SMART
LY 1757 1798 8.25e-7 SMART
EGF 1868 1906 4.03e-1 SMART
LY 1933 1975 1.01e-1 SMART
LY 1976 2018 3.03e-14 SMART
LY 2019 2062 2.16e-10 SMART
LY 2063 2105 4.09e-11 SMART
LY 2107 2149 9.96e0 SMART
EGF 2177 2214 2.13e0 SMART
LY 2292 2334 6.96e-5 SMART
LY 2340 2385 1.07e-5 SMART
LY 2386 2428 1.1e-11 SMART
LY 2429 2470 4.78e-3 SMART
EGF 2498 2535 2.03e1 SMART
LDLa 2540 2580 1.1e-6 SMART
LDLa 2582 2619 1.72e-8 SMART
LDLa 2621 2658 2.45e-13 SMART
LDLa 2669 2707 6.53e-9 SMART
LDLa 2712 2749 7.97e-13 SMART
LDLa 2750 2789 1.22e-8 SMART
LDLa 2791 2832 3.07e-14 SMART
LDLa 2835 2873 7.32e-12 SMART
LDLa 2875 2917 1.85e-8 SMART
LDLa 2921 2958 4.76e-11 SMART
EGF_CA 2957 2998 1.79e-7 SMART
EGF_CA 2999 3039 1.85e-9 SMART
LY 3066 3111 2.58e-8 SMART
LY 3112 3152 1.22e-9 SMART
LY 3153 3196 8.84e-7 SMART
LY 3197 3237 3.22e-9 SMART
LY 3238 3279 1.04e-3 SMART
EGF 3307 3345 7.13e-2 SMART
LDLa 3347 3385 9.29e-14 SMART
LDLa 3387 3424 2.25e-12 SMART
LDLa 3426 3464 5.63e-13 SMART
LDLa 3466 3504 1.07e-13 SMART
LDLa 3506 3543 1.35e-15 SMART
EGF_like 3545 3581 2.8e1 SMART
LDLa 3545 3582 1.49e-12 SMART
LDLa 3583 3620 4.21e-12 SMART
LDLa 3624 3661 4.9e-13 SMART
LDLa 3662 3700 9.58e-16 SMART
LDLa 3704 3743 5.38e-10 SMART
LDLa 3745 3784 1.42e-9 SMART
LDLa 3792 3829 3.66e-12 SMART
EGF 3835 3874 3.71e0 SMART
EGF_CA 3875 3912 6.8e-8 SMART
LY 3987 4033 4.24e0 SMART
LY 4050 4093 4.46e-3 SMART
LY 4094 4136 1.73e-9 SMART
EGF 4206 4239 2.45e0 SMART
EGF 4247 4280 2.48e-1 SMART
EGF 4283 4316 1.49e-4 SMART
EGF 4319 4352 1.69e-3 SMART
EGF 4355 4388 1.18e1 SMART
EGF_like 4391 4423 6.67e1 SMART
EGF 4424 4458 1.61e0 SMART
transmembrane domain 4476 4498 N/A INTRINSIC
low complexity region 4499 4509 N/A INTRINSIC
low complexity region 4512 4523 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167270
AA Change: D1607E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129192
Gene: ENSMUSG00000049252
AA Change: D1607E

DomainStartEndE-ValueType
EGF 5 40 1.95e1 SMART
EGF_CA 41 80 8.37e-8 SMART
LY 111 155 4.06e1 SMART
LY 159 203 1.15e-5 SMART
LY 204 247 1.17e-11 SMART
LY 248 290 1.12e-8 SMART
LY 291 333 2.21e1 SMART
EGF 360 403 2.45e0 SMART
LY 434 476 1.32e-5 SMART
LY 477 520 1.88e-10 SMART
LY 523 572 1.47e-12 SMART
LY 573 615 5.78e-11 SMART
LY 616 657 1.45e0 SMART
EGF_like 683 720 4.55e1 SMART
LDLa 730 769 7.15e-15 SMART
LDLa 771 810 5.26e-13 SMART
LDLa 812 850 6.13e-14 SMART
LDLa 852 890 6.47e-13 SMART
LDLa 891 930 1.76e-14 SMART
LDLa 938 976 2.29e-13 SMART
LDLa 980 1019 3.36e-11 SMART
LDLa 1021 1061 2.57e-7 SMART
EGF 1061 1099 1.58e-3 SMART
EGF 1103 1139 4.56e0 SMART
LY 1166 1208 4.85e-4 SMART
LY 1213 1255 6.49e-14 SMART
LY 1256 1300 8.18e-11 SMART
LY 1301 1345 4.25e-9 SMART
LY 1347 1389 5.4e-2 SMART
EGF 1416 1456 9.41e-2 SMART
LY 1484 1526 3.03e-5 SMART
LY 1527 1571 1.22e-9 SMART
LY 1573 1611 1.02e-2 SMART
LY 1612 1653 8.25e-7 SMART
EGF 1723 1761 4.03e-1 SMART
LY 1788 1830 1.01e-1 SMART
LY 1831 1873 3.03e-14 SMART
LY 1874 1917 2.16e-10 SMART
LY 1918 1960 4.09e-11 SMART
LY 1962 2004 9.96e0 SMART
EGF 2032 2069 2.13e0 SMART
LY 2147 2189 6.96e-5 SMART
LY 2195 2240 1.07e-5 SMART
LY 2241 2283 1.1e-11 SMART
LY 2284 2325 4.78e-3 SMART
EGF 2353 2390 2.03e1 SMART
LDLa 2395 2435 1.1e-6 SMART
LDLa 2437 2474 1.72e-8 SMART
LDLa 2476 2513 2.45e-13 SMART
LDLa 2524 2562 6.53e-9 SMART
LDLa 2567 2604 7.97e-13 SMART
LDLa 2605 2644 1.22e-8 SMART
LDLa 2646 2687 3.07e-14 SMART
LDLa 2690 2728 7.32e-12 SMART
LDLa 2730 2772 1.85e-8 SMART
LDLa 2776 2813 4.76e-11 SMART
EGF_CA 2812 2853 1.79e-7 SMART
EGF_CA 2854 2894 1.85e-9 SMART
LY 2921 2966 2.58e-8 SMART
LY 2967 3007 1.22e-9 SMART
LY 3008 3051 8.84e-7 SMART
LY 3052 3092 3.22e-9 SMART
LY 3093 3134 1.04e-3 SMART
EGF 3162 3200 7.13e-2 SMART
LDLa 3202 3240 9.29e-14 SMART
LDLa 3242 3279 2.25e-12 SMART
LDLa 3281 3319 5.63e-13 SMART
LDLa 3321 3357 5.86e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein (LDL) receptor family. These receptors play a wide variety of roles in normal cell function and development due to their interactions with multiple ligands. Disruption of this gene has been reported in several types of cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygous null mice appear normal, are fertile, have normal brain histology and function, normal plasma cholesterol and fasting triglycerides, and do not develop tumors. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(3) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,668,900 (GRCm39) N2552I probably damaging Het
Amph G T 13: 19,309,253 (GRCm39) A444S probably benign Het
Ankrd52 A G 10: 128,216,457 (GRCm39) N157S probably benign Het
Arhgap29 T C 3: 121,797,920 (GRCm39) F537L probably benign Het
Asic1 A C 15: 99,590,657 (GRCm39) T136P probably damaging Het
Atg2b T C 12: 105,605,561 (GRCm39) Y1468C probably benign Het
Atm A G 9: 53,427,817 (GRCm39) L431P probably damaging Het
Atosb T C 4: 43,036,050 (GRCm39) H227R probably damaging Het
Btaf1 A G 19: 36,922,646 (GRCm39) T17A probably benign Het
Car10 A G 11: 93,195,367 (GRCm39) N58S probably benign Het
Cd79b A T 11: 106,202,845 (GRCm39) D252E probably damaging Het
Cdipt C T 7: 126,576,202 (GRCm39) probably benign Het
Cebpe T C 14: 54,949,165 (GRCm39) D84G probably damaging Het
Cenpj T C 14: 56,790,453 (GRCm39) E532G probably benign Het
Cherp A G 8: 73,216,920 (GRCm39) probably null Het
Chuk T C 19: 44,071,109 (GRCm39) D532G possibly damaging Het
Clec1b C T 6: 129,374,603 (GRCm39) T9I probably benign Het
Clspn G T 4: 126,458,756 (GRCm39) A280S possibly damaging Het
Cts3 T G 13: 61,712,799 (GRCm39) Y307S probably benign Het
Cyp2c39 T C 19: 39,556,493 (GRCm39) M443T possibly damaging Het
Dhx57 C T 17: 80,582,447 (GRCm39) R386H probably damaging Het
Dhx58 A T 11: 100,592,133 (GRCm39) M305K probably benign Het
Dlgap3 T C 4: 127,129,287 (GRCm39) L894P probably damaging Het
Dnah3 A T 7: 119,574,299 (GRCm39) N2164K probably damaging Het
Dnajb14 A G 3: 137,608,044 (GRCm39) N183S probably benign Het
Drd5 G T 5: 38,478,090 (GRCm39) R361L probably damaging Het
Duoxa1 T C 2: 122,135,622 (GRCm39) E159G probably damaging Het
Exoc1 T A 5: 76,711,079 (GRCm39) S659R probably benign Het
Fbln7 T C 2: 128,719,314 (GRCm39) I37T probably benign Het
Fcgrt T G 7: 44,744,853 (GRCm39) E205A possibly damaging Het
Fcho2 A T 13: 98,900,202 (GRCm39) S304T probably damaging Het
Gbp9 C A 5: 105,253,587 (GRCm39) G43* probably null Het
Gucy2d A G 7: 98,123,868 (GRCm39) K151R probably benign Het
Heatr4 T A 12: 84,024,829 (GRCm39) I331F probably damaging Het
Hmcn1 G A 1: 150,485,378 (GRCm39) T4408I probably damaging Het
Hoxc9 C T 15: 102,890,551 (GRCm39) T156M probably benign Het
Hrnr A T 3: 93,227,987 (GRCm39) E35V probably damaging Het
Idua C T 5: 108,818,037 (GRCm39) Q70* probably null Het
Klf5 A T 14: 99,539,189 (GRCm39) I201F probably damaging Het
Lonrf1 T C 8: 36,701,164 (GRCm39) K349E probably damaging Het
Mdh1 T A 11: 21,521,870 (GRCm39) probably benign Het
Mllt11 T C 3: 95,127,521 (GRCm39) H83R probably benign Het
Mrgprb4 A C 7: 47,848,583 (GRCm39) I115S possibly damaging Het
Mrpl38 A G 11: 116,023,296 (GRCm39) F319S probably damaging Het
Naif1 A T 2: 32,344,907 (GRCm39) M204L probably benign Het
Ncan T A 8: 70,554,628 (GRCm39) D1063V probably damaging Het
Noto A T 6: 85,401,327 (GRCm39) R119W possibly damaging Het
Or4c115 G A 2: 88,927,573 (GRCm39) L233F probably benign Het
Or51h7 A T 7: 102,591,165 (GRCm39) D206E probably damaging Het
Or6c69 T A 10: 129,748,048 (GRCm39) Y33F probably damaging Het
Or8b3 A T 9: 38,314,841 (GRCm39) I224F probably damaging Het
Ovch2 A G 7: 107,393,584 (GRCm39) W181R probably damaging Het
Palm G C 10: 79,655,117 (GRCm39) G292R probably damaging Het
Pdgfrb T A 18: 61,205,787 (GRCm39) L591* probably null Het
Pik3c2g T C 6: 139,841,910 (GRCm39) S772P Het
Prx C A 7: 27,217,411 (GRCm39) D776E probably benign Het
Ptpra A G 2: 130,384,366 (GRCm39) E562G possibly damaging Het
Rbm4b A G 19: 4,807,359 (GRCm39) Y25C probably damaging Het
Reln T C 5: 22,136,427 (GRCm39) T2534A probably benign Het
Rnf123 T C 9: 107,954,963 (GRCm39) S14G probably benign Het
Rock2 A G 12: 17,015,602 (GRCm39) H833R probably benign Het
Rxfp3 A G 15: 11,037,111 (GRCm39) V87A possibly damaging Het
S100b G A 10: 76,092,936 (GRCm39) G23D probably damaging Het
Scn9a T A 2: 66,357,002 (GRCm39) M1100L probably benign Het
Septin11 T A 5: 93,296,266 (GRCm39) S55T possibly damaging Het
Speer4a3 T C 5: 26,154,829 (GRCm39) E257G probably damaging Het
Sv2b T A 7: 74,769,676 (GRCm39) Q622L probably benign Het
Taar7a T C 10: 23,868,799 (GRCm39) D194G probably benign Het
Trappc3 T C 4: 126,169,014 (GRCm39) I168T probably benign Het
Trim27 T C 13: 21,374,296 (GRCm39) probably null Het
Wdr49 G A 3: 75,304,359 (GRCm39) T109I probably benign Het
Wdr64 T C 1: 175,544,854 (GRCm39) Y96H probably damaging Het
Zfp219 A T 14: 52,247,049 (GRCm39) L26Q probably damaging Het
Zfp758 T A 17: 22,593,829 (GRCm39) V105D possibly damaging Het
Zfp975 C G 7: 42,312,332 (GRCm39) E94Q possibly damaging Het
Zfyve9 C T 4: 108,539,334 (GRCm39) A289T probably benign Het
Zscan5b T C 7: 6,234,525 (GRCm39) S184P possibly damaging Het
Other mutations in Lrp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Lrp1b APN 2 41,000,873 (GRCm39) missense probably damaging 1.00
IGL00543:Lrp1b APN 2 41,358,960 (GRCm39) missense possibly damaging 0.69
IGL00578:Lrp1b APN 2 40,569,185 (GRCm39) missense unknown
IGL01020:Lrp1b APN 2 40,888,259 (GRCm39) missense probably damaging 1.00
IGL01092:Lrp1b APN 2 40,640,959 (GRCm39) missense probably damaging 0.97
IGL01155:Lrp1b APN 2 41,660,947 (GRCm39) missense probably benign 0.17
IGL01361:Lrp1b APN 2 41,000,763 (GRCm39) splice site probably benign
IGL01377:Lrp1b APN 2 40,491,550 (GRCm39) missense probably damaging 1.00
IGL01459:Lrp1b APN 2 40,750,726 (GRCm39) missense probably damaging 0.97
IGL01473:Lrp1b APN 2 40,501,498 (GRCm39) missense probably damaging 0.97
IGL01528:Lrp1b APN 2 40,809,194 (GRCm39) missense probably damaging 0.99
IGL01536:Lrp1b APN 2 41,000,895 (GRCm39) missense probably benign 0.01
IGL01564:Lrp1b APN 2 40,567,498 (GRCm39) splice site probably benign
IGL01747:Lrp1b APN 2 40,750,697 (GRCm39) missense probably damaging 1.00
IGL01764:Lrp1b APN 2 40,587,454 (GRCm39) missense unknown
IGL01783:Lrp1b APN 2 41,202,584 (GRCm39) missense probably damaging 1.00
IGL01802:Lrp1b APN 2 41,401,494 (GRCm39) missense probably benign 0.07
IGL01826:Lrp1b APN 2 41,339,246 (GRCm39) missense probably damaging 1.00
IGL01884:Lrp1b APN 2 41,174,225 (GRCm39) nonsense probably null
IGL01908:Lrp1b APN 2 40,592,816 (GRCm39) missense probably benign
IGL01935:Lrp1b APN 2 41,158,367 (GRCm39) missense probably damaging 1.00
IGL01959:Lrp1b APN 2 41,202,539 (GRCm39) missense probably damaging 0.99
IGL02010:Lrp1b APN 2 41,358,954 (GRCm39) missense probably damaging 1.00
IGL02022:Lrp1b APN 2 41,172,172 (GRCm39) missense probably damaging 1.00
IGL02028:Lrp1b APN 2 41,401,464 (GRCm39) missense probably damaging 1.00
IGL02034:Lrp1b APN 2 41,158,382 (GRCm39) nonsense probably null
IGL02043:Lrp1b APN 2 40,587,537 (GRCm39) missense probably null 0.44
IGL02066:Lrp1b APN 2 41,001,091 (GRCm39) nonsense probably null
IGL02085:Lrp1b APN 2 40,779,321 (GRCm39) missense probably benign
IGL02137:Lrp1b APN 2 40,620,700 (GRCm39) splice site probably benign
IGL02218:Lrp1b APN 2 41,185,684 (GRCm39) missense probably benign 0.11
IGL02409:Lrp1b APN 2 41,335,208 (GRCm39) missense possibly damaging 0.93
IGL02513:Lrp1b APN 2 41,000,765 (GRCm39) critical splice donor site probably null
IGL02543:Lrp1b APN 2 40,760,413 (GRCm39) missense possibly damaging 0.89
IGL02701:Lrp1b APN 2 41,136,029 (GRCm39) missense possibly damaging 0.50
IGL02728:Lrp1b APN 2 40,691,410 (GRCm39) missense probably benign 0.03
IGL02739:Lrp1b APN 2 41,388,227 (GRCm39) missense probably damaging 1.00
IGL02748:Lrp1b APN 2 40,592,761 (GRCm39) missense probably damaging 0.99
IGL02754:Lrp1b APN 2 40,592,806 (GRCm39) missense probably benign 0.02
IGL02797:Lrp1b APN 2 41,561,069 (GRCm39) missense
IGL02813:Lrp1b APN 2 40,569,229 (GRCm39) critical splice acceptor site probably null
IGL02831:Lrp1b APN 2 41,083,603 (GRCm39) missense probably damaging 1.00
IGL02869:Lrp1b APN 2 40,591,842 (GRCm39) missense unknown
IGL02946:Lrp1b APN 2 41,202,571 (GRCm39) missense probably damaging 1.00
IGL02952:Lrp1b APN 2 41,396,715 (GRCm39) missense probably benign 0.33
IGL02958:Lrp1b APN 2 41,192,928 (GRCm39) missense probably damaging 1.00
IGL02977:Lrp1b APN 2 40,620,747 (GRCm39) missense probably damaging 1.00
IGL03001:Lrp1b APN 2 40,817,901 (GRCm39) missense probably damaging 1.00
IGL03010:Lrp1b APN 2 42,213,618 (GRCm39) missense possibly damaging 0.94
IGL03060:Lrp1b APN 2 40,527,765 (GRCm39) missense probably benign 0.04
IGL03129:Lrp1b APN 2 41,202,478 (GRCm39) splice site probably benign
IGL03166:Lrp1b APN 2 41,001,050 (GRCm39) missense probably damaging 1.00
IGL03170:Lrp1b APN 2 40,587,456 (GRCm39) missense unknown
IGL03195:Lrp1b APN 2 41,361,134 (GRCm39) missense possibly damaging 0.95
IGL03224:Lrp1b APN 2 41,361,043 (GRCm39) missense possibly damaging 0.92
IGL03251:Lrp1b APN 2 40,490,279 (GRCm39) missense probably benign 0.20
IGL03281:Lrp1b APN 2 40,615,526 (GRCm39) missense probably benign 0.01
IGL03295:Lrp1b APN 2 40,568,999 (GRCm39) splice site probably null
IGL03340:Lrp1b APN 2 41,358,981 (GRCm39) missense probably damaging 0.97
IGL03391:Lrp1b APN 2 41,185,653 (GRCm39) missense possibly damaging 0.95
IGL03401:Lrp1b APN 2 41,000,790 (GRCm39) missense probably benign 0.18
IGL03403:Lrp1b APN 2 40,592,836 (GRCm39) missense probably benign 0.16
IGL03408:Lrp1b APN 2 40,748,594 (GRCm39) missense probably damaging 0.97
Fetching UTSW 2 40,769,567 (GRCm39) missense probably benign 0.00
Heiden UTSW 2 40,527,787 (GRCm39) missense probably benign 0.00
hither UTSW 2 40,592,860 (GRCm39) missense probably benign 0.00
Roeslein UTSW 2 40,615,919 (GRCm39) missense probably damaging 1.00
I2288:Lrp1b UTSW 2 41,012,944 (GRCm39) missense probably damaging 0.99
I2289:Lrp1b UTSW 2 41,012,944 (GRCm39) missense probably damaging 0.99
LCD18:Lrp1b UTSW 2 42,127,574 (GRCm39) intron probably benign
PIT4431001:Lrp1b UTSW 2 40,894,767 (GRCm39) missense
PIT4585001:Lrp1b UTSW 2 41,159,216 (GRCm39) missense
R0022:Lrp1b UTSW 2 40,888,050 (GRCm39) splice site probably benign
R0022:Lrp1b UTSW 2 40,888,050 (GRCm39) splice site probably benign
R0054:Lrp1b UTSW 2 40,632,829 (GRCm39) missense probably benign 0.11
R0054:Lrp1b UTSW 2 40,632,829 (GRCm39) missense probably benign 0.11
R0094:Lrp1b UTSW 2 41,172,042 (GRCm39) unclassified probably benign
R0102:Lrp1b UTSW 2 41,298,997 (GRCm39) splice site probably benign
R0123:Lrp1b UTSW 2 40,486,995 (GRCm39) missense probably damaging 1.00
R0128:Lrp1b UTSW 2 41,401,520 (GRCm39) missense probably damaging 1.00
R0130:Lrp1b UTSW 2 41,401,520 (GRCm39) missense probably damaging 1.00
R0134:Lrp1b UTSW 2 40,486,995 (GRCm39) missense probably damaging 1.00
R0135:Lrp1b UTSW 2 41,159,251 (GRCm39) missense probably damaging 0.99
R0153:Lrp1b UTSW 2 41,013,031 (GRCm39) missense possibly damaging 0.92
R0178:Lrp1b UTSW 2 40,615,919 (GRCm39) missense probably damaging 1.00
R0225:Lrp1b UTSW 2 40,486,995 (GRCm39) missense probably damaging 1.00
R0242:Lrp1b UTSW 2 40,888,195 (GRCm39) missense probably benign 0.01
R0242:Lrp1b UTSW 2 40,888,195 (GRCm39) missense probably benign 0.01
R0312:Lrp1b UTSW 2 41,172,183 (GRCm39) missense probably damaging 1.00
R0325:Lrp1b UTSW 2 40,741,723 (GRCm39) missense probably damaging 1.00
R0330:Lrp1b UTSW 2 40,591,773 (GRCm39) nonsense probably null
R0372:Lrp1b UTSW 2 40,620,810 (GRCm39) missense probably benign 0.30
R0400:Lrp1b UTSW 2 40,640,926 (GRCm39) missense probably benign 0.40
R0408:Lrp1b UTSW 2 40,567,603 (GRCm39) missense probably damaging 1.00
R0498:Lrp1b UTSW 2 41,348,417 (GRCm39) missense probably benign 0.19
R0563:Lrp1b UTSW 2 40,640,926 (GRCm39) missense probably benign 0.40
R0569:Lrp1b UTSW 2 40,779,251 (GRCm39) missense probably benign 0.11
R0622:Lrp1b UTSW 2 41,618,563 (GRCm39) critical splice donor site probably null
R0682:Lrp1b UTSW 2 41,185,653 (GRCm39) missense probably benign 0.01
R0727:Lrp1b UTSW 2 40,640,956 (GRCm39) missense probably benign 0.40
R0747:Lrp1b UTSW 2 40,760,353 (GRCm39) missense probably damaging 1.00
R0761:Lrp1b UTSW 2 41,075,947 (GRCm39) missense probably damaging 0.99
R0905:Lrp1b UTSW 2 41,174,197 (GRCm39) missense probably damaging 1.00
R0959:Lrp1b UTSW 2 41,158,366 (GRCm39) missense possibly damaging 0.83
R1124:Lrp1b UTSW 2 40,765,063 (GRCm39) missense probably damaging 1.00
R1158:Lrp1b UTSW 2 40,567,506 (GRCm39) missense unknown
R1265:Lrp1b UTSW 2 41,366,666 (GRCm39) missense probably damaging 1.00
R1276:Lrp1b UTSW 2 41,618,588 (GRCm39) missense probably benign 0.35
R1277:Lrp1b UTSW 2 40,615,957 (GRCm39) missense probably benign
R1282:Lrp1b UTSW 2 40,750,773 (GRCm39) missense probably damaging 1.00
R1291:Lrp1b UTSW 2 41,231,907 (GRCm39) missense probably benign 0.05
R1316:Lrp1b UTSW 2 40,592,816 (GRCm39) missense probably benign
R1340:Lrp1b UTSW 2 40,592,806 (GRCm39) missense probably benign 0.02
R1371:Lrp1b UTSW 2 40,537,165 (GRCm39) missense probably damaging 1.00
R1415:Lrp1b UTSW 2 40,519,676 (GRCm39) missense probably damaging 1.00
R1416:Lrp1b UTSW 2 40,888,228 (GRCm39) missense probably damaging 1.00
R1417:Lrp1b UTSW 2 40,894,653 (GRCm39) missense probably benign 0.14
R1465:Lrp1b UTSW 2 41,001,071 (GRCm39) missense probably benign 0.00
R1465:Lrp1b UTSW 2 41,001,071 (GRCm39) missense probably benign 0.00
R1467:Lrp1b UTSW 2 40,547,368 (GRCm39) splice site probably benign
R1468:Lrp1b UTSW 2 40,817,841 (GRCm39) critical splice donor site probably null
R1468:Lrp1b UTSW 2 40,817,841 (GRCm39) critical splice donor site probably null
R1480:Lrp1b UTSW 2 40,793,401 (GRCm39) missense probably damaging 1.00
R1488:Lrp1b UTSW 2 41,392,036 (GRCm39) missense probably benign 0.01
R1496:Lrp1b UTSW 2 42,213,674 (GRCm39) missense probably damaging 0.98
R1542:Lrp1b UTSW 2 41,013,724 (GRCm39) missense probably damaging 1.00
R1571:Lrp1b UTSW 2 41,366,658 (GRCm39) missense probably damaging 1.00
R1598:Lrp1b UTSW 2 41,401,490 (GRCm39) missense probably damaging 1.00
R1619:Lrp1b UTSW 2 40,587,601 (GRCm39) missense unknown
R1697:Lrp1b UTSW 2 40,712,695 (GRCm39) missense probably damaging 0.99
R1698:Lrp1b UTSW 2 40,741,818 (GRCm39) nonsense probably null
R1699:Lrp1b UTSW 2 41,075,974 (GRCm39) missense possibly damaging 0.91
R1715:Lrp1b UTSW 2 41,075,993 (GRCm39) missense probably damaging 1.00
R1748:Lrp1b UTSW 2 41,618,718 (GRCm39) missense possibly damaging 0.56
R1756:Lrp1b UTSW 2 41,000,837 (GRCm39) missense probably damaging 1.00
R1889:Lrp1b UTSW 2 40,809,179 (GRCm39) nonsense probably null
R1895:Lrp1b UTSW 2 40,555,159 (GRCm39) missense unknown
R1902:Lrp1b UTSW 2 40,750,673 (GRCm39) missense probably damaging 1.00
R1919:Lrp1b UTSW 2 41,618,741 (GRCm39) missense probably benign 0.00
R1939:Lrp1b UTSW 2 40,587,601 (GRCm39) missense unknown
R1946:Lrp1b UTSW 2 40,555,159 (GRCm39) missense unknown
R1954:Lrp1b UTSW 2 40,748,453 (GRCm39) missense probably damaging 1.00
R1970:Lrp1b UTSW 2 40,765,081 (GRCm39) missense probably damaging 1.00
R1983:Lrp1b UTSW 2 41,401,416 (GRCm39) critical splice donor site probably null
R2029:Lrp1b UTSW 2 41,231,861 (GRCm39) missense probably benign 0.02
R2054:Lrp1b UTSW 2 40,587,494 (GRCm39) missense unknown
R2108:Lrp1b UTSW 2 41,000,769 (GRCm39) missense probably damaging 1.00
R2158:Lrp1b UTSW 2 40,769,567 (GRCm39) missense probably benign 0.00
R2168:Lrp1b UTSW 2 41,265,858 (GRCm39) missense probably damaging 1.00
R2184:Lrp1b UTSW 2 40,620,714 (GRCm39) missense probably benign
R2188:Lrp1b UTSW 2 41,298,971 (GRCm39) missense probably benign 0.25
R2200:Lrp1b UTSW 2 41,174,177 (GRCm39) missense probably benign 0.43
R2342:Lrp1b UTSW 2 40,809,208 (GRCm39) missense possibly damaging 0.89
R2421:Lrp1b UTSW 2 40,772,145 (GRCm39) splice site probably benign
R2656:Lrp1b UTSW 2 41,401,593 (GRCm39) missense probably damaging 0.99
R2864:Lrp1b UTSW 2 40,765,007 (GRCm39) missense possibly damaging 0.92
R2874:Lrp1b UTSW 2 40,741,705 (GRCm39) missense probably damaging 1.00
R2911:Lrp1b UTSW 2 41,396,704 (GRCm39) missense probably benign 0.00
R2919:Lrp1b UTSW 2 41,660,911 (GRCm39) missense probably damaging 1.00
R3027:Lrp1b UTSW 2 40,760,283 (GRCm39) missense probably benign 0.33
R3083:Lrp1b UTSW 2 40,490,336 (GRCm39) missense probably damaging 0.99
R3545:Lrp1b UTSW 2 40,490,300 (GRCm39) missense probably damaging 1.00
R3546:Lrp1b UTSW 2 40,490,300 (GRCm39) missense probably damaging 1.00
R3547:Lrp1b UTSW 2 40,490,300 (GRCm39) missense probably damaging 1.00
R3709:Lrp1b UTSW 2 40,587,454 (GRCm39) missense unknown
R3817:Lrp1b UTSW 2 40,766,670 (GRCm39) missense probably damaging 1.00
R3876:Lrp1b UTSW 2 41,335,206 (GRCm39) missense probably damaging 1.00
R3877:Lrp1b UTSW 2 41,335,206 (GRCm39) missense probably damaging 1.00
R3896:Lrp1b UTSW 2 40,812,440 (GRCm39) splice site probably null
R3901:Lrp1b UTSW 2 40,712,707 (GRCm39) missense probably damaging 1.00
R3915:Lrp1b UTSW 2 41,339,248 (GRCm39) missense probably damaging 1.00
R3922:Lrp1b UTSW 2 40,567,593 (GRCm39) missense unknown
R3964:Lrp1b UTSW 2 41,202,482 (GRCm39) splice site probably benign
R4013:Lrp1b UTSW 2 40,692,996 (GRCm39) missense possibly damaging 0.66
R4014:Lrp1b UTSW 2 40,692,996 (GRCm39) missense possibly damaging 0.66
R4015:Lrp1b UTSW 2 40,692,996 (GRCm39) missense possibly damaging 0.66
R4017:Lrp1b UTSW 2 40,692,996 (GRCm39) missense possibly damaging 0.66
R4031:Lrp1b UTSW 2 40,592,860 (GRCm39) missense probably benign 0.00
R4095:Lrp1b UTSW 2 41,339,203 (GRCm39) missense probably benign 0.03
R4108:Lrp1b UTSW 2 40,555,099 (GRCm39) missense unknown
R4176:Lrp1b UTSW 2 41,298,405 (GRCm39) missense probably damaging 1.00
R4181:Lrp1b UTSW 2 40,501,446 (GRCm39) missense probably damaging 1.00
R4359:Lrp1b UTSW 2 40,793,077 (GRCm39) missense probably damaging 1.00
R4410:Lrp1b UTSW 2 40,555,094 (GRCm39) missense possibly damaging 0.96
R4416:Lrp1b UTSW 2 40,553,679 (GRCm39) missense unknown
R4489:Lrp1b UTSW 2 40,551,501 (GRCm39) unclassified probably benign
R4577:Lrp1b UTSW 2 40,711,731 (GRCm39) missense probably damaging 1.00
R4623:Lrp1b UTSW 2 41,136,033 (GRCm39) missense probably damaging 1.00
R4677:Lrp1b UTSW 2 40,691,496 (GRCm39) missense probably damaging 1.00
R4684:Lrp1b UTSW 2 40,812,316 (GRCm39) missense probably benign 0.44
R4714:Lrp1b UTSW 2 41,000,771 (GRCm39) missense possibly damaging 0.90
R4721:Lrp1b UTSW 2 40,605,381 (GRCm39) splice site probably null
R4755:Lrp1b UTSW 2 41,361,028 (GRCm39) missense probably benign
R4755:Lrp1b UTSW 2 41,159,285 (GRCm39) missense probably benign 0.07
R4774:Lrp1b UTSW 2 40,551,544 (GRCm39) missense probably null 1.00
R4854:Lrp1b UTSW 2 41,001,089 (GRCm39) missense probably damaging 1.00
R4880:Lrp1b UTSW 2 41,660,931 (GRCm39) missense probably benign 0.07
R4885:Lrp1b UTSW 2 41,358,905 (GRCm39) missense probably benign
R4901:Lrp1b UTSW 2 40,711,657 (GRCm39) missense probably damaging 1.00
R4919:Lrp1b UTSW 2 40,537,246 (GRCm39) missense probably benign 0.25
R4935:Lrp1b UTSW 2 41,388,405 (GRCm39) missense probably benign 0.01
R4937:Lrp1b UTSW 2 40,692,897 (GRCm39) splice site probably null
R4967:Lrp1b UTSW 2 41,678,986 (GRCm39) missense probably damaging 1.00
R4968:Lrp1b UTSW 2 41,679,074 (GRCm39) missense probably damaging 1.00
R4968:Lrp1b UTSW 2 40,592,719 (GRCm39) splice site probably null
R5155:Lrp1b UTSW 2 41,618,634 (GRCm39) splice site probably null
R5221:Lrp1b UTSW 2 41,002,994 (GRCm39) missense possibly damaging 0.79
R5224:Lrp1b UTSW 2 41,000,852 (GRCm39) missense possibly damaging 0.61
R5227:Lrp1b UTSW 2 40,741,805 (GRCm39) missense possibly damaging 0.95
R5246:Lrp1b UTSW 2 41,360,952 (GRCm39) critical splice donor site probably null
R5263:Lrp1b UTSW 2 41,850,691 (GRCm39) missense probably damaging 1.00
R5274:Lrp1b UTSW 2 41,234,456 (GRCm39) missense probably null 1.00
R5291:Lrp1b UTSW 2 40,793,015 (GRCm39) missense probably damaging 1.00
R5362:Lrp1b UTSW 2 41,265,914 (GRCm39) missense probably damaging 1.00
R5365:Lrp1b UTSW 2 40,537,137 (GRCm39) missense possibly damaging 0.55
R5369:Lrp1b UTSW 2 40,894,625 (GRCm39) nonsense probably null
R5419:Lrp1b UTSW 2 40,620,716 (GRCm39) nonsense probably null
R5434:Lrp1b UTSW 2 41,660,880 (GRCm39) missense probably damaging 0.96
R5452:Lrp1b UTSW 2 40,812,328 (GRCm39) missense probably damaging 1.00
R5453:Lrp1b UTSW 2 41,172,249 (GRCm39) missense probably damaging 1.00
R5496:Lrp1b UTSW 2 40,817,985 (GRCm39) missense probably benign 0.02
R5524:Lrp1b UTSW 2 41,000,900 (GRCm39) missense probably damaging 1.00
R5538:Lrp1b UTSW 2 40,587,486 (GRCm39) missense unknown
R5571:Lrp1b UTSW 2 41,298,354 (GRCm39) missense probably damaging 0.97
R5577:Lrp1b UTSW 2 40,765,135 (GRCm39) missense possibly damaging 0.70
R5609:Lrp1b UTSW 2 41,231,807 (GRCm39) missense probably damaging 1.00
R5635:Lrp1b UTSW 2 42,542,834 (GRCm39) utr 5 prime probably benign
R5669:Lrp1b UTSW 2 41,001,050 (GRCm39) missense probably damaging 1.00
R5672:Lrp1b UTSW 2 41,231,771 (GRCm39) missense probably benign 0.01
R5690:Lrp1b UTSW 2 40,640,906 (GRCm39) splice site probably null
R5752:Lrp1b UTSW 2 41,185,624 (GRCm39) missense probably damaging 1.00
R5853:Lrp1b UTSW 2 40,553,738 (GRCm39) missense unknown
R5869:Lrp1b UTSW 2 40,894,615 (GRCm39) missense probably damaging 0.98
R5880:Lrp1b UTSW 2 41,231,826 (GRCm39) missense probably benign 0.23
R5887:Lrp1b UTSW 2 40,711,719 (GRCm39) missense possibly damaging 0.91
R5893:Lrp1b UTSW 2 40,491,599 (GRCm39) missense probably damaging 1.00
R5894:Lrp1b UTSW 2 41,388,233 (GRCm39) missense probably benign 0.11
R6019:Lrp1b UTSW 2 41,192,982 (GRCm39) missense probably damaging 1.00
R6019:Lrp1b UTSW 2 41,366,821 (GRCm39) missense probably damaging 1.00
R6021:Lrp1b UTSW 2 41,234,439 (GRCm39) missense probably benign 0.02
R6045:Lrp1b UTSW 2 40,591,825 (GRCm39) missense unknown
R6047:Lrp1b UTSW 2 40,527,787 (GRCm39) missense probably benign 0.00
R6060:Lrp1b UTSW 2 40,640,946 (GRCm39) missense
R6063:Lrp1b UTSW 2 41,174,156 (GRCm39) nonsense probably null
R6090:Lrp1b UTSW 2 41,075,880 (GRCm39) critical splice donor site probably null
R6112:Lrp1b UTSW 2 41,231,894 (GRCm39) missense probably benign 0.14
R6128:Lrp1b UTSW 2 40,750,667 (GRCm39) missense probably benign
R6149:Lrp1b UTSW 2 40,765,165 (GRCm39) splice site probably null
R6174:Lrp1b UTSW 2 41,339,275 (GRCm39) missense probably benign
R6177:Lrp1b UTSW 2 41,013,748 (GRCm39) splice site probably null
R6257:Lrp1b UTSW 2 40,486,981 (GRCm39) splice site probably null
R6267:Lrp1b UTSW 2 40,547,537 (GRCm39) missense probably benign 0.00
R6268:Lrp1b UTSW 2 40,711,729 (GRCm39) missense probably benign 0.01
R6331:Lrp1b UTSW 2 40,693,221 (GRCm39) missense probably damaging 1.00
R6334:Lrp1b UTSW 2 41,679,045 (GRCm39) missense probably benign
R6359:Lrp1b UTSW 2 41,185,608 (GRCm39) missense probably damaging 1.00
R6371:Lrp1b UTSW 2 40,741,666 (GRCm39) missense possibly damaging 0.61
R6421:Lrp1b UTSW 2 40,779,282 (GRCm39) missense probably damaging 1.00
R6524:Lrp1b UTSW 2 40,741,816 (GRCm39) missense possibly damaging 0.95
R6616:Lrp1b UTSW 2 40,589,643 (GRCm39) missense unknown
R6632:Lrp1b UTSW 2 40,615,454 (GRCm39) missense probably benign 0.23
R6656:Lrp1b UTSW 2 40,527,876 (GRCm39) nonsense probably null
R6698:Lrp1b UTSW 2 41,192,958 (GRCm39) missense probably damaging 1.00
R6741:Lrp1b UTSW 2 41,136,001 (GRCm39) missense possibly damaging 0.82
R6742:Lrp1b UTSW 2 41,361,132 (GRCm39) missense probably benign 0.31
R6811:Lrp1b UTSW 2 41,339,206 (GRCm39) missense probably benign 0.01
R6811:Lrp1b UTSW 2 40,605,512 (GRCm39) splice site probably null
R6855:Lrp1b UTSW 2 40,518,708 (GRCm39) missense possibly damaging 0.66
R6888:Lrp1b UTSW 2 41,361,138 (GRCm39) missense probably benign 0.18
R6946:Lrp1b UTSW 2 40,587,451 (GRCm39) missense probably benign
R6984:Lrp1b UTSW 2 40,712,640 (GRCm39) missense probably damaging 0.97
R7026:Lrp1b UTSW 2 41,159,234 (GRCm39) missense probably damaging 1.00
R7028:Lrp1b UTSW 2 41,136,023 (GRCm39) missense probably benign 0.45
R7036:Lrp1b UTSW 2 41,002,354 (GRCm39) missense possibly damaging 0.89
R7043:Lrp1b UTSW 2 40,812,426 (GRCm39) missense possibly damaging 0.84
R7071:Lrp1b UTSW 2 41,298,276 (GRCm39) missense
R7077:Lrp1b UTSW 2 41,660,858 (GRCm39) missense
R7115:Lrp1b UTSW 2 40,888,247 (GRCm39) missense
R7143:Lrp1b UTSW 2 41,202,655 (GRCm39) missense
R7146:Lrp1b UTSW 2 41,266,006 (GRCm39) nonsense probably null
R7149:Lrp1b UTSW 2 40,527,872 (GRCm39) missense
R7185:Lrp1b UTSW 2 40,691,524 (GRCm39) critical splice acceptor site probably null
R7239:Lrp1b UTSW 2 40,894,725 (GRCm39) missense
R7247:Lrp1b UTSW 2 41,159,224 (GRCm39) missense
R7331:Lrp1b UTSW 2 40,553,622 (GRCm39) splice site probably null
R7369:Lrp1b UTSW 2 41,172,051 (GRCm39) missense
R7378:Lrp1b UTSW 2 41,185,681 (GRCm39) missense
R7381:Lrp1b UTSW 2 40,692,929 (GRCm39) missense
R7406:Lrp1b UTSW 2 41,266,030 (GRCm39) critical splice acceptor site probably null
R7437:Lrp1b UTSW 2 40,712,658 (GRCm39) missense
R7437:Lrp1b UTSW 2 40,712,657 (GRCm39) missense
R7446:Lrp1b UTSW 2 41,561,069 (GRCm39) missense
R7460:Lrp1b UTSW 2 40,488,478 (GRCm39) missense
R7462:Lrp1b UTSW 2 41,003,041 (GRCm39) missense
R7475:Lrp1b UTSW 2 41,234,588 (GRCm39) missense
R7479:Lrp1b UTSW 2 40,691,517 (GRCm39) missense
R7523:Lrp1b UTSW 2 41,401,473 (GRCm39) missense
R7525:Lrp1b UTSW 2 40,547,428 (GRCm39) missense
R7549:Lrp1b UTSW 2 40,765,134 (GRCm39) missense
R7552:Lrp1b UTSW 2 40,567,582 (GRCm39) missense
R7558:Lrp1b UTSW 2 41,231,948 (GRCm39) missense
R7587:Lrp1b UTSW 2 40,620,729 (GRCm39) missense
R7599:Lrp1b UTSW 2 40,551,561 (GRCm39) missense
R7635:Lrp1b UTSW 2 41,013,609 (GRCm39) critical splice donor site probably null
R7663:Lrp1b UTSW 2 42,543,047 (GRCm39) unclassified probably benign
R7674:Lrp1b UTSW 2 42,542,921 (GRCm39) start gained probably benign
R7681:Lrp1b UTSW 2 40,765,011 (GRCm39) nonsense probably null
R7703:Lrp1b UTSW 2 41,000,798 (GRCm39) missense
R7742:Lrp1b UTSW 2 40,712,641 (GRCm39) missense
R7767:Lrp1b UTSW 2 40,691,517 (GRCm39) missense
R7829:Lrp1b UTSW 2 40,793,460 (GRCm39) nonsense probably null
R7861:Lrp1b UTSW 2 40,587,570 (GRCm39) missense
R7868:Lrp1b UTSW 2 41,339,246 (GRCm39) missense
R7883:Lrp1b UTSW 2 40,555,141 (GRCm39) missense
R7956:Lrp1b UTSW 2 41,172,161 (GRCm39) splice site probably null
R7963:Lrp1b UTSW 2 40,817,947 (GRCm39) missense
R7964:Lrp1b UTSW 2 40,488,523 (GRCm39) missense
R8035:Lrp1b UTSW 2 40,750,667 (GRCm39) missense
R8046:Lrp1b UTSW 2 41,159,199 (GRCm39) missense
R8128:Lrp1b UTSW 2 41,159,248 (GRCm39) missense probably null
R8234:Lrp1b UTSW 2 41,202,668 (GRCm39) missense
R8237:Lrp1b UTSW 2 40,741,786 (GRCm39) missense
R8244:Lrp1b UTSW 2 41,396,794 (GRCm39) missense
R8370:Lrp1b UTSW 2 40,888,117 (GRCm39) missense
R8395:Lrp1b UTSW 2 40,547,411 (GRCm39) missense
R8398:Lrp1b UTSW 2 40,591,819 (GRCm39) missense
R8421:Lrp1b UTSW 2 40,615,435 (GRCm39) missense
R8426:Lrp1b UTSW 2 41,388,318 (GRCm39) missense
R8443:Lrp1b UTSW 2 41,265,867 (GRCm39) nonsense probably null
R8444:Lrp1b UTSW 2 40,760,272 (GRCm39) missense
R8486:Lrp1b UTSW 2 41,618,702 (GRCm39) missense probably damaging 1.00
R8500:Lrp1b UTSW 2 41,396,791 (GRCm39) missense probably benign 0.12
R8507:Lrp1b UTSW 2 41,298,387 (GRCm39) missense
R8552:Lrp1b UTSW 2 41,298,993 (GRCm39) missense probably benign 0.00
R8554:Lrp1b UTSW 2 41,234,495 (GRCm39) missense probably benign 0.28
R8669:Lrp1b UTSW 2 41,172,047 (GRCm39) critical splice donor site probably null
R8699:Lrp1b UTSW 2 41,172,207 (GRCm39) missense
R8796:Lrp1b UTSW 2 40,793,426 (GRCm39) missense
R8815:Lrp1b UTSW 2 40,555,171 (GRCm39) missense
R8842:Lrp1b UTSW 2 41,158,417 (GRCm39) missense
R8858:Lrp1b UTSW 2 41,560,827 (GRCm39) intron probably benign
R8864:Lrp1b UTSW 2 41,002,718 (GRCm39) missense
R8918:Lrp1b UTSW 2 40,615,893 (GRCm39) missense
R8920:Lrp1b UTSW 2 42,213,610 (GRCm39) missense
R8963:Lrp1b UTSW 2 40,888,196 (GRCm39) missense probably benign 0.28
R8971:Lrp1b UTSW 2 41,325,640 (GRCm39) missense
R9007:Lrp1b UTSW 2 40,587,564 (GRCm39) missense
R9042:Lrp1b UTSW 2 41,392,029 (GRCm39) missense
R9053:Lrp1b UTSW 2 40,748,501 (GRCm39) missense
R9063:Lrp1b UTSW 2 41,231,838 (GRCm39) missense
R9072:Lrp1b UTSW 2 40,615,457 (GRCm39) nonsense probably null
R9105:Lrp1b UTSW 2 41,396,803 (GRCm39) missense
R9131:Lrp1b UTSW 2 40,589,590 (GRCm39) nonsense probably null
R9226:Lrp1b UTSW 2 41,401,460 (GRCm39) missense
R9245:Lrp1b UTSW 2 40,488,456 (GRCm39) missense
R9275:Lrp1b UTSW 2 40,487,076 (GRCm39) missense
R9278:Lrp1b UTSW 2 40,487,076 (GRCm39) missense
R9303:Lrp1b UTSW 2 41,618,574 (GRCm39) missense
R9305:Lrp1b UTSW 2 41,618,574 (GRCm39) missense
R9306:Lrp1b UTSW 2 40,518,762 (GRCm39) missense possibly damaging 0.66
R9320:Lrp1b UTSW 2 41,335,111 (GRCm39) critical splice donor site probably null
R9330:Lrp1b UTSW 2 41,012,993 (GRCm39) missense
R9352:Lrp1b UTSW 2 40,748,438 (GRCm39) missense
R9386:Lrp1b UTSW 2 41,013,640 (GRCm39) missense
R9397:Lrp1b UTSW 2 40,640,922 (GRCm39) missense
R9444:Lrp1b UTSW 2 41,013,730 (GRCm39) missense
R9452:Lrp1b UTSW 2 41,850,726 (GRCm39) nonsense probably null
R9474:Lrp1b UTSW 2 40,491,599 (GRCm39) missense probably damaging 1.00
R9501:Lrp1b UTSW 2 41,172,247 (GRCm39) missense
R9523:Lrp1b UTSW 2 41,660,978 (GRCm39) missense
R9541:Lrp1b UTSW 2 41,234,600 (GRCm39) missense
R9555:Lrp1b UTSW 2 40,748,438 (GRCm39) missense
R9555:Lrp1b UTSW 2 40,741,693 (GRCm39) missense
R9563:Lrp1b UTSW 2 41,185,711 (GRCm39) missense
R9568:Lrp1b UTSW 2 40,569,227 (GRCm39) missense
R9622:Lrp1b UTSW 2 40,779,354 (GRCm39) nonsense probably null
R9623:Lrp1b UTSW 2 41,366,648 (GRCm39) missense
R9634:Lrp1b UTSW 2 41,135,951 (GRCm39) critical splice donor site probably null
R9640:Lrp1b UTSW 2 41,078,929 (GRCm39) missense
R9664:Lrp1b UTSW 2 40,765,004 (GRCm39) missense
R9668:Lrp1b UTSW 2 41,075,982 (GRCm39) missense
R9672:Lrp1b UTSW 2 40,779,291 (GRCm39) missense
R9741:Lrp1b UTSW 2 41,002,300 (GRCm39) missense
RF018:Lrp1b UTSW 2 41,000,919 (GRCm39) missense
RF020:Lrp1b UTSW 2 41,660,858 (GRCm39) missense
V1662:Lrp1b UTSW 2 41,012,944 (GRCm39) missense probably damaging 0.99
X0028:Lrp1b UTSW 2 41,361,157 (GRCm39) missense probably damaging 1.00
X0064:Lrp1b UTSW 2 41,392,055 (GRCm39) missense probably damaging 1.00
Z1176:Lrp1b UTSW 2 40,812,395 (GRCm39) missense
Z1176:Lrp1b UTSW 2 40,587,594 (GRCm39) missense
Z1176:Lrp1b UTSW 2 40,567,518 (GRCm39) missense
Z1176:Lrp1b UTSW 2 41,618,722 (GRCm39) missense
Z1177:Lrp1b UTSW 2 41,078,860 (GRCm39) missense
Z1177:Lrp1b UTSW 2 40,527,761 (GRCm39) missense
Z1187:Lrp1b UTSW 2 40,640,946 (GRCm39) missense
Z1188:Lrp1b UTSW 2 40,640,946 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AGATGCCCAGACAGTGTGTG -3'
(R):5'- GGGCCAACATACTTAAGTCTTTTGG -3'

Sequencing Primer
(F):5'- CCCAGACAGTGTGTGTGCTAATG -3'
(R):5'- GGATTTGCATGCAACATGT -3'
Posted On 2022-10-06