Incidental Mutation 'R9717:Exoc1'
ID 730521
Institutional Source Beutler Lab
Gene Symbol Exoc1
Ensembl Gene ENSMUSG00000036435
Gene Name exocyst complex component 1
Synonyms Sec3l1, A730011E05Rik, SEC3, Sec3p, 2810407P21Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 76677158-76718141 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 76711079 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 659 (S659R)
Ref Sequence ENSEMBL: ENSMUSP00000109121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049469] [ENSMUST00000087133] [ENSMUST00000113493] [ENSMUST00000134521]
AlphaFold Q8R3S6
Predicted Effect probably benign
Transcript: ENSMUST00000049469
AA Change: S637R

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000046719
Gene: ENSMUSG00000036435
AA Change: S637R

DomainStartEndE-ValueType
Sec3-PIP2_bind 31 122 9.51e-41 SMART
Pfam:Sec3_C 169 856 5.5e-221 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087133
AA Change: S652R

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000084373
Gene: ENSMUSG00000036435
AA Change: S652R

DomainStartEndE-ValueType
Sec3-PIP2_bind 31 122 9.51e-41 SMART
Pfam:Sec3_C 169 871 2e-220 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113493
AA Change: S659R

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000109121
Gene: ENSMUSG00000036435
AA Change: S659R

DomainStartEndE-ValueType
Sec3-PIP2_bind 31 122 9.51e-41 SMART
coiled coil region 161 183 N/A INTRINSIC
Pfam:Sec3_C 190 878 4.1e-186 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134521
AA Change: S50R

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121784
Gene: ENSMUSG00000036435
AA Change: S50R

DomainStartEndE-ValueType
Pfam:Sec3_C 1 111 1.7e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,668,900 (GRCm39) N2552I probably damaging Het
Amph G T 13: 19,309,253 (GRCm39) A444S probably benign Het
Ankrd52 A G 10: 128,216,457 (GRCm39) N157S probably benign Het
Arhgap29 T C 3: 121,797,920 (GRCm39) F537L probably benign Het
Asic1 A C 15: 99,590,657 (GRCm39) T136P probably damaging Het
Atg2b T C 12: 105,605,561 (GRCm39) Y1468C probably benign Het
Atm A G 9: 53,427,817 (GRCm39) L431P probably damaging Het
Atosb T C 4: 43,036,050 (GRCm39) H227R probably damaging Het
Btaf1 A G 19: 36,922,646 (GRCm39) T17A probably benign Het
Car10 A G 11: 93,195,367 (GRCm39) N58S probably benign Het
Cd79b A T 11: 106,202,845 (GRCm39) D252E probably damaging Het
Cdipt C T 7: 126,576,202 (GRCm39) probably benign Het
Cebpe T C 14: 54,949,165 (GRCm39) D84G probably damaging Het
Cenpj T C 14: 56,790,453 (GRCm39) E532G probably benign Het
Cherp A G 8: 73,216,920 (GRCm39) probably null Het
Chuk T C 19: 44,071,109 (GRCm39) D532G possibly damaging Het
Clec1b C T 6: 129,374,603 (GRCm39) T9I probably benign Het
Clspn G T 4: 126,458,756 (GRCm39) A280S possibly damaging Het
Cts3 T G 13: 61,712,799 (GRCm39) Y307S probably benign Het
Cyp2c39 T C 19: 39,556,493 (GRCm39) M443T possibly damaging Het
Dhx57 C T 17: 80,582,447 (GRCm39) R386H probably damaging Het
Dhx58 A T 11: 100,592,133 (GRCm39) M305K probably benign Het
Dlgap3 T C 4: 127,129,287 (GRCm39) L894P probably damaging Het
Dnah3 A T 7: 119,574,299 (GRCm39) N2164K probably damaging Het
Dnajb14 A G 3: 137,608,044 (GRCm39) N183S probably benign Het
Drd5 G T 5: 38,478,090 (GRCm39) R361L probably damaging Het
Duoxa1 T C 2: 122,135,622 (GRCm39) E159G probably damaging Het
Fbln7 T C 2: 128,719,314 (GRCm39) I37T probably benign Het
Fcgrt T G 7: 44,744,853 (GRCm39) E205A possibly damaging Het
Fcho2 A T 13: 98,900,202 (GRCm39) S304T probably damaging Het
Gbp9 C A 5: 105,253,587 (GRCm39) G43* probably null Het
Gucy2d A G 7: 98,123,868 (GRCm39) K151R probably benign Het
Heatr4 T A 12: 84,024,829 (GRCm39) I331F probably damaging Het
Hmcn1 G A 1: 150,485,378 (GRCm39) T4408I probably damaging Het
Hoxc9 C T 15: 102,890,551 (GRCm39) T156M probably benign Het
Hrnr A T 3: 93,227,987 (GRCm39) E35V probably damaging Het
Idua C T 5: 108,818,037 (GRCm39) Q70* probably null Het
Klf5 A T 14: 99,539,189 (GRCm39) I201F probably damaging Het
Lonrf1 T C 8: 36,701,164 (GRCm39) K349E probably damaging Het
Lrp1b A T 2: 41,158,395 (GRCm39) D1721E Het
Mdh1 T A 11: 21,521,870 (GRCm39) probably benign Het
Mllt11 T C 3: 95,127,521 (GRCm39) H83R probably benign Het
Mrgprb4 A C 7: 47,848,583 (GRCm39) I115S possibly damaging Het
Mrpl38 A G 11: 116,023,296 (GRCm39) F319S probably damaging Het
Naif1 A T 2: 32,344,907 (GRCm39) M204L probably benign Het
Ncan T A 8: 70,554,628 (GRCm39) D1063V probably damaging Het
Noto A T 6: 85,401,327 (GRCm39) R119W possibly damaging Het
Or4c115 G A 2: 88,927,573 (GRCm39) L233F probably benign Het
Or51h7 A T 7: 102,591,165 (GRCm39) D206E probably damaging Het
Or6c69 T A 10: 129,748,048 (GRCm39) Y33F probably damaging Het
Or8b3 A T 9: 38,314,841 (GRCm39) I224F probably damaging Het
Ovch2 A G 7: 107,393,584 (GRCm39) W181R probably damaging Het
Palm G C 10: 79,655,117 (GRCm39) G292R probably damaging Het
Pdgfrb T A 18: 61,205,787 (GRCm39) L591* probably null Het
Pik3c2g T C 6: 139,841,910 (GRCm39) S772P Het
Prx C A 7: 27,217,411 (GRCm39) D776E probably benign Het
Ptpra A G 2: 130,384,366 (GRCm39) E562G possibly damaging Het
Rbm4b A G 19: 4,807,359 (GRCm39) Y25C probably damaging Het
Reln T C 5: 22,136,427 (GRCm39) T2534A probably benign Het
Rnf123 T C 9: 107,954,963 (GRCm39) S14G probably benign Het
Rock2 A G 12: 17,015,602 (GRCm39) H833R probably benign Het
Rxfp3 A G 15: 11,037,111 (GRCm39) V87A possibly damaging Het
S100b G A 10: 76,092,936 (GRCm39) G23D probably damaging Het
Scn9a T A 2: 66,357,002 (GRCm39) M1100L probably benign Het
Septin11 T A 5: 93,296,266 (GRCm39) S55T possibly damaging Het
Speer4a3 T C 5: 26,154,829 (GRCm39) E257G probably damaging Het
Sv2b T A 7: 74,769,676 (GRCm39) Q622L probably benign Het
Taar7a T C 10: 23,868,799 (GRCm39) D194G probably benign Het
Trappc3 T C 4: 126,169,014 (GRCm39) I168T probably benign Het
Trim27 T C 13: 21,374,296 (GRCm39) probably null Het
Wdr49 G A 3: 75,304,359 (GRCm39) T109I probably benign Het
Wdr64 T C 1: 175,544,854 (GRCm39) Y96H probably damaging Het
Zfp219 A T 14: 52,247,049 (GRCm39) L26Q probably damaging Het
Zfp758 T A 17: 22,593,829 (GRCm39) V105D possibly damaging Het
Zfp975 C G 7: 42,312,332 (GRCm39) E94Q possibly damaging Het
Zfyve9 C T 4: 108,539,334 (GRCm39) A289T probably benign Het
Zscan5b T C 7: 6,234,525 (GRCm39) S184P possibly damaging Het
Other mutations in Exoc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Exoc1 APN 5 76,714,870 (GRCm39) missense possibly damaging 0.88
IGL01149:Exoc1 APN 5 76,690,091 (GRCm39) splice site probably benign
IGL02061:Exoc1 APN 5 76,689,967 (GRCm39) missense probably damaging 0.96
IGL02288:Exoc1 APN 5 76,693,160 (GRCm39) missense probably benign
IGL02407:Exoc1 APN 5 76,693,193 (GRCm39) missense probably damaging 0.97
IGL03089:Exoc1 APN 5 76,690,005 (GRCm39) missense possibly damaging 0.81
IGL03242:Exoc1 APN 5 76,706,854 (GRCm39) missense probably damaging 1.00
IGL03348:Exoc1 APN 5 76,683,440 (GRCm39) missense probably damaging 1.00
IGL03411:Exoc1 APN 5 76,690,042 (GRCm39) missense probably damaging 1.00
Smalls UTSW 5 76,685,626 (GRCm39) missense probably damaging 1.00
R0462:Exoc1 UTSW 5 76,691,464 (GRCm39) missense probably benign 0.37
R1216:Exoc1 UTSW 5 76,702,035 (GRCm39) missense probably benign
R1528:Exoc1 UTSW 5 76,697,411 (GRCm39) missense possibly damaging 0.94
R1531:Exoc1 UTSW 5 76,707,011 (GRCm39) missense probably damaging 0.98
R1636:Exoc1 UTSW 5 76,715,965 (GRCm39) missense probably benign 0.03
R1754:Exoc1 UTSW 5 76,708,169 (GRCm39) splice site probably null
R1803:Exoc1 UTSW 5 76,709,288 (GRCm39) missense probably benign 0.18
R2086:Exoc1 UTSW 5 76,680,693 (GRCm39) nonsense probably null
R2239:Exoc1 UTSW 5 76,707,557 (GRCm39) unclassified probably benign
R3914:Exoc1 UTSW 5 76,691,408 (GRCm39) missense possibly damaging 0.54
R4022:Exoc1 UTSW 5 76,697,417 (GRCm39) missense possibly damaging 0.92
R4329:Exoc1 UTSW 5 76,715,822 (GRCm39) missense probably damaging 1.00
R4413:Exoc1 UTSW 5 76,689,866 (GRCm39) intron probably benign
R4427:Exoc1 UTSW 5 76,711,110 (GRCm39) missense probably benign 0.00
R4557:Exoc1 UTSW 5 76,709,290 (GRCm39) missense probably damaging 1.00
R4627:Exoc1 UTSW 5 76,690,075 (GRCm39) missense probably benign 0.26
R4677:Exoc1 UTSW 5 76,707,010 (GRCm39) missense probably null 0.82
R5138:Exoc1 UTSW 5 76,715,922 (GRCm39) missense probably damaging 1.00
R5325:Exoc1 UTSW 5 76,685,549 (GRCm39) missense probably benign
R5342:Exoc1 UTSW 5 76,714,861 (GRCm39) missense probably damaging 1.00
R5736:Exoc1 UTSW 5 76,685,615 (GRCm39) missense possibly damaging 0.90
R5891:Exoc1 UTSW 5 76,689,991 (GRCm39) missense probably damaging 1.00
R6102:Exoc1 UTSW 5 76,685,626 (GRCm39) missense probably damaging 1.00
R6447:Exoc1 UTSW 5 76,691,364 (GRCm39) missense probably damaging 0.97
R6532:Exoc1 UTSW 5 76,685,684 (GRCm39) missense probably damaging 0.99
R6694:Exoc1 UTSW 5 76,697,399 (GRCm39) missense probably damaging 1.00
R6753:Exoc1 UTSW 5 76,711,186 (GRCm39) missense probably damaging 1.00
R6885:Exoc1 UTSW 5 76,706,889 (GRCm39) missense probably damaging 1.00
R7090:Exoc1 UTSW 5 76,714,800 (GRCm39) missense unknown
R7299:Exoc1 UTSW 5 76,690,006 (GRCm39) missense probably damaging 1.00
R7439:Exoc1 UTSW 5 76,693,195 (GRCm39) missense probably benign 0.18
R7567:Exoc1 UTSW 5 76,685,562 (GRCm39) missense probably damaging 0.96
R7665:Exoc1 UTSW 5 76,691,420 (GRCm39) missense probably benign 0.33
R7745:Exoc1 UTSW 5 76,709,359 (GRCm39) nonsense probably null
R7883:Exoc1 UTSW 5 76,709,229 (GRCm39) missense probably damaging 0.99
R7918:Exoc1 UTSW 5 76,691,840 (GRCm39) missense probably benign 0.10
R7956:Exoc1 UTSW 5 76,705,704 (GRCm39) missense probably benign 0.01
R7977:Exoc1 UTSW 5 76,691,432 (GRCm39) missense probably damaging 1.00
R7987:Exoc1 UTSW 5 76,691,432 (GRCm39) missense probably damaging 1.00
R8191:Exoc1 UTSW 5 76,707,674 (GRCm39) critical splice donor site probably null
R8286:Exoc1 UTSW 5 76,711,087 (GRCm39) missense probably benign 0.00
R8670:Exoc1 UTSW 5 76,717,505 (GRCm39) missense probably damaging 1.00
R8791:Exoc1 UTSW 5 76,683,412 (GRCm39) missense probably damaging 1.00
R9308:Exoc1 UTSW 5 76,706,968 (GRCm39) missense probably benign 0.10
R9410:Exoc1 UTSW 5 76,706,989 (GRCm39) missense probably benign 0.21
X0018:Exoc1 UTSW 5 76,714,882 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAATACACCAGCGTTTGTGC -3'
(R):5'- CTGCAGTTACCCAGGAACAATG -3'

Sequencing Primer
(F):5'- CTGCAGAGGACTGGTTCTCTC -3'
(R):5'- TCACCATTAATGAACACTCCTCTG -3'
Posted On 2022-10-06