Mutagenetix > Incidental Mutation

Incidental Mutation 'R9717:Arhgap29'

730511

Institutional Source

Beutler Lab

Gene Symbol

Arhgap29

Ensembl Gene

ENSMUSG00000039831

Gene Name

Rho GTPase activating protein 29

Synonyms

B130017I01Rik, 6720461J18Rik, C76601, Parg1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9717 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

121952541-122016753 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 122004271 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 537 (F537L)

Ref Sequence

ENSEMBL: ENSMUSP00000044624 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037958] [ENSMUST00000197155]

AlphaFold

Q8CGF1

Predicted Effect

probably benign
Transcript: ENSMUST00000037958
AA Change: F537L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000044624
Gene: ENSMUSG00000039831
AA Change: F537L

Domain	Start	End	E-Value	Type
low complexity region	5	12	N/A	INTRINSIC
PDB:3QWE\|A	193	469	5e-41	PDB
Blast:RhoGAP	412	595	9e-84	BLAST
C1	613	659	2.48e-6	SMART
RhoGAP	684	885	1.92e-68	SMART
low complexity region	947	961	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197155
AA Change: F537L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000142945
Gene: ENSMUSG00000039831
AA Change: F537L

Domain	Start	End	E-Value	Type
low complexity region	5	12	N/A	INTRINSIC
PDB:3QWE\|A	193	469	8e-42	PDB
Blast:RhoGAP	412	595	2e-87	BLAST
C1	613	659	2.48e-6	SMART
RhoGAP	684	780	1.14e-6	SMART

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rap1 is a small GTPase that, through effectors, regulates Rho GTPase signaling. These effectors- Rasip1, Radil, and the protein encoded by this gene- translocate to the cell membrane, where they form a multiprotein complex. This complex is necessary for Rap1-induced inhibition of Rho signaling. Defects in this gene may be a cause of nonsyndromic cleft lip with or without cleft palate. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	T	A	13: 81,520,781	N2552I	probably damaging	Het
Amph	G	T	13: 19,125,083	A444S	probably benign	Het
Ankrd52	A	G	10: 128,380,588	N157S	probably benign	Het
Asic1	A	C	15: 99,692,776	T136P	probably damaging	Het
Atg2b	T	C	12: 105,639,302	Y1468C	probably benign	Het
Atm	A	G	9: 53,516,517	L431P	probably damaging	Het
Btaf1	A	G	19: 36,945,246	T17A	probably benign	Het
Car10	A	G	11: 93,304,541	N58S	probably benign	Het
Cd79b	A	T	11: 106,312,019	D252E	probably damaging	Het
Cdipt	C	T	7: 126,977,030		probably benign	Het
Cebpe	T	C	14: 54,711,708	D84G	probably damaging	Het
Cenpj	T	C	14: 56,552,996	E532G	probably benign	Het
Cherp	A	G	8: 72,463,076		probably null	Het
Chuk	T	C	19: 44,082,670	D532G	possibly damaging	Het
Clec1b	C	T	6: 129,397,640	T9I	probably benign	Het
Clspn	G	T	4: 126,564,963	A280S	possibly damaging	Het
Cts3	T	G	13: 61,564,985	Y307S	probably benign	Het
Cyp2c39	T	C	19: 39,568,049	M443T	possibly damaging	Het
Dhx57	C	T	17: 80,275,018	R386H	probably damaging	Het
Dhx58	A	T	11: 100,701,307	M305K	probably benign	Het
Dlgap3	T	C	4: 127,235,494	L894P	probably damaging	Het
Dnah3	A	T	7: 119,975,076	N2164K	probably damaging	Het
Dnajb14	A	G	3: 137,902,283	N183S	probably benign	Het
Drd5	G	T	5: 38,320,747	R361L	probably damaging	Het
Duoxa1	T	C	2: 122,305,141	E159G	probably damaging	Het
Exoc1	T	A	5: 76,563,232	S659R	probably benign	Het
Fam214b	T	C	4: 43,036,050	H227R	probably damaging	Het
Fbln7	T	C	2: 128,877,394	I37T	probably benign	Het
Fcgrt	T	G	7: 45,095,429	E205A	possibly damaging	Het
Fcho2	A	T	13: 98,763,694	S304T	probably damaging	Het
Gbp9	C	A	5: 105,105,721	G43*	probably null	Het
Gm21671	T	C	5: 25,949,831	E257G	probably damaging	Het
Gucy2d	A	G	7: 98,474,661	K151R	probably benign	Het
Heatr4	T	A	12: 83,978,055	I331F	probably damaging	Het
Hmcn1	G	A	1: 150,609,627	T4408I	probably damaging	Het
Hoxc9	C	T	15: 102,982,119	T156M	probably benign	Het
Hrnr	A	T	3: 93,320,680	E35V	probably damaging	Het
Idua	C	T	5: 108,670,171	Q70*	probably null	Het
Klf5	A	T	14: 99,301,753	I201F	probably damaging	Het
Lonrf1	T	C	8: 36,234,010	K349E	probably damaging	Het
Lrp1b	A	T	2: 41,268,383	D1721E		Het
Mdh1	T	A	11: 21,571,870		probably benign	Het
Mllt11	T	C	3: 95,220,210	H83R	probably benign	Het
Mrgprb4	A	C	7: 48,198,835	I115S	possibly damaging	Het
Mrpl38	A	G	11: 116,132,470	F319S	probably damaging	Het
Naif1	A	T	2: 32,454,895	M204L	probably benign	Het
Ncan	T	A	8: 70,101,978	D1063V	probably damaging	Het
Noto	A	T	6: 85,424,345	R119W	possibly damaging	Het
Olfr1220	G	A	2: 89,097,229	L233F	probably benign	Het
Olfr147	A	T	9: 38,403,545	I224F	probably damaging	Het
Olfr573-ps1	A	T	7: 102,941,958	D206E	probably damaging	Het
Olfr816	T	A	10: 129,912,179	Y33F	probably damaging	Het
Ovch2	A	G	7: 107,794,377	W181R	probably damaging	Het
Palm	G	C	10: 79,819,283	G292R	probably damaging	Het
Pdgfrb	T	A	18: 61,072,715	L591*	probably null	Het
Pik3c2g	T	C	6: 139,896,184	S772P		Het
Prx	C	A	7: 27,517,986	D776E	probably benign	Het
Ptpra	A	G	2: 130,542,446	E562G	possibly damaging	Het
Rbm4b	A	G	19: 4,757,331	Y25C	probably damaging	Het
Reln	T	C	5: 21,931,429	T2534A	probably benign	Het
Rnf123	T	C	9: 108,077,764	S14G	probably benign	Het
Rock2	A	G	12: 16,965,601	H833R	probably benign	Het
Rxfp3	A	G	15: 11,037,025	V87A	possibly damaging	Het
S100b	G	A	10: 76,257,102	G23D	probably damaging	Het
Scn9a	T	A	2: 66,526,658	M1100L	probably benign	Het
Sept11	T	A	5: 93,148,407	S55T	possibly damaging	Het
Sv2b	T	A	7: 75,119,928	Q622L	probably benign	Het
Taar7a	T	C	10: 23,992,901	D194G	probably benign	Het
Trappc3	T	C	4: 126,275,221	I168T	probably benign	Het
Trim27	T	C	13: 21,190,126		probably null	Het
Wdr49	G	A	3: 75,397,052	T109I	probably benign	Het
Wdr64	T	C	1: 175,717,288	Y96H	probably damaging	Het
Zfp219	A	T	14: 52,009,592	L26Q	probably damaging	Het
Zfp758	T	A	17: 22,374,848	V105D	possibly damaging	Het
Zfp975	C	G	7: 42,662,908	E94Q	possibly damaging	Het
Zfyve9	C	T	4: 108,682,137	A289T	probably benign	Het
Zscan5b	T	C	7: 6,231,526	S184P	possibly damaging	Het

Other mutations in Arhgap29

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Arhgap29	APN	3	122003312	nonsense	probably null
IGL01121:Arhgap29	APN	3	122009863	missense	probably damaging	1.00
IGL01622:Arhgap29	APN	3	121974124	splice site	probably benign
IGL01623:Arhgap29	APN	3	121974124	splice site	probably benign
IGL01995:Arhgap29	APN	3	122014328	missense	probably benign	0.00
IGL02120:Arhgap29	APN	3	122004257	missense	probably benign	0.05
IGL02554:Arhgap29	APN	3	121992524	unclassified	probably benign
IGL02931:Arhgap29	APN	3	121992860	missense	probably benign
IGL02937:Arhgap29	APN	3	121974049	missense	probably damaging	0.99
PIT4362001:Arhgap29	UTSW	3	122003212	missense	probably benign	0.42
R0022:Arhgap29	UTSW	3	121988937	missense	possibly damaging	0.61
R0574:Arhgap29	UTSW	3	122007625	missense	probably benign	0.01
R0601:Arhgap29	UTSW	3	121991110	missense	probably damaging	1.00
R0639:Arhgap29	UTSW	3	122007641	missense	probably damaging	1.00
R0881:Arhgap29	UTSW	3	122014679	missense	probably damaging	1.00
R1232:Arhgap29	UTSW	3	122003340	missense	probably damaging	1.00
R1295:Arhgap29	UTSW	3	121992395	missense	probably benign	0.27
R1296:Arhgap29	UTSW	3	121992395	missense	probably benign	0.27
R1403:Arhgap29	UTSW	3	121973929	missense	probably damaging	1.00
R1403:Arhgap29	UTSW	3	121973929	missense	probably damaging	1.00
R1470:Arhgap29	UTSW	3	121992319	unclassified	probably benign
R1710:Arhgap29	UTSW	3	122008080	missense	probably damaging	1.00
R1878:Arhgap29	UTSW	3	122011371	missense	probably damaging	1.00
R2051:Arhgap29	UTSW	3	121981860	missense	probably benign	0.01
R2112:Arhgap29	UTSW	3	122011561	missense	probably benign	0.03
R2188:Arhgap29	UTSW	3	121991009	missense	probably damaging	1.00
R2240:Arhgap29	UTSW	3	122011453	missense	probably benign	0.12
R2420:Arhgap29	UTSW	3	121973980	missense	probably benign
R3618:Arhgap29	UTSW	3	121988527	missense	possibly damaging	0.62
R4673:Arhgap29	UTSW	3	122014971	missense	probably damaging	1.00
R4717:Arhgap29	UTSW	3	122009958	missense	possibly damaging	0.82
R5028:Arhgap29	UTSW	3	122010060	critical splice donor site	probably null
R5043:Arhgap29	UTSW	3	121974004	missense	probably benign	0.00
R5045:Arhgap29	UTSW	3	122002595	missense	probably benign	0.28
R5463:Arhgap29	UTSW	3	121988551	missense	possibly damaging	0.94
R5495:Arhgap29	UTSW	3	122014929	missense	probably damaging	1.00
R5743:Arhgap29	UTSW	3	121981911	missense	probably damaging	1.00
R5791:Arhgap29	UTSW	3	122014245	missense	probably damaging	0.98
R5896:Arhgap29	UTSW	3	122012087	missense	possibly damaging	0.78
R6083:Arhgap29	UTSW	3	121992748	missense	probably benign	0.00
R6355:Arhgap29	UTSW	3	122011258	missense	possibly damaging	0.46
R6451:Arhgap29	UTSW	3	121993581	missense	probably damaging	1.00
R6528:Arhgap29	UTSW	3	122014702	missense	probably benign	0.13
R7239:Arhgap29	UTSW	3	121988950	missense	probably benign	0.16
R7669:Arhgap29	UTSW	3	121992812	missense	probably damaging	1.00
R7807:Arhgap29	UTSW	3	122014332	missense	probably benign	0.01
R8045:Arhgap29	UTSW	3	122007562	synonymous	silent
R8048:Arhgap29	UTSW	3	121992901	missense	probably damaging	1.00
R8165:Arhgap29	UTSW	3	121988573	missense	probably damaging	0.98
R9001:Arhgap29	UTSW	3	121981874	missense	probably benign	0.03
R9032:Arhgap29	UTSW	3	122014600	missense	probably benign
R9060:Arhgap29	UTSW	3	121990324	missense	probably damaging	0.99
R9085:Arhgap29	UTSW	3	122014600	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCTACCTGTAGGCAAGGGTT -3'
(R):5'- ACATATGCATGTATATTCGCTTATGT -3'

Sequencing Primer
(F):5'- TCCATCCACTGTTGAATGAAGC -3'
(R):5'- CGCTTATGTCTGAGATAGTTCAAAC -3'

Posted On

2022-10-06