Incidental Mutation 'R9717:Scn9a'
ID 730503
Institutional Source Beutler Lab
Gene Symbol Scn9a
Ensembl Gene ENSMUSG00000075316
Gene Name sodium channel, voltage-gated, type IX, alpha
Synonyms PN1
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 66310424-66465306 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 66357002 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 1100 (M1100L)
Ref Sequence ENSEMBL: ENSMUSP00000097642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100063] [ENSMUST00000100064] [ENSMUST00000112354] [ENSMUST00000164384] [ENSMUST00000169900]
AlphaFold Q62205
Predicted Effect probably benign
Transcript: ENSMUST00000100063
AA Change: M1091L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097641
Gene: ENSMUSG00000075316
AA Change: M1091L

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 403 9.5e-78 PFAM
coiled coil region 404 442 N/A INTRINSIC
Pfam:DUF3451 465 685 1.3e-62 PFAM
Pfam:Ion_trans 768 957 9.9e-48 PFAM
Pfam:Na_trans_assoc 972 1191 2.9e-72 PFAM
low complexity region 1203 1214 N/A INTRINSIC
Pfam:Ion_trans 1217 1445 2.8e-55 PFAM
PDB:1BYY|A 1447 1499 9e-27 PDB
Pfam:Ion_trans 1538 1748 3.4e-52 PFAM
Pfam:PKD_channel 1599 1755 1.1e-7 PFAM
IQ 1877 1899 1.03e-3 SMART
low complexity region 1956 1972 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100064
AA Change: M1100L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097642
Gene: ENSMUSG00000075316
AA Change: M1100L

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 125 412 2.2e-84 PFAM
low complexity region 433 446 N/A INTRINSIC
Pfam:Na_trans_cytopl 483 693 7.5e-76 PFAM
Pfam:Ion_trans 742 977 4.1e-57 PFAM
Pfam:Na_trans_assoc 981 1185 1.4e-58 PFAM
Pfam:Ion_trans 1189 1466 7e-67 PFAM
Pfam:Ion_trans 1512 1769 1e-55 PFAM
Pfam:PKD_channel 1605 1763 2.6e-7 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112354
AA Change: M1089L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107973
Gene: ENSMUSG00000075316
AA Change: M1089L

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.2e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164384
AA Change: M1100L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126528
Gene: ENSMUSG00000075316
AA Change: M1100L

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.1e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 694 4.2e-66 PFAM
Pfam:Ion_trans 777 966 8.8e-48 PFAM
Pfam:Na_trans_assoc 981 1200 6e-72 PFAM
low complexity region 1212 1223 N/A INTRINSIC
Pfam:Ion_trans 1226 1454 2.5e-55 PFAM
PDB:1BYY|A 1456 1508 6e-29 PDB
Pfam:Ion_trans 1547 1757 3e-52 PFAM
Pfam:PKD_channel 1608 1764 8.1e-8 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169900
AA Change: M1089L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131711
Gene: ENSMUSG00000075316
AA Change: M1089L

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 3.7e-78 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated sodium channel which plays a significant role in nociception signaling. Mutations in this gene have been associated with primary erythermalgia, channelopathy-associated insensitivity to pain, and paroxysmal extreme pain disorder. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal/neonatal lethality. Mice homozygous for a knock-in allele exhibit increased susceptibility to electrically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,668,900 (GRCm39) N2552I probably damaging Het
Amph G T 13: 19,309,253 (GRCm39) A444S probably benign Het
Ankrd52 A G 10: 128,216,457 (GRCm39) N157S probably benign Het
Arhgap29 T C 3: 121,797,920 (GRCm39) F537L probably benign Het
Asic1 A C 15: 99,590,657 (GRCm39) T136P probably damaging Het
Atg2b T C 12: 105,605,561 (GRCm39) Y1468C probably benign Het
Atm A G 9: 53,427,817 (GRCm39) L431P probably damaging Het
Atosb T C 4: 43,036,050 (GRCm39) H227R probably damaging Het
Btaf1 A G 19: 36,922,646 (GRCm39) T17A probably benign Het
Car10 A G 11: 93,195,367 (GRCm39) N58S probably benign Het
Cd79b A T 11: 106,202,845 (GRCm39) D252E probably damaging Het
Cdipt C T 7: 126,576,202 (GRCm39) probably benign Het
Cebpe T C 14: 54,949,165 (GRCm39) D84G probably damaging Het
Cenpj T C 14: 56,790,453 (GRCm39) E532G probably benign Het
Cherp A G 8: 73,216,920 (GRCm39) probably null Het
Chuk T C 19: 44,071,109 (GRCm39) D532G possibly damaging Het
Clec1b C T 6: 129,374,603 (GRCm39) T9I probably benign Het
Clspn G T 4: 126,458,756 (GRCm39) A280S possibly damaging Het
Cts3 T G 13: 61,712,799 (GRCm39) Y307S probably benign Het
Cyp2c39 T C 19: 39,556,493 (GRCm39) M443T possibly damaging Het
Dhx57 C T 17: 80,582,447 (GRCm39) R386H probably damaging Het
Dhx58 A T 11: 100,592,133 (GRCm39) M305K probably benign Het
Dlgap3 T C 4: 127,129,287 (GRCm39) L894P probably damaging Het
Dnah3 A T 7: 119,574,299 (GRCm39) N2164K probably damaging Het
Dnajb14 A G 3: 137,608,044 (GRCm39) N183S probably benign Het
Drd5 G T 5: 38,478,090 (GRCm39) R361L probably damaging Het
Duoxa1 T C 2: 122,135,622 (GRCm39) E159G probably damaging Het
Exoc1 T A 5: 76,711,079 (GRCm39) S659R probably benign Het
Fbln7 T C 2: 128,719,314 (GRCm39) I37T probably benign Het
Fcgrt T G 7: 44,744,853 (GRCm39) E205A possibly damaging Het
Fcho2 A T 13: 98,900,202 (GRCm39) S304T probably damaging Het
Gbp9 C A 5: 105,253,587 (GRCm39) G43* probably null Het
Gucy2d A G 7: 98,123,868 (GRCm39) K151R probably benign Het
Heatr4 T A 12: 84,024,829 (GRCm39) I331F probably damaging Het
Hmcn1 G A 1: 150,485,378 (GRCm39) T4408I probably damaging Het
Hoxc9 C T 15: 102,890,551 (GRCm39) T156M probably benign Het
Hrnr A T 3: 93,227,987 (GRCm39) E35V probably damaging Het
Idua C T 5: 108,818,037 (GRCm39) Q70* probably null Het
Klf5 A T 14: 99,539,189 (GRCm39) I201F probably damaging Het
Lonrf1 T C 8: 36,701,164 (GRCm39) K349E probably damaging Het
Lrp1b A T 2: 41,158,395 (GRCm39) D1721E Het
Mdh1 T A 11: 21,521,870 (GRCm39) probably benign Het
Mllt11 T C 3: 95,127,521 (GRCm39) H83R probably benign Het
Mrgprb4 A C 7: 47,848,583 (GRCm39) I115S possibly damaging Het
Mrpl38 A G 11: 116,023,296 (GRCm39) F319S probably damaging Het
Naif1 A T 2: 32,344,907 (GRCm39) M204L probably benign Het
Ncan T A 8: 70,554,628 (GRCm39) D1063V probably damaging Het
Noto A T 6: 85,401,327 (GRCm39) R119W possibly damaging Het
Or4c115 G A 2: 88,927,573 (GRCm39) L233F probably benign Het
Or51h7 A T 7: 102,591,165 (GRCm39) D206E probably damaging Het
Or6c69 T A 10: 129,748,048 (GRCm39) Y33F probably damaging Het
Or8b3 A T 9: 38,314,841 (GRCm39) I224F probably damaging Het
Ovch2 A G 7: 107,393,584 (GRCm39) W181R probably damaging Het
Palm G C 10: 79,655,117 (GRCm39) G292R probably damaging Het
Pdgfrb T A 18: 61,205,787 (GRCm39) L591* probably null Het
Pik3c2g T C 6: 139,841,910 (GRCm39) S772P Het
Prx C A 7: 27,217,411 (GRCm39) D776E probably benign Het
Ptpra A G 2: 130,384,366 (GRCm39) E562G possibly damaging Het
Rbm4b A G 19: 4,807,359 (GRCm39) Y25C probably damaging Het
Reln T C 5: 22,136,427 (GRCm39) T2534A probably benign Het
Rnf123 T C 9: 107,954,963 (GRCm39) S14G probably benign Het
Rock2 A G 12: 17,015,602 (GRCm39) H833R probably benign Het
Rxfp3 A G 15: 11,037,111 (GRCm39) V87A possibly damaging Het
S100b G A 10: 76,092,936 (GRCm39) G23D probably damaging Het
Septin11 T A 5: 93,296,266 (GRCm39) S55T possibly damaging Het
Speer4a3 T C 5: 26,154,829 (GRCm39) E257G probably damaging Het
Sv2b T A 7: 74,769,676 (GRCm39) Q622L probably benign Het
Taar7a T C 10: 23,868,799 (GRCm39) D194G probably benign Het
Trappc3 T C 4: 126,169,014 (GRCm39) I168T probably benign Het
Trim27 T C 13: 21,374,296 (GRCm39) probably null Het
Wdr49 G A 3: 75,304,359 (GRCm39) T109I probably benign Het
Wdr64 T C 1: 175,544,854 (GRCm39) Y96H probably damaging Het
Zfp219 A T 14: 52,247,049 (GRCm39) L26Q probably damaging Het
Zfp758 T A 17: 22,593,829 (GRCm39) V105D possibly damaging Het
Zfp975 C G 7: 42,312,332 (GRCm39) E94Q possibly damaging Het
Zfyve9 C T 4: 108,539,334 (GRCm39) A289T probably benign Het
Zscan5b T C 7: 6,234,525 (GRCm39) S184P possibly damaging Het
Other mutations in Scn9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Scn9a APN 2 66,393,945 (GRCm39) missense probably damaging 1.00
IGL00570:Scn9a APN 2 66,314,486 (GRCm39) missense probably damaging 1.00
IGL00809:Scn9a APN 2 66,314,279 (GRCm39) missense probably damaging 1.00
IGL00977:Scn9a APN 2 66,314,645 (GRCm39) missense probably damaging 0.99
IGL01120:Scn9a APN 2 66,357,316 (GRCm39) missense probably benign 0.00
IGL01134:Scn9a APN 2 66,335,312 (GRCm39) missense probably damaging 1.00
IGL01300:Scn9a APN 2 66,318,397 (GRCm39) nonsense probably null
IGL01452:Scn9a APN 2 66,357,416 (GRCm39) missense probably damaging 1.00
IGL01531:Scn9a APN 2 66,367,722 (GRCm39) missense probably benign 0.11
IGL01572:Scn9a APN 2 66,324,230 (GRCm39) missense probably benign 0.00
IGL01645:Scn9a APN 2 66,317,986 (GRCm39) missense possibly damaging 0.62
IGL01823:Scn9a APN 2 66,314,386 (GRCm39) missense probably damaging 1.00
IGL01965:Scn9a APN 2 66,314,777 (GRCm39) missense probably damaging 1.00
IGL02127:Scn9a APN 2 66,325,170 (GRCm39) missense probably damaging 1.00
IGL02127:Scn9a APN 2 66,377,479 (GRCm39) missense probably damaging 1.00
IGL02166:Scn9a APN 2 66,323,447 (GRCm39) missense possibly damaging 0.95
IGL02183:Scn9a APN 2 66,314,955 (GRCm39) splice site probably benign
IGL02640:Scn9a APN 2 66,366,440 (GRCm39) critical splice donor site probably null
IGL02685:Scn9a APN 2 66,367,637 (GRCm39) missense probably damaging 1.00
IGL02798:Scn9a APN 2 66,370,903 (GRCm39) missense possibly damaging 0.52
IGL02832:Scn9a APN 2 66,398,373 (GRCm39) missense probably damaging 1.00
IGL03008:Scn9a APN 2 66,392,855 (GRCm39) missense probably damaging 1.00
IGL03270:Scn9a APN 2 66,314,358 (GRCm39) missense probably damaging 1.00
IGL03408:Scn9a APN 2 66,357,091 (GRCm39) missense probably benign 0.00
BB007:Scn9a UTSW 2 66,335,193 (GRCm39) missense probably damaging 0.99
BB017:Scn9a UTSW 2 66,335,193 (GRCm39) missense probably damaging 0.99
R0039:Scn9a UTSW 2 66,392,788 (GRCm39) missense probably damaging 0.98
R0173:Scn9a UTSW 2 66,363,437 (GRCm39) missense probably damaging 1.00
R0323:Scn9a UTSW 2 66,398,475 (GRCm39) missense probably damaging 1.00
R0344:Scn9a UTSW 2 66,335,354 (GRCm39) missense probably damaging 0.99
R0421:Scn9a UTSW 2 66,373,621 (GRCm39) missense probably benign
R0465:Scn9a UTSW 2 66,357,340 (GRCm39) missense probably damaging 1.00
R0514:Scn9a UTSW 2 66,314,022 (GRCm39) missense probably damaging 1.00
R0599:Scn9a UTSW 2 66,357,143 (GRCm39) missense probably damaging 0.96
R0627:Scn9a UTSW 2 66,367,721 (GRCm39) missense probably benign 0.00
R0644:Scn9a UTSW 2 66,363,405 (GRCm39) critical splice donor site probably null
R0653:Scn9a UTSW 2 66,363,721 (GRCm39) missense probably damaging 1.00
R0685:Scn9a UTSW 2 66,313,843 (GRCm39) missense probably benign 0.02
R0718:Scn9a UTSW 2 66,377,456 (GRCm39) missense probably damaging 1.00
R0827:Scn9a UTSW 2 66,366,468 (GRCm39) nonsense probably null
R0890:Scn9a UTSW 2 66,314,079 (GRCm39) missense probably damaging 1.00
R1139:Scn9a UTSW 2 66,335,341 (GRCm39) missense probably benign 0.02
R1385:Scn9a UTSW 2 66,393,886 (GRCm39) missense probably damaging 1.00
R1398:Scn9a UTSW 2 66,314,930 (GRCm39) missense probably benign 0.11
R1496:Scn9a UTSW 2 66,357,232 (GRCm39) missense probably benign
R1511:Scn9a UTSW 2 66,357,157 (GRCm39) missense probably benign 0.01
R1517:Scn9a UTSW 2 66,335,371 (GRCm39) splice site probably benign
R1564:Scn9a UTSW 2 66,314,648 (GRCm39) missense probably damaging 1.00
R1634:Scn9a UTSW 2 66,318,361 (GRCm39) missense probably damaging 1.00
R1662:Scn9a UTSW 2 66,313,803 (GRCm39) missense probably benign 0.00
R1695:Scn9a UTSW 2 66,335,220 (GRCm39) nonsense probably null
R1709:Scn9a UTSW 2 66,313,850 (GRCm39) missense probably damaging 1.00
R1741:Scn9a UTSW 2 66,317,938 (GRCm39) missense probably damaging 0.99
R1755:Scn9a UTSW 2 66,332,060 (GRCm39) missense probably benign 0.38
R1914:Scn9a UTSW 2 66,396,594 (GRCm39) missense probably damaging 1.00
R1962:Scn9a UTSW 2 66,314,655 (GRCm39) missense probably damaging 1.00
R1970:Scn9a UTSW 2 66,345,724 (GRCm39) missense probably damaging 0.97
R2017:Scn9a UTSW 2 66,345,665 (GRCm39) missense probably damaging 0.99
R2092:Scn9a UTSW 2 66,363,720 (GRCm39) missense probably damaging 0.99
R2105:Scn9a UTSW 2 66,398,527 (GRCm39) missense probably benign 0.25
R2114:Scn9a UTSW 2 66,314,396 (GRCm39) missense probably damaging 1.00
R2115:Scn9a UTSW 2 66,314,396 (GRCm39) missense probably damaging 1.00
R2128:Scn9a UTSW 2 66,356,998 (GRCm39) missense probably damaging 1.00
R2157:Scn9a UTSW 2 66,366,669 (GRCm39) missense probably damaging 1.00
R2162:Scn9a UTSW 2 66,364,573 (GRCm39) missense probably damaging 0.98
R2350:Scn9a UTSW 2 66,335,312 (GRCm39) missense probably damaging 1.00
R3694:Scn9a UTSW 2 66,392,749 (GRCm39) missense probably benign
R3771:Scn9a UTSW 2 66,313,992 (GRCm39) missense probably benign 0.26
R3772:Scn9a UTSW 2 66,313,992 (GRCm39) missense probably benign 0.26
R3773:Scn9a UTSW 2 66,313,992 (GRCm39) missense probably benign 0.26
R3922:Scn9a UTSW 2 66,357,217 (GRCm39) missense possibly damaging 0.88
R3926:Scn9a UTSW 2 66,357,217 (GRCm39) missense possibly damaging 0.88
R4258:Scn9a UTSW 2 66,395,398 (GRCm39) intron probably benign
R4385:Scn9a UTSW 2 66,314,900 (GRCm39) missense probably damaging 1.00
R4415:Scn9a UTSW 2 66,357,037 (GRCm39) missense probably damaging 1.00
R4570:Scn9a UTSW 2 66,313,902 (GRCm39) missense possibly damaging 0.85
R4682:Scn9a UTSW 2 66,377,362 (GRCm39) missense probably benign
R4783:Scn9a UTSW 2 66,370,967 (GRCm39) missense probably benign 0.01
R4822:Scn9a UTSW 2 66,314,093 (GRCm39) missense possibly damaging 0.55
R4829:Scn9a UTSW 2 66,382,057 (GRCm39) missense probably benign
R4908:Scn9a UTSW 2 66,357,087 (GRCm39) missense probably benign 0.03
R4983:Scn9a UTSW 2 66,396,614 (GRCm39) missense probably benign 0.02
R5047:Scn9a UTSW 2 66,392,824 (GRCm39) missense probably damaging 1.00
R5100:Scn9a UTSW 2 66,364,463 (GRCm39) missense probably damaging 1.00
R5140:Scn9a UTSW 2 66,395,511 (GRCm39) missense possibly damaging 0.81
R5398:Scn9a UTSW 2 66,318,387 (GRCm39) missense probably damaging 1.00
R5557:Scn9a UTSW 2 66,377,447 (GRCm39) missense probably damaging 0.99
R5582:Scn9a UTSW 2 66,395,373 (GRCm39) intron probably benign
R6108:Scn9a UTSW 2 66,314,393 (GRCm39) missense probably damaging 1.00
R6115:Scn9a UTSW 2 66,393,973 (GRCm39) missense possibly damaging 0.70
R6143:Scn9a UTSW 2 66,317,868 (GRCm39) missense probably benign 0.00
R6261:Scn9a UTSW 2 66,314,240 (GRCm39) missense probably damaging 1.00
R6335:Scn9a UTSW 2 66,398,608 (GRCm39) start codon destroyed possibly damaging 0.91
R6429:Scn9a UTSW 2 66,357,307 (GRCm39) missense possibly damaging 0.95
R6632:Scn9a UTSW 2 66,313,846 (GRCm39) missense probably benign 0.23
R6681:Scn9a UTSW 2 66,393,686 (GRCm39) missense possibly damaging 0.90
R6830:Scn9a UTSW 2 66,398,373 (GRCm39) missense probably damaging 1.00
R7102:Scn9a UTSW 2 66,379,359 (GRCm39) missense probably damaging 1.00
R7186:Scn9a UTSW 2 66,364,567 (GRCm39) missense probably damaging 1.00
R7243:Scn9a UTSW 2 66,370,874 (GRCm39) missense probably damaging 1.00
R7311:Scn9a UTSW 2 66,314,748 (GRCm39) missense possibly damaging 0.54
R7328:Scn9a UTSW 2 66,314,931 (GRCm39) missense probably benign
R7386:Scn9a UTSW 2 66,370,894 (GRCm39) missense probably damaging 1.00
R7438:Scn9a UTSW 2 66,377,531 (GRCm39) missense possibly damaging 0.81
R7483:Scn9a UTSW 2 66,363,692 (GRCm39) missense probably damaging 0.99
R7485:Scn9a UTSW 2 66,364,561 (GRCm39) missense probably damaging 1.00
R7526:Scn9a UTSW 2 66,313,990 (GRCm39) missense probably benign
R7617:Scn9a UTSW 2 66,370,893 (GRCm39) missense possibly damaging 0.55
R7642:Scn9a UTSW 2 66,366,580 (GRCm39) missense probably benign 0.02
R7653:Scn9a UTSW 2 66,357,424 (GRCm39) missense probably damaging 1.00
R7747:Scn9a UTSW 2 66,314,642 (GRCm39) missense probably damaging 1.00
R7823:Scn9a UTSW 2 66,314,135 (GRCm39) missense probably damaging 1.00
R7864:Scn9a UTSW 2 66,314,904 (GRCm39) missense possibly damaging 0.73
R7890:Scn9a UTSW 2 66,373,456 (GRCm39) missense probably benign 0.00
R7930:Scn9a UTSW 2 66,335,193 (GRCm39) missense probably damaging 0.99
R7975:Scn9a UTSW 2 66,314,597 (GRCm39) missense probably damaging 1.00
R8057:Scn9a UTSW 2 66,345,774 (GRCm39) missense probably benign 0.06
R8145:Scn9a UTSW 2 66,317,754 (GRCm39) missense probably damaging 1.00
R8163:Scn9a UTSW 2 66,314,745 (GRCm39) missense probably damaging 1.00
R8165:Scn9a UTSW 2 66,370,874 (GRCm39) missense probably damaging 1.00
R8342:Scn9a UTSW 2 66,366,626 (GRCm39) missense probably benign
R8345:Scn9a UTSW 2 66,324,966 (GRCm39) missense probably damaging 0.96
R8464:Scn9a UTSW 2 66,396,625 (GRCm39) missense probably damaging 0.99
R8467:Scn9a UTSW 2 66,332,015 (GRCm39) missense probably damaging 1.00
R8698:Scn9a UTSW 2 66,366,628 (GRCm39) missense probably benign 0.00
R8810:Scn9a UTSW 2 66,332,010 (GRCm39) missense probably damaging 1.00
R8822:Scn9a UTSW 2 66,370,979 (GRCm39) missense probably damaging 0.99
R8829:Scn9a UTSW 2 66,313,961 (GRCm39) missense probably benign
R9009:Scn9a UTSW 2 66,338,927 (GRCm39) missense probably damaging 1.00
R9038:Scn9a UTSW 2 66,325,147 (GRCm39) missense probably damaging 1.00
R9126:Scn9a UTSW 2 66,314,744 (GRCm39) missense probably damaging 1.00
R9205:Scn9a UTSW 2 66,363,657 (GRCm39) missense probably damaging 1.00
R9300:Scn9a UTSW 2 66,335,236 (GRCm39) missense probably benign 0.39
R9373:Scn9a UTSW 2 66,314,261 (GRCm39) missense probably benign 0.00
R9404:Scn9a UTSW 2 66,357,040 (GRCm39) missense probably benign 0.02
R9443:Scn9a UTSW 2 66,395,553 (GRCm39) missense probably damaging 1.00
R9590:Scn9a UTSW 2 66,314,328 (GRCm39) missense probably benign 0.05
R9612:Scn9a UTSW 2 66,363,708 (GRCm39) missense probably damaging 1.00
R9617:Scn9a UTSW 2 66,392,809 (GRCm39) missense probably damaging 1.00
X0003:Scn9a UTSW 2 66,338,991 (GRCm39) missense probably benign 0.02
X0062:Scn9a UTSW 2 66,398,421 (GRCm39) missense probably damaging 1.00
Z1176:Scn9a UTSW 2 66,370,936 (GRCm39) missense probably benign 0.00
Z1177:Scn9a UTSW 2 66,325,029 (GRCm39) missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ACGGGGTTACATCTGTTATTACG -3'
(R):5'- TCTCAAACCGTACCCTTGCG -3'

Sequencing Primer
(F):5'- GTAAGATGTTTGAAATGACACCCGC -3'
(R):5'- GTACCCTTGCGGAGATAAGC -3'
Posted On 2022-10-06