Incidental Mutation 'R9717:Drd5'
ID 730520
Institutional Source Beutler Lab
Gene Symbol Drd5
Ensembl Gene ENSMUSG00000039358
Gene Name dopamine receptor D5
Synonyms DRD1b, Drd-5, Drd1b, D5R, Gpcr1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R9717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 38476742-38479868 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 38478090 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 361 (R361L)
Ref Sequence ENSEMBL: ENSMUSP00000039691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041646]
AlphaFold Q8BLD9
Predicted Effect probably damaging
Transcript: ENSMUST00000041646
AA Change: R361L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039691
Gene: ENSMUSG00000039358
AA Change: R361L

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 47 177 5.5e-7 PFAM
Pfam:7TM_GPCR_Srsx 49 179 1e-7 PFAM
Pfam:7tm_1 55 354 1.5e-74 PFAM
Pfam:7TM_GPCR_Srsx 210 368 2.4e-6 PFAM
low complexity region 419 430 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D5 subtype of the dopamine receptor. The D5 subtype is a G-protein coupled receptor which stimulates adenylyl cyclase. This receptor is expressed in neurons in the limbic regions of the brain. It has a 10-fold higher affinity for dopamine than the D1 subtype. Pseudogenes related to this gene reside on chromosomes 1 and 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop hypertension and exhibit elevated blood pressure caused by increased sympathetic tone. Mice homozygous for another knock-out allele exhibit increased methamphetamine-induced ambulatory activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,668,900 (GRCm39) N2552I probably damaging Het
Amph G T 13: 19,309,253 (GRCm39) A444S probably benign Het
Ankrd52 A G 10: 128,216,457 (GRCm39) N157S probably benign Het
Arhgap29 T C 3: 121,797,920 (GRCm39) F537L probably benign Het
Asic1 A C 15: 99,590,657 (GRCm39) T136P probably damaging Het
Atg2b T C 12: 105,605,561 (GRCm39) Y1468C probably benign Het
Atm A G 9: 53,427,817 (GRCm39) L431P probably damaging Het
Atosb T C 4: 43,036,050 (GRCm39) H227R probably damaging Het
Btaf1 A G 19: 36,922,646 (GRCm39) T17A probably benign Het
Car10 A G 11: 93,195,367 (GRCm39) N58S probably benign Het
Cd79b A T 11: 106,202,845 (GRCm39) D252E probably damaging Het
Cdipt C T 7: 126,576,202 (GRCm39) probably benign Het
Cebpe T C 14: 54,949,165 (GRCm39) D84G probably damaging Het
Cenpj T C 14: 56,790,453 (GRCm39) E532G probably benign Het
Cherp A G 8: 73,216,920 (GRCm39) probably null Het
Chuk T C 19: 44,071,109 (GRCm39) D532G possibly damaging Het
Clec1b C T 6: 129,374,603 (GRCm39) T9I probably benign Het
Clspn G T 4: 126,458,756 (GRCm39) A280S possibly damaging Het
Cts3 T G 13: 61,712,799 (GRCm39) Y307S probably benign Het
Cyp2c39 T C 19: 39,556,493 (GRCm39) M443T possibly damaging Het
Dhx57 C T 17: 80,582,447 (GRCm39) R386H probably damaging Het
Dhx58 A T 11: 100,592,133 (GRCm39) M305K probably benign Het
Dlgap3 T C 4: 127,129,287 (GRCm39) L894P probably damaging Het
Dnah3 A T 7: 119,574,299 (GRCm39) N2164K probably damaging Het
Dnajb14 A G 3: 137,608,044 (GRCm39) N183S probably benign Het
Duoxa1 T C 2: 122,135,622 (GRCm39) E159G probably damaging Het
Exoc1 T A 5: 76,711,079 (GRCm39) S659R probably benign Het
Fbln7 T C 2: 128,719,314 (GRCm39) I37T probably benign Het
Fcgrt T G 7: 44,744,853 (GRCm39) E205A possibly damaging Het
Fcho2 A T 13: 98,900,202 (GRCm39) S304T probably damaging Het
Gbp9 C A 5: 105,253,587 (GRCm39) G43* probably null Het
Gucy2d A G 7: 98,123,868 (GRCm39) K151R probably benign Het
Heatr4 T A 12: 84,024,829 (GRCm39) I331F probably damaging Het
Hmcn1 G A 1: 150,485,378 (GRCm39) T4408I probably damaging Het
Hoxc9 C T 15: 102,890,551 (GRCm39) T156M probably benign Het
Hrnr A T 3: 93,227,987 (GRCm39) E35V probably damaging Het
Idua C T 5: 108,818,037 (GRCm39) Q70* probably null Het
Klf5 A T 14: 99,539,189 (GRCm39) I201F probably damaging Het
Lonrf1 T C 8: 36,701,164 (GRCm39) K349E probably damaging Het
Lrp1b A T 2: 41,158,395 (GRCm39) D1721E Het
Mdh1 T A 11: 21,521,870 (GRCm39) probably benign Het
Mllt11 T C 3: 95,127,521 (GRCm39) H83R probably benign Het
Mrgprb4 A C 7: 47,848,583 (GRCm39) I115S possibly damaging Het
Mrpl38 A G 11: 116,023,296 (GRCm39) F319S probably damaging Het
Naif1 A T 2: 32,344,907 (GRCm39) M204L probably benign Het
Ncan T A 8: 70,554,628 (GRCm39) D1063V probably damaging Het
Noto A T 6: 85,401,327 (GRCm39) R119W possibly damaging Het
Or4c115 G A 2: 88,927,573 (GRCm39) L233F probably benign Het
Or51h7 A T 7: 102,591,165 (GRCm39) D206E probably damaging Het
Or6c69 T A 10: 129,748,048 (GRCm39) Y33F probably damaging Het
Or8b3 A T 9: 38,314,841 (GRCm39) I224F probably damaging Het
Ovch2 A G 7: 107,393,584 (GRCm39) W181R probably damaging Het
Palm G C 10: 79,655,117 (GRCm39) G292R probably damaging Het
Pdgfrb T A 18: 61,205,787 (GRCm39) L591* probably null Het
Pik3c2g T C 6: 139,841,910 (GRCm39) S772P Het
Prx C A 7: 27,217,411 (GRCm39) D776E probably benign Het
Ptpra A G 2: 130,384,366 (GRCm39) E562G possibly damaging Het
Rbm4b A G 19: 4,807,359 (GRCm39) Y25C probably damaging Het
Reln T C 5: 22,136,427 (GRCm39) T2534A probably benign Het
Rnf123 T C 9: 107,954,963 (GRCm39) S14G probably benign Het
Rock2 A G 12: 17,015,602 (GRCm39) H833R probably benign Het
Rxfp3 A G 15: 11,037,111 (GRCm39) V87A possibly damaging Het
S100b G A 10: 76,092,936 (GRCm39) G23D probably damaging Het
Scn9a T A 2: 66,357,002 (GRCm39) M1100L probably benign Het
Septin11 T A 5: 93,296,266 (GRCm39) S55T possibly damaging Het
Speer4a3 T C 5: 26,154,829 (GRCm39) E257G probably damaging Het
Sv2b T A 7: 74,769,676 (GRCm39) Q622L probably benign Het
Taar7a T C 10: 23,868,799 (GRCm39) D194G probably benign Het
Trappc3 T C 4: 126,169,014 (GRCm39) I168T probably benign Het
Trim27 T C 13: 21,374,296 (GRCm39) probably null Het
Wdr49 G A 3: 75,304,359 (GRCm39) T109I probably benign Het
Wdr64 T C 1: 175,544,854 (GRCm39) Y96H probably damaging Het
Zfp219 A T 14: 52,247,049 (GRCm39) L26Q probably damaging Het
Zfp758 T A 17: 22,593,829 (GRCm39) V105D possibly damaging Het
Zfp975 C G 7: 42,312,332 (GRCm39) E94Q possibly damaging Het
Zfyve9 C T 4: 108,539,334 (GRCm39) A289T probably benign Het
Zscan5b T C 7: 6,234,525 (GRCm39) S184P possibly damaging Het
Other mutations in Drd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03153:Drd5 APN 5 38,477,124 (GRCm39) missense probably benign 0.25
PIT4305001:Drd5 UTSW 5 38,477,927 (GRCm39) missense probably damaging 1.00
R0051:Drd5 UTSW 5 38,477,957 (GRCm39) missense probably benign 0.39
R0051:Drd5 UTSW 5 38,477,957 (GRCm39) missense probably benign 0.39
R0571:Drd5 UTSW 5 38,477,270 (GRCm39) missense probably damaging 1.00
R1507:Drd5 UTSW 5 38,478,065 (GRCm39) missense probably damaging 1.00
R1663:Drd5 UTSW 5 38,478,198 (GRCm39) missense probably benign 0.02
R1777:Drd5 UTSW 5 38,477,504 (GRCm39) missense probably damaging 1.00
R1932:Drd5 UTSW 5 38,477,319 (GRCm39) missense probably benign 0.14
R1986:Drd5 UTSW 5 38,477,456 (GRCm39) missense probably damaging 0.99
R2047:Drd5 UTSW 5 38,477,679 (GRCm39) missense probably damaging 1.00
R3875:Drd5 UTSW 5 38,477,157 (GRCm39) missense possibly damaging 0.84
R5033:Drd5 UTSW 5 38,477,544 (GRCm39) missense probably damaging 1.00
R5201:Drd5 UTSW 5 38,477,366 (GRCm39) missense probably damaging 0.96
R5255:Drd5 UTSW 5 38,477,310 (GRCm39) missense probably damaging 1.00
R5393:Drd5 UTSW 5 38,478,248 (GRCm39) missense probably benign
R5639:Drd5 UTSW 5 38,477,178 (GRCm39) missense possibly damaging 0.81
R7241:Drd5 UTSW 5 38,477,879 (GRCm39) missense probably damaging 1.00
R7520:Drd5 UTSW 5 38,478,195 (GRCm39) missense probably benign 0.00
R7739:Drd5 UTSW 5 38,477,421 (GRCm39) missense probably damaging 1.00
R8300:Drd5 UTSW 5 38,477,672 (GRCm39) missense probably damaging 0.99
R8746:Drd5 UTSW 5 38,477,433 (GRCm39) missense probably benign 0.04
R8829:Drd5 UTSW 5 38,477,078 (GRCm39) missense probably benign 0.08
R8832:Drd5 UTSW 5 38,477,078 (GRCm39) missense probably benign 0.08
R8870:Drd5 UTSW 5 38,477,747 (GRCm39) missense possibly damaging 0.76
R9600:Drd5 UTSW 5 38,478,174 (GRCm39) missense possibly damaging 0.79
R9705:Drd5 UTSW 5 38,478,027 (GRCm39) missense probably damaging 1.00
Z1177:Drd5 UTSW 5 38,477,729 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AAACCCTGTCCGTGATCATGG -3'
(R):5'- AGACATGTGATCGAAAGGCC -3'

Sequencing Primer
(F):5'- CCGTGATCATGGGGGTCTTC -3'
(R):5'- ATGTGATCGAAAGGCCCCTCC -3'
Posted On 2022-10-06