Incidental Mutation 'R9717:Zfyve9'
ID 730514
Institutional Source Beutler Lab
Gene Symbol Zfyve9
Ensembl Gene ENSMUSG00000034557
Gene Name zinc finger, FYVE domain containing 9
Synonyms Madhip
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.431) question?
Stock # R9717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 108494663-108637995 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 108539334 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 289 (A289T)
Ref Sequence ENSEMBL: ENSMUSP00000039852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042185] [ENSMUST00000106657] [ENSMUST00000106658]
AlphaFold A2A8R0
Predicted Effect probably benign
Transcript: ENSMUST00000042185
AA Change: A289T

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000039852
Gene: ENSMUSG00000034557
AA Change: A289T

DomainStartEndE-ValueType
Blast:FYVE 7 40 4e-7 BLAST
Pfam:SARA 52 92 1e-25 PFAM
Pfam:DUF3480 328 681 1.4e-189 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106657
AA Change: A980T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102268
Gene: ENSMUSG00000034557
AA Change: A980T

DomainStartEndE-ValueType
low complexity region 230 243 N/A INTRINSIC
low complexity region 471 487 N/A INTRINSIC
low complexity region 578 587 N/A INTRINSIC
Blast:FYVE 590 618 7e-6 BLAST
FYVE 663 731 2.38e-26 SMART
Pfam:SARA 745 783 1.3e-22 PFAM
Pfam:DUF3480 1020 1372 1e-178 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106658
AA Change: A921T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102269
Gene: ENSMUSG00000034557
AA Change: A921T

DomainStartEndE-ValueType
low complexity region 230 243 N/A INTRINSIC
low complexity region 471 487 N/A INTRINSIC
low complexity region 578 587 N/A INTRINSIC
Blast:FYVE 590 618 8e-6 BLAST
FYVE 663 731 2.38e-26 SMART
Pfam:DUF3480 960 1313 5.5e-189 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a double zinc finger motif-containing protein that participates in the transforming growth factor-beta (TGFB) signalling pathway. The encoded protein interacts directly with SMAD2 and SMAD3, and recruits SMAD2 to the TGFB receptor. There are multiple pseudogenes for this gene on chromosomes 2, 15, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,668,900 (GRCm39) N2552I probably damaging Het
Amph G T 13: 19,309,253 (GRCm39) A444S probably benign Het
Ankrd52 A G 10: 128,216,457 (GRCm39) N157S probably benign Het
Arhgap29 T C 3: 121,797,920 (GRCm39) F537L probably benign Het
Asic1 A C 15: 99,590,657 (GRCm39) T136P probably damaging Het
Atg2b T C 12: 105,605,561 (GRCm39) Y1468C probably benign Het
Atm A G 9: 53,427,817 (GRCm39) L431P probably damaging Het
Atosb T C 4: 43,036,050 (GRCm39) H227R probably damaging Het
Btaf1 A G 19: 36,922,646 (GRCm39) T17A probably benign Het
Car10 A G 11: 93,195,367 (GRCm39) N58S probably benign Het
Cd79b A T 11: 106,202,845 (GRCm39) D252E probably damaging Het
Cdipt C T 7: 126,576,202 (GRCm39) probably benign Het
Cebpe T C 14: 54,949,165 (GRCm39) D84G probably damaging Het
Cenpj T C 14: 56,790,453 (GRCm39) E532G probably benign Het
Cherp A G 8: 73,216,920 (GRCm39) probably null Het
Chuk T C 19: 44,071,109 (GRCm39) D532G possibly damaging Het
Clec1b C T 6: 129,374,603 (GRCm39) T9I probably benign Het
Clspn G T 4: 126,458,756 (GRCm39) A280S possibly damaging Het
Cts3 T G 13: 61,712,799 (GRCm39) Y307S probably benign Het
Cyp2c39 T C 19: 39,556,493 (GRCm39) M443T possibly damaging Het
Dhx57 C T 17: 80,582,447 (GRCm39) R386H probably damaging Het
Dhx58 A T 11: 100,592,133 (GRCm39) M305K probably benign Het
Dlgap3 T C 4: 127,129,287 (GRCm39) L894P probably damaging Het
Dnah3 A T 7: 119,574,299 (GRCm39) N2164K probably damaging Het
Dnajb14 A G 3: 137,608,044 (GRCm39) N183S probably benign Het
Drd5 G T 5: 38,478,090 (GRCm39) R361L probably damaging Het
Duoxa1 T C 2: 122,135,622 (GRCm39) E159G probably damaging Het
Exoc1 T A 5: 76,711,079 (GRCm39) S659R probably benign Het
Fbln7 T C 2: 128,719,314 (GRCm39) I37T probably benign Het
Fcgrt T G 7: 44,744,853 (GRCm39) E205A possibly damaging Het
Fcho2 A T 13: 98,900,202 (GRCm39) S304T probably damaging Het
Gbp9 C A 5: 105,253,587 (GRCm39) G43* probably null Het
Gucy2d A G 7: 98,123,868 (GRCm39) K151R probably benign Het
Heatr4 T A 12: 84,024,829 (GRCm39) I331F probably damaging Het
Hmcn1 G A 1: 150,485,378 (GRCm39) T4408I probably damaging Het
Hoxc9 C T 15: 102,890,551 (GRCm39) T156M probably benign Het
Hrnr A T 3: 93,227,987 (GRCm39) E35V probably damaging Het
Idua C T 5: 108,818,037 (GRCm39) Q70* probably null Het
Klf5 A T 14: 99,539,189 (GRCm39) I201F probably damaging Het
Lonrf1 T C 8: 36,701,164 (GRCm39) K349E probably damaging Het
Lrp1b A T 2: 41,158,395 (GRCm39) D1721E Het
Mdh1 T A 11: 21,521,870 (GRCm39) probably benign Het
Mllt11 T C 3: 95,127,521 (GRCm39) H83R probably benign Het
Mrgprb4 A C 7: 47,848,583 (GRCm39) I115S possibly damaging Het
Mrpl38 A G 11: 116,023,296 (GRCm39) F319S probably damaging Het
Naif1 A T 2: 32,344,907 (GRCm39) M204L probably benign Het
Ncan T A 8: 70,554,628 (GRCm39) D1063V probably damaging Het
Noto A T 6: 85,401,327 (GRCm39) R119W possibly damaging Het
Or4c115 G A 2: 88,927,573 (GRCm39) L233F probably benign Het
Or51h7 A T 7: 102,591,165 (GRCm39) D206E probably damaging Het
Or6c69 T A 10: 129,748,048 (GRCm39) Y33F probably damaging Het
Or8b3 A T 9: 38,314,841 (GRCm39) I224F probably damaging Het
Ovch2 A G 7: 107,393,584 (GRCm39) W181R probably damaging Het
Palm G C 10: 79,655,117 (GRCm39) G292R probably damaging Het
Pdgfrb T A 18: 61,205,787 (GRCm39) L591* probably null Het
Pik3c2g T C 6: 139,841,910 (GRCm39) S772P Het
Prx C A 7: 27,217,411 (GRCm39) D776E probably benign Het
Ptpra A G 2: 130,384,366 (GRCm39) E562G possibly damaging Het
Rbm4b A G 19: 4,807,359 (GRCm39) Y25C probably damaging Het
Reln T C 5: 22,136,427 (GRCm39) T2534A probably benign Het
Rnf123 T C 9: 107,954,963 (GRCm39) S14G probably benign Het
Rock2 A G 12: 17,015,602 (GRCm39) H833R probably benign Het
Rxfp3 A G 15: 11,037,111 (GRCm39) V87A possibly damaging Het
S100b G A 10: 76,092,936 (GRCm39) G23D probably damaging Het
Scn9a T A 2: 66,357,002 (GRCm39) M1100L probably benign Het
Septin11 T A 5: 93,296,266 (GRCm39) S55T possibly damaging Het
Speer4a3 T C 5: 26,154,829 (GRCm39) E257G probably damaging Het
Sv2b T A 7: 74,769,676 (GRCm39) Q622L probably benign Het
Taar7a T C 10: 23,868,799 (GRCm39) D194G probably benign Het
Trappc3 T C 4: 126,169,014 (GRCm39) I168T probably benign Het
Trim27 T C 13: 21,374,296 (GRCm39) probably null Het
Wdr49 G A 3: 75,304,359 (GRCm39) T109I probably benign Het
Wdr64 T C 1: 175,544,854 (GRCm39) Y96H probably damaging Het
Zfp219 A T 14: 52,247,049 (GRCm39) L26Q probably damaging Het
Zfp758 T A 17: 22,593,829 (GRCm39) V105D possibly damaging Het
Zfp975 C G 7: 42,312,332 (GRCm39) E94Q possibly damaging Het
Zscan5b T C 7: 6,234,525 (GRCm39) S184P possibly damaging Het
Other mutations in Zfyve9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Zfyve9 APN 4 108,499,304 (GRCm39) missense possibly damaging 0.85
IGL01161:Zfyve9 APN 4 108,538,261 (GRCm39) missense probably damaging 1.00
IGL01404:Zfyve9 APN 4 108,539,348 (GRCm39) missense probably damaging 1.00
IGL01451:Zfyve9 APN 4 108,539,457 (GRCm39) missense probably damaging 0.98
IGL01655:Zfyve9 APN 4 108,499,289 (GRCm39) missense probably damaging 1.00
IGL02567:Zfyve9 APN 4 108,531,720 (GRCm39) missense probably damaging 1.00
IGL02593:Zfyve9 APN 4 108,539,420 (GRCm39) missense possibly damaging 0.73
IGL03169:Zfyve9 APN 4 108,553,022 (GRCm39) missense probably damaging 1.00
IGL03206:Zfyve9 APN 4 108,546,406 (GRCm39) missense possibly damaging 0.88
IGL03288:Zfyve9 APN 4 108,580,996 (GRCm39) splice site probably benign
R0008:Zfyve9 UTSW 4 108,575,902 (GRCm39) missense possibly damaging 0.92
R0008:Zfyve9 UTSW 4 108,575,902 (GRCm39) missense possibly damaging 0.92
R0104:Zfyve9 UTSW 4 108,575,360 (GRCm39) missense probably damaging 1.00
R0104:Zfyve9 UTSW 4 108,575,360 (GRCm39) missense probably damaging 1.00
R0362:Zfyve9 UTSW 4 108,538,166 (GRCm39) missense probably damaging 0.96
R0502:Zfyve9 UTSW 4 108,576,961 (GRCm39) nonsense probably null
R0503:Zfyve9 UTSW 4 108,576,961 (GRCm39) nonsense probably null
R0557:Zfyve9 UTSW 4 108,531,708 (GRCm39) missense probably damaging 0.98
R0835:Zfyve9 UTSW 4 108,575,866 (GRCm39) missense probably damaging 0.99
R1215:Zfyve9 UTSW 4 108,507,426 (GRCm39) missense probably benign 0.32
R1245:Zfyve9 UTSW 4 108,550,508 (GRCm39) intron probably benign
R1527:Zfyve9 UTSW 4 108,552,964 (GRCm39) critical splice donor site probably null
R1638:Zfyve9 UTSW 4 108,542,104 (GRCm39) critical splice donor site probably null
R1653:Zfyve9 UTSW 4 108,517,774 (GRCm39) nonsense probably null
R1728:Zfyve9 UTSW 4 108,575,698 (GRCm39) missense possibly damaging 0.80
R1729:Zfyve9 UTSW 4 108,575,698 (GRCm39) missense possibly damaging 0.80
R1861:Zfyve9 UTSW 4 108,539,492 (GRCm39) splice site probably benign
R1983:Zfyve9 UTSW 4 108,546,386 (GRCm39) missense possibly damaging 0.94
R2050:Zfyve9 UTSW 4 108,576,500 (GRCm39) missense possibly damaging 0.94
R2050:Zfyve9 UTSW 4 108,575,800 (GRCm39) missense probably benign 0.05
R2246:Zfyve9 UTSW 4 108,546,461 (GRCm39) missense possibly damaging 0.70
R2338:Zfyve9 UTSW 4 108,517,811 (GRCm39) missense probably damaging 1.00
R2697:Zfyve9 UTSW 4 108,553,016 (GRCm39) missense probably damaging 0.99
R3522:Zfyve9 UTSW 4 108,576,940 (GRCm39) missense probably benign 0.45
R4030:Zfyve9 UTSW 4 108,576,898 (GRCm39) missense possibly damaging 0.61
R4247:Zfyve9 UTSW 4 108,576,389 (GRCm39) missense probably benign 0.28
R4273:Zfyve9 UTSW 4 108,538,173 (GRCm39) missense probably damaging 1.00
R4720:Zfyve9 UTSW 4 108,501,565 (GRCm39) missense possibly damaging 0.94
R4835:Zfyve9 UTSW 4 108,575,195 (GRCm39) missense possibly damaging 0.70
R4871:Zfyve9 UTSW 4 108,538,183 (GRCm39) missense probably damaging 1.00
R4881:Zfyve9 UTSW 4 108,584,688 (GRCm39) splice site probably null
R4974:Zfyve9 UTSW 4 108,538,097 (GRCm39) critical splice donor site probably null
R5024:Zfyve9 UTSW 4 108,548,866 (GRCm39) missense probably benign 0.18
R5481:Zfyve9 UTSW 4 108,501,546 (GRCm39) missense probably damaging 1.00
R5660:Zfyve9 UTSW 4 108,576,365 (GRCm39) missense probably benign
R5965:Zfyve9 UTSW 4 108,548,878 (GRCm39) missense possibly damaging 0.53
R5996:Zfyve9 UTSW 4 108,576,557 (GRCm39) missense probably benign 0.07
R6315:Zfyve9 UTSW 4 108,531,685 (GRCm39) missense probably damaging 1.00
R6772:Zfyve9 UTSW 4 108,496,466 (GRCm39) missense probably damaging 1.00
R6865:Zfyve9 UTSW 4 108,501,558 (GRCm39) missense possibly damaging 0.71
R7112:Zfyve9 UTSW 4 108,507,519 (GRCm39) missense probably benign 0.00
R7258:Zfyve9 UTSW 4 108,514,151 (GRCm39) missense possibly damaging 0.94
R7266:Zfyve9 UTSW 4 108,575,744 (GRCm39) missense possibly damaging 0.62
R7287:Zfyve9 UTSW 4 108,575,453 (GRCm39) missense probably benign 0.00
R7356:Zfyve9 UTSW 4 108,576,212 (GRCm39) missense probably benign 0.01
R7389:Zfyve9 UTSW 4 108,550,515 (GRCm39) critical splice donor site probably null
R7729:Zfyve9 UTSW 4 108,548,973 (GRCm39) missense probably benign 0.01
R7780:Zfyve9 UTSW 4 108,576,298 (GRCm39) missense possibly damaging 0.81
R7801:Zfyve9 UTSW 4 108,542,192 (GRCm39) missense possibly damaging 0.50
R8069:Zfyve9 UTSW 4 108,542,215 (GRCm39) missense probably benign 0.32
R8201:Zfyve9 UTSW 4 108,507,474 (GRCm39) missense possibly damaging 0.83
R8221:Zfyve9 UTSW 4 108,576,877 (GRCm39) missense possibly damaging 0.77
R8682:Zfyve9 UTSW 4 108,576,539 (GRCm39) missense probably benign 0.30
R8948:Zfyve9 UTSW 4 108,499,288 (GRCm39) missense possibly damaging 0.84
R8960:Zfyve9 UTSW 4 108,501,558 (GRCm39) missense possibly damaging 0.71
R9123:Zfyve9 UTSW 4 108,575,760 (GRCm39) missense probably benign 0.30
R9135:Zfyve9 UTSW 4 108,539,386 (GRCm39) nonsense probably null
R9439:Zfyve9 UTSW 4 108,501,538 (GRCm39) missense probably benign 0.33
R9449:Zfyve9 UTSW 4 108,576,435 (GRCm39) missense probably damaging 1.00
R9560:Zfyve9 UTSW 4 108,575,334 (GRCm39) missense possibly damaging 0.82
R9603:Zfyve9 UTSW 4 108,499,288 (GRCm39) missense possibly damaging 0.84
R9657:Zfyve9 UTSW 4 108,575,729 (GRCm39) missense probably damaging 1.00
R9691:Zfyve9 UTSW 4 108,576,305 (GRCm39) missense probably benign
Z1176:Zfyve9 UTSW 4 108,499,404 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TACCCCAAGGTCAATGGATTCTC -3'
(R):5'- GTATGGGCTTACATGATCTTTCC -3'

Sequencing Primer
(F):5'- GCCTCTAATATAGTCCAAGGGCTG -3'
(R):5'- AACCAAAGGGATGCATGC -3'
Posted On 2022-10-06