Incidental Mutation 'R9717:Speer4a3'
ID 730519
Institutional Source Beutler Lab
Gene Symbol Speer4a3
Ensembl Gene ENSMUSG00000095550
Gene Name spermatogenesis associated glutamate (E)-rich protein 4A3
Synonyms Gm21671
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R9717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 26154795-26159342 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26154829 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 257 (E257G)
Ref Sequence ENSEMBL: ENSMUSP00000133924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162387]
AlphaFold G3UY31
Predicted Effect probably damaging
Transcript: ENSMUST00000162387
AA Change: E257G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133924
Gene: ENSMUSG00000095550
AA Change: E257G

DomainStartEndE-ValueType
Pfam:Takusan 50 134 2.4e-25 PFAM
low complexity region 154 168 N/A INTRINSIC
low complexity region 235 259 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,668,900 (GRCm39) N2552I probably damaging Het
Amph G T 13: 19,309,253 (GRCm39) A444S probably benign Het
Ankrd52 A G 10: 128,216,457 (GRCm39) N157S probably benign Het
Arhgap29 T C 3: 121,797,920 (GRCm39) F537L probably benign Het
Asic1 A C 15: 99,590,657 (GRCm39) T136P probably damaging Het
Atg2b T C 12: 105,605,561 (GRCm39) Y1468C probably benign Het
Atm A G 9: 53,427,817 (GRCm39) L431P probably damaging Het
Atosb T C 4: 43,036,050 (GRCm39) H227R probably damaging Het
Btaf1 A G 19: 36,922,646 (GRCm39) T17A probably benign Het
Car10 A G 11: 93,195,367 (GRCm39) N58S probably benign Het
Cd79b A T 11: 106,202,845 (GRCm39) D252E probably damaging Het
Cdipt C T 7: 126,576,202 (GRCm39) probably benign Het
Cebpe T C 14: 54,949,165 (GRCm39) D84G probably damaging Het
Cenpj T C 14: 56,790,453 (GRCm39) E532G probably benign Het
Cherp A G 8: 73,216,920 (GRCm39) probably null Het
Chuk T C 19: 44,071,109 (GRCm39) D532G possibly damaging Het
Clec1b C T 6: 129,374,603 (GRCm39) T9I probably benign Het
Clspn G T 4: 126,458,756 (GRCm39) A280S possibly damaging Het
Cts3 T G 13: 61,712,799 (GRCm39) Y307S probably benign Het
Cyp2c39 T C 19: 39,556,493 (GRCm39) M443T possibly damaging Het
Dhx57 C T 17: 80,582,447 (GRCm39) R386H probably damaging Het
Dhx58 A T 11: 100,592,133 (GRCm39) M305K probably benign Het
Dlgap3 T C 4: 127,129,287 (GRCm39) L894P probably damaging Het
Dnah3 A T 7: 119,574,299 (GRCm39) N2164K probably damaging Het
Dnajb14 A G 3: 137,608,044 (GRCm39) N183S probably benign Het
Drd5 G T 5: 38,478,090 (GRCm39) R361L probably damaging Het
Duoxa1 T C 2: 122,135,622 (GRCm39) E159G probably damaging Het
Exoc1 T A 5: 76,711,079 (GRCm39) S659R probably benign Het
Fbln7 T C 2: 128,719,314 (GRCm39) I37T probably benign Het
Fcgrt T G 7: 44,744,853 (GRCm39) E205A possibly damaging Het
Fcho2 A T 13: 98,900,202 (GRCm39) S304T probably damaging Het
Gbp9 C A 5: 105,253,587 (GRCm39) G43* probably null Het
Gucy2d A G 7: 98,123,868 (GRCm39) K151R probably benign Het
Heatr4 T A 12: 84,024,829 (GRCm39) I331F probably damaging Het
Hmcn1 G A 1: 150,485,378 (GRCm39) T4408I probably damaging Het
Hoxc9 C T 15: 102,890,551 (GRCm39) T156M probably benign Het
Hrnr A T 3: 93,227,987 (GRCm39) E35V probably damaging Het
Idua C T 5: 108,818,037 (GRCm39) Q70* probably null Het
Klf5 A T 14: 99,539,189 (GRCm39) I201F probably damaging Het
Lonrf1 T C 8: 36,701,164 (GRCm39) K349E probably damaging Het
Lrp1b A T 2: 41,158,395 (GRCm39) D1721E Het
Mdh1 T A 11: 21,521,870 (GRCm39) probably benign Het
Mllt11 T C 3: 95,127,521 (GRCm39) H83R probably benign Het
Mrgprb4 A C 7: 47,848,583 (GRCm39) I115S possibly damaging Het
Mrpl38 A G 11: 116,023,296 (GRCm39) F319S probably damaging Het
Naif1 A T 2: 32,344,907 (GRCm39) M204L probably benign Het
Ncan T A 8: 70,554,628 (GRCm39) D1063V probably damaging Het
Noto A T 6: 85,401,327 (GRCm39) R119W possibly damaging Het
Or4c115 G A 2: 88,927,573 (GRCm39) L233F probably benign Het
Or51h7 A T 7: 102,591,165 (GRCm39) D206E probably damaging Het
Or6c69 T A 10: 129,748,048 (GRCm39) Y33F probably damaging Het
Or8b3 A T 9: 38,314,841 (GRCm39) I224F probably damaging Het
Ovch2 A G 7: 107,393,584 (GRCm39) W181R probably damaging Het
Palm G C 10: 79,655,117 (GRCm39) G292R probably damaging Het
Pdgfrb T A 18: 61,205,787 (GRCm39) L591* probably null Het
Pik3c2g T C 6: 139,841,910 (GRCm39) S772P Het
Prx C A 7: 27,217,411 (GRCm39) D776E probably benign Het
Ptpra A G 2: 130,384,366 (GRCm39) E562G possibly damaging Het
Rbm4b A G 19: 4,807,359 (GRCm39) Y25C probably damaging Het
Reln T C 5: 22,136,427 (GRCm39) T2534A probably benign Het
Rnf123 T C 9: 107,954,963 (GRCm39) S14G probably benign Het
Rock2 A G 12: 17,015,602 (GRCm39) H833R probably benign Het
Rxfp3 A G 15: 11,037,111 (GRCm39) V87A possibly damaging Het
S100b G A 10: 76,092,936 (GRCm39) G23D probably damaging Het
Scn9a T A 2: 66,357,002 (GRCm39) M1100L probably benign Het
Septin11 T A 5: 93,296,266 (GRCm39) S55T possibly damaging Het
Sv2b T A 7: 74,769,676 (GRCm39) Q622L probably benign Het
Taar7a T C 10: 23,868,799 (GRCm39) D194G probably benign Het
Trappc3 T C 4: 126,169,014 (GRCm39) I168T probably benign Het
Trim27 T C 13: 21,374,296 (GRCm39) probably null Het
Wdr49 G A 3: 75,304,359 (GRCm39) T109I probably benign Het
Wdr64 T C 1: 175,544,854 (GRCm39) Y96H probably damaging Het
Zfp219 A T 14: 52,247,049 (GRCm39) L26Q probably damaging Het
Zfp758 T A 17: 22,593,829 (GRCm39) V105D possibly damaging Het
Zfp975 C G 7: 42,312,332 (GRCm39) E94Q possibly damaging Het
Zfyve9 C T 4: 108,539,334 (GRCm39) A289T probably benign Het
Zscan5b T C 7: 6,234,525 (GRCm39) S184P possibly damaging Het
Other mutations in Speer4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Speer4a3 APN 5 26,159,222 (GRCm39) missense probably benign
IGL01018:Speer4a3 APN 5 26,155,721 (GRCm39) missense probably benign
IGL02487:Speer4a3 APN 5 26,156,605 (GRCm39) missense probably benign 0.00
IGL02612:Speer4a3 APN 5 26,156,614 (GRCm39) missense probably benign 0.32
IGL02654:Speer4a3 APN 5 26,158,205 (GRCm39) missense probably benign 0.00
R1344:Speer4a3 UTSW 5 26,158,107 (GRCm39) missense probably benign 0.07
R1462:Speer4a3 UTSW 5 26,156,623 (GRCm39) missense possibly damaging 0.94
R1462:Speer4a3 UTSW 5 26,156,623 (GRCm39) missense possibly damaging 0.94
R2213:Speer4a3 UTSW 5 26,158,175 (GRCm39) missense probably benign
R6856:Speer4a3 UTSW 5 26,155,843 (GRCm39) missense probably benign
R7069:Speer4a3 UTSW 5 26,154,842 (GRCm39) missense possibly damaging 0.94
R7165:Speer4a3 UTSW 5 26,155,849 (GRCm39) small deletion probably benign
R7737:Speer4a3 UTSW 5 26,155,849 (GRCm39) small deletion probably benign
R8393:Speer4a3 UTSW 5 26,158,076 (GRCm39) missense probably damaging 1.00
R8729:Speer4a3 UTSW 5 26,158,178 (GRCm39) missense probably damaging 0.99
R8815:Speer4a3 UTSW 5 26,158,191 (GRCm39) missense probably damaging 1.00
R8901:Speer4a3 UTSW 5 26,155,857 (GRCm39) small deletion probably benign
R8922:Speer4a3 UTSW 5 26,156,594 (GRCm39) missense possibly damaging 0.89
R9125:Speer4a3 UTSW 5 26,156,596 (GRCm39) missense possibly damaging 0.78
R9156:Speer4a3 UTSW 5 26,155,857 (GRCm39) small deletion probably benign
R9451:Speer4a3 UTSW 5 26,156,569 (GRCm39) nonsense probably null
R9474:Speer4a3 UTSW 5 26,158,136 (GRCm39) missense probably damaging 1.00
R9498:Speer4a3 UTSW 5 26,155,849 (GRCm39) small deletion probably benign
R9685:Speer4a3 UTSW 5 26,155,849 (GRCm39) small deletion probably benign
R9766:Speer4a3 UTSW 5 26,155,849 (GRCm39) small deletion probably benign
RF039:Speer4a3 UTSW 5 26,155,857 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TCTGCACTTTTGGCAGCAC -3'
(R):5'- CTGTCAAGTAAAGTTGAGGTAGTG -3'

Sequencing Primer
(F):5'- GCAGCACAGCCCTCCAG -3'
(R):5'- ACTGCAGTCTGAGAGCTTCCATG -3'
Posted On 2022-10-06