Incidental Mutation 'R9717:Arhgap29'
ID 730511
Institutional Source Beutler Lab
Gene Symbol Arhgap29
Ensembl Gene ENSMUSG00000039831
Gene Name Rho GTPase activating protein 29
Synonyms B130017I01Rik, 6720461J18Rik, C76601, Parg1
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 121952541-122016753 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 122004271 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 537 (F537L)
Ref Sequence ENSEMBL: ENSMUSP00000044624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037958] [ENSMUST00000197155]
AlphaFold Q8CGF1
Predicted Effect probably benign
Transcript: ENSMUST00000037958
AA Change: F537L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000044624
Gene: ENSMUSG00000039831
AA Change: F537L

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
PDB:3QWE|A 193 469 5e-41 PDB
Blast:RhoGAP 412 595 9e-84 BLAST
C1 613 659 2.48e-6 SMART
RhoGAP 684 885 1.92e-68 SMART
low complexity region 947 961 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197155
AA Change: F537L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000142945
Gene: ENSMUSG00000039831
AA Change: F537L

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
PDB:3QWE|A 193 469 8e-42 PDB
Blast:RhoGAP 412 595 2e-87 BLAST
C1 613 659 2.48e-6 SMART
RhoGAP 684 780 1.14e-6 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rap1 is a small GTPase that, through effectors, regulates Rho GTPase signaling. These effectors- Rasip1, Radil, and the protein encoded by this gene- translocate to the cell membrane, where they form a multiprotein complex. This complex is necessary for Rap1-induced inhibition of Rho signaling. Defects in this gene may be a cause of nonsyndromic cleft lip with or without cleft palate. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,520,781 N2552I probably damaging Het
Amph G T 13: 19,125,083 A444S probably benign Het
Ankrd52 A G 10: 128,380,588 N157S probably benign Het
Asic1 A C 15: 99,692,776 T136P probably damaging Het
Atg2b T C 12: 105,639,302 Y1468C probably benign Het
Atm A G 9: 53,516,517 L431P probably damaging Het
Btaf1 A G 19: 36,945,246 T17A probably benign Het
Car10 A G 11: 93,304,541 N58S probably benign Het
Cd79b A T 11: 106,312,019 D252E probably damaging Het
Cdipt C T 7: 126,977,030 probably benign Het
Cebpe T C 14: 54,711,708 D84G probably damaging Het
Cenpj T C 14: 56,552,996 E532G probably benign Het
Cherp A G 8: 72,463,076 probably null Het
Chuk T C 19: 44,082,670 D532G possibly damaging Het
Clec1b C T 6: 129,397,640 T9I probably benign Het
Clspn G T 4: 126,564,963 A280S possibly damaging Het
Cts3 T G 13: 61,564,985 Y307S probably benign Het
Cyp2c39 T C 19: 39,568,049 M443T possibly damaging Het
Dhx57 C T 17: 80,275,018 R386H probably damaging Het
Dhx58 A T 11: 100,701,307 M305K probably benign Het
Dlgap3 T C 4: 127,235,494 L894P probably damaging Het
Dnah3 A T 7: 119,975,076 N2164K probably damaging Het
Dnajb14 A G 3: 137,902,283 N183S probably benign Het
Drd5 G T 5: 38,320,747 R361L probably damaging Het
Duoxa1 T C 2: 122,305,141 E159G probably damaging Het
Exoc1 T A 5: 76,563,232 S659R probably benign Het
Fam214b T C 4: 43,036,050 H227R probably damaging Het
Fbln7 T C 2: 128,877,394 I37T probably benign Het
Fcgrt T G 7: 45,095,429 E205A possibly damaging Het
Fcho2 A T 13: 98,763,694 S304T probably damaging Het
Gbp9 C A 5: 105,105,721 G43* probably null Het
Gm21671 T C 5: 25,949,831 E257G probably damaging Het
Gucy2d A G 7: 98,474,661 K151R probably benign Het
Heatr4 T A 12: 83,978,055 I331F probably damaging Het
Hmcn1 G A 1: 150,609,627 T4408I probably damaging Het
Hoxc9 C T 15: 102,982,119 T156M probably benign Het
Hrnr A T 3: 93,320,680 E35V probably damaging Het
Idua C T 5: 108,670,171 Q70* probably null Het
Klf5 A T 14: 99,301,753 I201F probably damaging Het
Lonrf1 T C 8: 36,234,010 K349E probably damaging Het
Lrp1b A T 2: 41,268,383 D1721E Het
Mdh1 T A 11: 21,571,870 probably benign Het
Mllt11 T C 3: 95,220,210 H83R probably benign Het
Mrgprb4 A C 7: 48,198,835 I115S possibly damaging Het
Mrpl38 A G 11: 116,132,470 F319S probably damaging Het
Naif1 A T 2: 32,454,895 M204L probably benign Het
Ncan T A 8: 70,101,978 D1063V probably damaging Het
Noto A T 6: 85,424,345 R119W possibly damaging Het
Olfr1220 G A 2: 89,097,229 L233F probably benign Het
Olfr147 A T 9: 38,403,545 I224F probably damaging Het
Olfr573-ps1 A T 7: 102,941,958 D206E probably damaging Het
Olfr816 T A 10: 129,912,179 Y33F probably damaging Het
Ovch2 A G 7: 107,794,377 W181R probably damaging Het
Palm G C 10: 79,819,283 G292R probably damaging Het
Pdgfrb T A 18: 61,072,715 L591* probably null Het
Pik3c2g T C 6: 139,896,184 S772P Het
Prx C A 7: 27,517,986 D776E probably benign Het
Ptpra A G 2: 130,542,446 E562G possibly damaging Het
Rbm4b A G 19: 4,757,331 Y25C probably damaging Het
Reln T C 5: 21,931,429 T2534A probably benign Het
Rnf123 T C 9: 108,077,764 S14G probably benign Het
Rock2 A G 12: 16,965,601 H833R probably benign Het
Rxfp3 A G 15: 11,037,025 V87A possibly damaging Het
S100b G A 10: 76,257,102 G23D probably damaging Het
Scn9a T A 2: 66,526,658 M1100L probably benign Het
Sept11 T A 5: 93,148,407 S55T possibly damaging Het
Sv2b T A 7: 75,119,928 Q622L probably benign Het
Taar7a T C 10: 23,992,901 D194G probably benign Het
Trappc3 T C 4: 126,275,221 I168T probably benign Het
Trim27 T C 13: 21,190,126 probably null Het
Wdr49 G A 3: 75,397,052 T109I probably benign Het
Wdr64 T C 1: 175,717,288 Y96H probably damaging Het
Zfp219 A T 14: 52,009,592 L26Q probably damaging Het
Zfp758 T A 17: 22,374,848 V105D possibly damaging Het
Zfp975 C G 7: 42,662,908 E94Q possibly damaging Het
Zfyve9 C T 4: 108,682,137 A289T probably benign Het
Zscan5b T C 7: 6,231,526 S184P possibly damaging Het
Other mutations in Arhgap29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Arhgap29 APN 3 122003312 nonsense probably null
IGL01121:Arhgap29 APN 3 122009863 missense probably damaging 1.00
IGL01622:Arhgap29 APN 3 121974124 splice site probably benign
IGL01623:Arhgap29 APN 3 121974124 splice site probably benign
IGL01995:Arhgap29 APN 3 122014328 missense probably benign 0.00
IGL02120:Arhgap29 APN 3 122004257 missense probably benign 0.05
IGL02554:Arhgap29 APN 3 121992524 unclassified probably benign
IGL02931:Arhgap29 APN 3 121992860 missense probably benign
IGL02937:Arhgap29 APN 3 121974049 missense probably damaging 0.99
PIT4362001:Arhgap29 UTSW 3 122003212 missense probably benign 0.42
R0022:Arhgap29 UTSW 3 121988937 missense possibly damaging 0.61
R0574:Arhgap29 UTSW 3 122007625 missense probably benign 0.01
R0601:Arhgap29 UTSW 3 121991110 missense probably damaging 1.00
R0639:Arhgap29 UTSW 3 122007641 missense probably damaging 1.00
R0881:Arhgap29 UTSW 3 122014679 missense probably damaging 1.00
R1232:Arhgap29 UTSW 3 122003340 missense probably damaging 1.00
R1295:Arhgap29 UTSW 3 121992395 missense probably benign 0.27
R1296:Arhgap29 UTSW 3 121992395 missense probably benign 0.27
R1403:Arhgap29 UTSW 3 121973929 missense probably damaging 1.00
R1403:Arhgap29 UTSW 3 121973929 missense probably damaging 1.00
R1470:Arhgap29 UTSW 3 121992319 unclassified probably benign
R1710:Arhgap29 UTSW 3 122008080 missense probably damaging 1.00
R1878:Arhgap29 UTSW 3 122011371 missense probably damaging 1.00
R2051:Arhgap29 UTSW 3 121981860 missense probably benign 0.01
R2112:Arhgap29 UTSW 3 122011561 missense probably benign 0.03
R2188:Arhgap29 UTSW 3 121991009 missense probably damaging 1.00
R2240:Arhgap29 UTSW 3 122011453 missense probably benign 0.12
R2420:Arhgap29 UTSW 3 121973980 missense probably benign
R3618:Arhgap29 UTSW 3 121988527 missense possibly damaging 0.62
R4673:Arhgap29 UTSW 3 122014971 missense probably damaging 1.00
R4717:Arhgap29 UTSW 3 122009958 missense possibly damaging 0.82
R5028:Arhgap29 UTSW 3 122010060 critical splice donor site probably null
R5043:Arhgap29 UTSW 3 121974004 missense probably benign 0.00
R5045:Arhgap29 UTSW 3 122002595 missense probably benign 0.28
R5463:Arhgap29 UTSW 3 121988551 missense possibly damaging 0.94
R5495:Arhgap29 UTSW 3 122014929 missense probably damaging 1.00
R5743:Arhgap29 UTSW 3 121981911 missense probably damaging 1.00
R5791:Arhgap29 UTSW 3 122014245 missense probably damaging 0.98
R5896:Arhgap29 UTSW 3 122012087 missense possibly damaging 0.78
R6083:Arhgap29 UTSW 3 121992748 missense probably benign 0.00
R6355:Arhgap29 UTSW 3 122011258 missense possibly damaging 0.46
R6451:Arhgap29 UTSW 3 121993581 missense probably damaging 1.00
R6528:Arhgap29 UTSW 3 122014702 missense probably benign 0.13
R7239:Arhgap29 UTSW 3 121988950 missense probably benign 0.16
R7669:Arhgap29 UTSW 3 121992812 missense probably damaging 1.00
R7807:Arhgap29 UTSW 3 122014332 missense probably benign 0.01
R8045:Arhgap29 UTSW 3 122007562 synonymous silent
R8048:Arhgap29 UTSW 3 121992901 missense probably damaging 1.00
R8165:Arhgap29 UTSW 3 121988573 missense probably damaging 0.98
R9001:Arhgap29 UTSW 3 121981874 missense probably benign 0.03
R9032:Arhgap29 UTSW 3 122014600 missense probably benign
R9060:Arhgap29 UTSW 3 121990324 missense probably damaging 0.99
R9085:Arhgap29 UTSW 3 122014600 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTACCTGTAGGCAAGGGTT -3'
(R):5'- ACATATGCATGTATATTCGCTTATGT -3'

Sequencing Primer
(F):5'- TCCATCCACTGTTGAATGAAGC -3'
(R):5'- CGCTTATGTCTGAGATAGTTCAAAC -3'
Posted On 2022-10-06