Incidental Mutation 'R9717:Ptpra'
ID 730507
Institutional Source Beutler Lab
Gene Symbol Ptpra
Ensembl Gene ENSMUSG00000027303
Gene Name protein tyrosine phosphatase receptor type A
Synonyms PTP[a], RPTRalpha, PTPalpha, RPTPalpha, Ptpa
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 130292198-130396220 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 130384366 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 562 (E562G)
Ref Sequence ENSEMBL: ENSMUSP00000076533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028769] [ENSMUST00000077303] [ENSMUST00000230981]
AlphaFold P18052
PDB Structure Crystal structure of the D2 domain of RPTPa [X-RAY DIFFRACTION]
RECEPTOR PROTEIN TYROSINE PHOSPHATASE ALPHA, DOMAIN 1 FROM MOUSE [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028769
AA Change: E526G

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028769
Gene: ENSMUSG00000027303
AA Change: E526G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
PTPc 231 494 6.01e-130 SMART
PTPc 523 784 3.56e-132 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000077303
AA Change: E562G

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000076533
Gene: ENSMUSG00000027303
AA Change: E562G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
PTPc 231 530 2.03e-118 SMART
PTPc 559 820 3.56e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230981
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. This PTP has been shown to dephosphorylate and activate Src family tyrosine kinases, and is implicated in the regulation of integrin signaling, cell adhesion and proliferation. Three alternatively spliced variants of this gene, which encode two distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit deficits in Morris water maze learning, reduced locomotor activity, and decreased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,668,900 (GRCm39) N2552I probably damaging Het
Amph G T 13: 19,309,253 (GRCm39) A444S probably benign Het
Ankrd52 A G 10: 128,216,457 (GRCm39) N157S probably benign Het
Arhgap29 T C 3: 121,797,920 (GRCm39) F537L probably benign Het
Asic1 A C 15: 99,590,657 (GRCm39) T136P probably damaging Het
Atg2b T C 12: 105,605,561 (GRCm39) Y1468C probably benign Het
Atm A G 9: 53,427,817 (GRCm39) L431P probably damaging Het
Atosb T C 4: 43,036,050 (GRCm39) H227R probably damaging Het
Btaf1 A G 19: 36,922,646 (GRCm39) T17A probably benign Het
Car10 A G 11: 93,195,367 (GRCm39) N58S probably benign Het
Cd79b A T 11: 106,202,845 (GRCm39) D252E probably damaging Het
Cdipt C T 7: 126,576,202 (GRCm39) probably benign Het
Cebpe T C 14: 54,949,165 (GRCm39) D84G probably damaging Het
Cenpj T C 14: 56,790,453 (GRCm39) E532G probably benign Het
Cherp A G 8: 73,216,920 (GRCm39) probably null Het
Chuk T C 19: 44,071,109 (GRCm39) D532G possibly damaging Het
Clec1b C T 6: 129,374,603 (GRCm39) T9I probably benign Het
Clspn G T 4: 126,458,756 (GRCm39) A280S possibly damaging Het
Cts3 T G 13: 61,712,799 (GRCm39) Y307S probably benign Het
Cyp2c39 T C 19: 39,556,493 (GRCm39) M443T possibly damaging Het
Dhx57 C T 17: 80,582,447 (GRCm39) R386H probably damaging Het
Dhx58 A T 11: 100,592,133 (GRCm39) M305K probably benign Het
Dlgap3 T C 4: 127,129,287 (GRCm39) L894P probably damaging Het
Dnah3 A T 7: 119,574,299 (GRCm39) N2164K probably damaging Het
Dnajb14 A G 3: 137,608,044 (GRCm39) N183S probably benign Het
Drd5 G T 5: 38,478,090 (GRCm39) R361L probably damaging Het
Duoxa1 T C 2: 122,135,622 (GRCm39) E159G probably damaging Het
Exoc1 T A 5: 76,711,079 (GRCm39) S659R probably benign Het
Fbln7 T C 2: 128,719,314 (GRCm39) I37T probably benign Het
Fcgrt T G 7: 44,744,853 (GRCm39) E205A possibly damaging Het
Fcho2 A T 13: 98,900,202 (GRCm39) S304T probably damaging Het
Gbp9 C A 5: 105,253,587 (GRCm39) G43* probably null Het
Gucy2d A G 7: 98,123,868 (GRCm39) K151R probably benign Het
Heatr4 T A 12: 84,024,829 (GRCm39) I331F probably damaging Het
Hmcn1 G A 1: 150,485,378 (GRCm39) T4408I probably damaging Het
Hoxc9 C T 15: 102,890,551 (GRCm39) T156M probably benign Het
Hrnr A T 3: 93,227,987 (GRCm39) E35V probably damaging Het
Idua C T 5: 108,818,037 (GRCm39) Q70* probably null Het
Klf5 A T 14: 99,539,189 (GRCm39) I201F probably damaging Het
Lonrf1 T C 8: 36,701,164 (GRCm39) K349E probably damaging Het
Lrp1b A T 2: 41,158,395 (GRCm39) D1721E Het
Mdh1 T A 11: 21,521,870 (GRCm39) probably benign Het
Mllt11 T C 3: 95,127,521 (GRCm39) H83R probably benign Het
Mrgprb4 A C 7: 47,848,583 (GRCm39) I115S possibly damaging Het
Mrpl38 A G 11: 116,023,296 (GRCm39) F319S probably damaging Het
Naif1 A T 2: 32,344,907 (GRCm39) M204L probably benign Het
Ncan T A 8: 70,554,628 (GRCm39) D1063V probably damaging Het
Noto A T 6: 85,401,327 (GRCm39) R119W possibly damaging Het
Or4c115 G A 2: 88,927,573 (GRCm39) L233F probably benign Het
Or51h7 A T 7: 102,591,165 (GRCm39) D206E probably damaging Het
Or6c69 T A 10: 129,748,048 (GRCm39) Y33F probably damaging Het
Or8b3 A T 9: 38,314,841 (GRCm39) I224F probably damaging Het
Ovch2 A G 7: 107,393,584 (GRCm39) W181R probably damaging Het
Palm G C 10: 79,655,117 (GRCm39) G292R probably damaging Het
Pdgfrb T A 18: 61,205,787 (GRCm39) L591* probably null Het
Pik3c2g T C 6: 139,841,910 (GRCm39) S772P Het
Prx C A 7: 27,217,411 (GRCm39) D776E probably benign Het
Rbm4b A G 19: 4,807,359 (GRCm39) Y25C probably damaging Het
Reln T C 5: 22,136,427 (GRCm39) T2534A probably benign Het
Rnf123 T C 9: 107,954,963 (GRCm39) S14G probably benign Het
Rock2 A G 12: 17,015,602 (GRCm39) H833R probably benign Het
Rxfp3 A G 15: 11,037,111 (GRCm39) V87A possibly damaging Het
S100b G A 10: 76,092,936 (GRCm39) G23D probably damaging Het
Scn9a T A 2: 66,357,002 (GRCm39) M1100L probably benign Het
Septin11 T A 5: 93,296,266 (GRCm39) S55T possibly damaging Het
Speer4a3 T C 5: 26,154,829 (GRCm39) E257G probably damaging Het
Sv2b T A 7: 74,769,676 (GRCm39) Q622L probably benign Het
Taar7a T C 10: 23,868,799 (GRCm39) D194G probably benign Het
Trappc3 T C 4: 126,169,014 (GRCm39) I168T probably benign Het
Trim27 T C 13: 21,374,296 (GRCm39) probably null Het
Wdr49 G A 3: 75,304,359 (GRCm39) T109I probably benign Het
Wdr64 T C 1: 175,544,854 (GRCm39) Y96H probably damaging Het
Zfp219 A T 14: 52,247,049 (GRCm39) L26Q probably damaging Het
Zfp758 T A 17: 22,593,829 (GRCm39) V105D possibly damaging Het
Zfp975 C G 7: 42,312,332 (GRCm39) E94Q possibly damaging Het
Zfyve9 C T 4: 108,539,334 (GRCm39) A289T probably benign Het
Zscan5b T C 7: 6,234,525 (GRCm39) S184P possibly damaging Het
Other mutations in Ptpra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Ptpra APN 2 130,386,359 (GRCm39) missense probably damaging 1.00
IGL01734:Ptpra APN 2 130,385,997 (GRCm39) missense probably damaging 1.00
IGL02066:Ptpra APN 2 30,333,308 (GRCm39) missense possibly damaging 0.83
IGL02073:Ptpra APN 2 30,333,362 (GRCm39) missense probably damaging 1.00
IGL02201:Ptpra APN 2 30,336,389 (GRCm39) missense possibly damaging 0.91
IGL02218:Ptpra APN 2 130,394,255 (GRCm39) splice site probably benign
IGL02385:Ptpra APN 2 130,382,393 (GRCm39) unclassified probably benign
IGL02480:Ptpra APN 2 130,346,181 (GRCm39) missense probably benign 0.09
IGL03181:Ptpra APN 2 130,359,707 (GRCm39) missense probably damaging 0.99
R0374:Ptpra UTSW 2 130,379,541 (GRCm39) missense probably damaging 1.00
R0483:Ptpra UTSW 2 130,381,605 (GRCm39) missense probably damaging 1.00
R0848:Ptpra UTSW 2 130,360,911 (GRCm39) missense probably damaging 1.00
R1550:Ptpra UTSW 2 130,383,313 (GRCm39) missense possibly damaging 0.86
R1596:Ptpra UTSW 2 130,386,872 (GRCm39) missense probably damaging 1.00
R1602:Ptpra UTSW 2 30,327,602 (GRCm39) missense probably benign 0.22
R1689:Ptpra UTSW 2 130,345,412 (GRCm39) missense probably benign 0.01
R1760:Ptpra UTSW 2 130,391,747 (GRCm39) missense probably damaging 1.00
R1943:Ptpra UTSW 2 130,386,024 (GRCm39) missense probably damaging 1.00
R2114:Ptpra UTSW 2 130,381,655 (GRCm39) missense probably damaging 1.00
R2115:Ptpra UTSW 2 130,381,655 (GRCm39) missense probably damaging 1.00
R2117:Ptpra UTSW 2 130,381,655 (GRCm39) missense probably damaging 1.00
R2187:Ptpra UTSW 2 130,346,219 (GRCm39) missense probably benign
R2848:Ptpra UTSW 2 130,386,919 (GRCm39) missense probably benign 0.06
R2849:Ptpra UTSW 2 130,386,919 (GRCm39) missense probably benign 0.06
R3962:Ptpra UTSW 2 30,325,672 (GRCm39) missense probably damaging 1.00
R4080:Ptpra UTSW 2 30,333,317 (GRCm39) missense probably damaging 1.00
R4644:Ptpra UTSW 2 130,386,078 (GRCm39) missense probably damaging 1.00
R4779:Ptpra UTSW 2 130,379,537 (GRCm39) missense probably damaging 1.00
R4849:Ptpra UTSW 2 130,374,081 (GRCm39) missense probably damaging 1.00
R4899:Ptpra UTSW 2 130,386,356 (GRCm39) missense probably damaging 1.00
R5186:Ptpra UTSW 2 30,328,367 (GRCm39) critical splice donor site probably null
R5657:Ptpra UTSW 2 130,346,204 (GRCm39) missense probably benign 0.06
R6018:Ptpra UTSW 2 130,345,422 (GRCm39) missense probably benign
R6234:Ptpra UTSW 2 130,379,508 (GRCm39) missense probably damaging 1.00
R6350:Ptpra UTSW 2 130,382,512 (GRCm39) missense probably damaging 1.00
R6622:Ptpra UTSW 2 30,327,589 (GRCm39) missense probably damaging 1.00
R6856:Ptpra UTSW 2 130,361,301 (GRCm39) missense probably damaging 1.00
R7072:Ptpra UTSW 2 130,395,350 (GRCm39) missense probably damaging 1.00
R7146:Ptpra UTSW 2 130,379,571 (GRCm39) critical splice donor site probably null
R7220:Ptpra UTSW 2 130,386,417 (GRCm39) missense probably damaging 1.00
R7346:Ptpra UTSW 2 130,395,320 (GRCm39) missense probably damaging 1.00
R7819:Ptpra UTSW 2 130,346,126 (GRCm39) missense probably benign
R7943:Ptpra UTSW 2 30,322,056 (GRCm39) missense probably damaging 1.00
R8044:Ptpra UTSW 2 130,386,881 (GRCm39) missense possibly damaging 0.93
R8190:Ptpra UTSW 2 30,328,351 (GRCm39) missense probably damaging 1.00
R8231:Ptpra UTSW 2 130,379,523 (GRCm39) missense probably damaging 1.00
R8404:Ptpra UTSW 2 130,391,679 (GRCm39) missense probably damaging 1.00
R8422:Ptpra UTSW 2 130,374,091 (GRCm39) missense possibly damaging 0.86
R8502:Ptpra UTSW 2 130,391,679 (GRCm39) missense probably damaging 1.00
R8683:Ptpra UTSW 2 130,394,187 (GRCm39) missense possibly damaging 0.88
R8952:Ptpra UTSW 2 130,386,969 (GRCm39) missense probably damaging 1.00
R9147:Ptpra UTSW 2 30,328,256 (GRCm39) missense probably benign 0.21
R9147:Ptpra UTSW 2 30,328,255 (GRCm39) missense probably damaging 1.00
R9148:Ptpra UTSW 2 30,328,256 (GRCm39) missense probably benign 0.21
R9148:Ptpra UTSW 2 30,328,255 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAGACCTCTGTGATCCAC -3'
(R):5'- TGCTGAACATGAGAATCACCG -3'

Sequencing Primer
(F):5'- GATCCACATTTCAGATGCAGTACGTC -3'
(R):5'- TGAGAGGTGTAAGGAAATACTGTTTC -3'
Posted On 2022-10-06