Incidental Mutation 'R9717:Idua'
ID 730524
Institutional Source Beutler Lab
Gene Symbol Idua
Ensembl Gene ENSMUSG00000033540
Gene Name iduronidase, alpha-L
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.147) question?
Stock # R9717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 108808197-108832423 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 108818037 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 70 (Q70*)
Ref Sequence ENSEMBL: ENSMUSP00000071577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051757] [ENSMUST00000071650] [ENSMUST00000112563] [ENSMUST00000119212] [ENSMUST00000119270] [ENSMUST00000132708] [ENSMUST00000136227] [ENSMUST00000139734] [ENSMUST00000140620] [ENSMUST00000163328]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000051757
SMART Domains Protein: ENSMUSP00000051561
Gene: ENSMUSG00000046959

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.9e-31 PFAM
Pfam:Sulfate_transp 200 478 3.1e-84 PFAM
Pfam:STAS 536 686 9.5e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000071650
AA Change: Q70*
SMART Domains Protein: ENSMUSP00000071577
Gene: ENSMUSG00000033540
AA Change: Q70*

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 542 1.4e-223 PFAM
SCOP:d1bpv__ 546 643 3e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112563
AA Change: Q70*
SMART Domains Protein: ENSMUSP00000108182
Gene: ENSMUSG00000033540
AA Change: Q70*

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 542 2.1e-224 PFAM
SCOP:d1bpv__ 546 643 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119212
SMART Domains Protein: ENSMUSP00000113190
Gene: ENSMUSG00000033540

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Glyco_hydro_39 48 495 2.4e-193 PFAM
SCOP:d1bpv__ 499 596 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119270
SMART Domains Protein: ENSMUSP00000113185
Gene: ENSMUSG00000046959

DomainStartEndE-ValueType
Pfam:Sulfate_transp 85 498 7.3e-135 PFAM
Pfam:STAS 552 702 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132708
SMART Domains Protein: ENSMUSP00000122837
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
Blast:C1 26 56 2e-13 BLAST
low complexity region 68 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136227
SMART Domains Protein: ENSMUSP00000116540
Gene: ENSMUSG00000046959

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 3.4e-31 PFAM
Pfam:Sulfate_transp 200 416 2.2e-62 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000139734
AA Change: Q70*
SMART Domains Protein: ENSMUSP00000117694
Gene: ENSMUSG00000033540
AA Change: Q70*

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 199 6.8e-80 PFAM
low complexity region 235 260 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000140620
AA Change: Q70*
SMART Domains Protein: ENSMUSP00000119624
Gene: ENSMUSG00000033540
AA Change: Q70*

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 150 3.4e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163328
SMART Domains Protein: ENSMUSP00000131282
Gene: ENSMUSG00000046959

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.9e-31 PFAM
Pfam:Sulfate_transp 200 478 3.1e-84 PFAM
Pfam:STAS 536 686 9.5e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes the terminal alpha-L-iduronic acid residues of two glycosaminoglycans, dermatan sulfate and heparan sulfate. This hydrolysis is required for the lysosomal degradation of these glycosaminoglycans. Mutations in this gene that result in enzymatic deficiency lead to the autosomal recessive disease mucopolysaccharidosis type I (MPS I). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutants show lysosomal storage in multiple tissues, increased urinary GAG, craniofacial and skeletal defects, increased body weight, impaired habituation and long-term memory for aversive training, reduced ventricular function with valve insufficiency, and progressive hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,668,900 (GRCm39) N2552I probably damaging Het
Amph G T 13: 19,309,253 (GRCm39) A444S probably benign Het
Ankrd52 A G 10: 128,216,457 (GRCm39) N157S probably benign Het
Arhgap29 T C 3: 121,797,920 (GRCm39) F537L probably benign Het
Asic1 A C 15: 99,590,657 (GRCm39) T136P probably damaging Het
Atg2b T C 12: 105,605,561 (GRCm39) Y1468C probably benign Het
Atm A G 9: 53,427,817 (GRCm39) L431P probably damaging Het
Atosb T C 4: 43,036,050 (GRCm39) H227R probably damaging Het
Btaf1 A G 19: 36,922,646 (GRCm39) T17A probably benign Het
Car10 A G 11: 93,195,367 (GRCm39) N58S probably benign Het
Cd79b A T 11: 106,202,845 (GRCm39) D252E probably damaging Het
Cdipt C T 7: 126,576,202 (GRCm39) probably benign Het
Cebpe T C 14: 54,949,165 (GRCm39) D84G probably damaging Het
Cenpj T C 14: 56,790,453 (GRCm39) E532G probably benign Het
Cherp A G 8: 73,216,920 (GRCm39) probably null Het
Chuk T C 19: 44,071,109 (GRCm39) D532G possibly damaging Het
Clec1b C T 6: 129,374,603 (GRCm39) T9I probably benign Het
Clspn G T 4: 126,458,756 (GRCm39) A280S possibly damaging Het
Cts3 T G 13: 61,712,799 (GRCm39) Y307S probably benign Het
Cyp2c39 T C 19: 39,556,493 (GRCm39) M443T possibly damaging Het
Dhx57 C T 17: 80,582,447 (GRCm39) R386H probably damaging Het
Dhx58 A T 11: 100,592,133 (GRCm39) M305K probably benign Het
Dlgap3 T C 4: 127,129,287 (GRCm39) L894P probably damaging Het
Dnah3 A T 7: 119,574,299 (GRCm39) N2164K probably damaging Het
Dnajb14 A G 3: 137,608,044 (GRCm39) N183S probably benign Het
Drd5 G T 5: 38,478,090 (GRCm39) R361L probably damaging Het
Duoxa1 T C 2: 122,135,622 (GRCm39) E159G probably damaging Het
Exoc1 T A 5: 76,711,079 (GRCm39) S659R probably benign Het
Fbln7 T C 2: 128,719,314 (GRCm39) I37T probably benign Het
Fcgrt T G 7: 44,744,853 (GRCm39) E205A possibly damaging Het
Fcho2 A T 13: 98,900,202 (GRCm39) S304T probably damaging Het
Gbp9 C A 5: 105,253,587 (GRCm39) G43* probably null Het
Gucy2d A G 7: 98,123,868 (GRCm39) K151R probably benign Het
Heatr4 T A 12: 84,024,829 (GRCm39) I331F probably damaging Het
Hmcn1 G A 1: 150,485,378 (GRCm39) T4408I probably damaging Het
Hoxc9 C T 15: 102,890,551 (GRCm39) T156M probably benign Het
Hrnr A T 3: 93,227,987 (GRCm39) E35V probably damaging Het
Klf5 A T 14: 99,539,189 (GRCm39) I201F probably damaging Het
Lonrf1 T C 8: 36,701,164 (GRCm39) K349E probably damaging Het
Lrp1b A T 2: 41,158,395 (GRCm39) D1721E Het
Mdh1 T A 11: 21,521,870 (GRCm39) probably benign Het
Mllt11 T C 3: 95,127,521 (GRCm39) H83R probably benign Het
Mrgprb4 A C 7: 47,848,583 (GRCm39) I115S possibly damaging Het
Mrpl38 A G 11: 116,023,296 (GRCm39) F319S probably damaging Het
Naif1 A T 2: 32,344,907 (GRCm39) M204L probably benign Het
Ncan T A 8: 70,554,628 (GRCm39) D1063V probably damaging Het
Noto A T 6: 85,401,327 (GRCm39) R119W possibly damaging Het
Or4c115 G A 2: 88,927,573 (GRCm39) L233F probably benign Het
Or51h7 A T 7: 102,591,165 (GRCm39) D206E probably damaging Het
Or6c69 T A 10: 129,748,048 (GRCm39) Y33F probably damaging Het
Or8b3 A T 9: 38,314,841 (GRCm39) I224F probably damaging Het
Ovch2 A G 7: 107,393,584 (GRCm39) W181R probably damaging Het
Palm G C 10: 79,655,117 (GRCm39) G292R probably damaging Het
Pdgfrb T A 18: 61,205,787 (GRCm39) L591* probably null Het
Pik3c2g T C 6: 139,841,910 (GRCm39) S772P Het
Prx C A 7: 27,217,411 (GRCm39) D776E probably benign Het
Ptpra A G 2: 130,384,366 (GRCm39) E562G possibly damaging Het
Rbm4b A G 19: 4,807,359 (GRCm39) Y25C probably damaging Het
Reln T C 5: 22,136,427 (GRCm39) T2534A probably benign Het
Rnf123 T C 9: 107,954,963 (GRCm39) S14G probably benign Het
Rock2 A G 12: 17,015,602 (GRCm39) H833R probably benign Het
Rxfp3 A G 15: 11,037,111 (GRCm39) V87A possibly damaging Het
S100b G A 10: 76,092,936 (GRCm39) G23D probably damaging Het
Scn9a T A 2: 66,357,002 (GRCm39) M1100L probably benign Het
Septin11 T A 5: 93,296,266 (GRCm39) S55T possibly damaging Het
Speer4a3 T C 5: 26,154,829 (GRCm39) E257G probably damaging Het
Sv2b T A 7: 74,769,676 (GRCm39) Q622L probably benign Het
Taar7a T C 10: 23,868,799 (GRCm39) D194G probably benign Het
Trappc3 T C 4: 126,169,014 (GRCm39) I168T probably benign Het
Trim27 T C 13: 21,374,296 (GRCm39) probably null Het
Wdr49 G A 3: 75,304,359 (GRCm39) T109I probably benign Het
Wdr64 T C 1: 175,544,854 (GRCm39) Y96H probably damaging Het
Zfp219 A T 14: 52,247,049 (GRCm39) L26Q probably damaging Het
Zfp758 T A 17: 22,593,829 (GRCm39) V105D possibly damaging Het
Zfp975 C G 7: 42,312,332 (GRCm39) E94Q possibly damaging Het
Zfyve9 C T 4: 108,539,334 (GRCm39) A289T probably benign Het
Zscan5b T C 7: 6,234,525 (GRCm39) S184P possibly damaging Het
Other mutations in Idua
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Idua APN 5 108,828,737 (GRCm39) missense probably benign 0.34
IGL01575:Idua APN 5 108,829,973 (GRCm39) missense possibly damaging 0.71
IGL02402:Idua APN 5 108,827,657 (GRCm39) missense probably damaging 1.00
IGL03145:Idua APN 5 108,829,362 (GRCm39) missense probably benign
Cooper UTSW 5 108,828,180 (GRCm39) missense probably damaging 1.00
R0208:Idua UTSW 5 108,829,618 (GRCm39) missense probably damaging 1.00
R1572:Idua UTSW 5 108,828,455 (GRCm39) missense probably benign
R1731:Idua UTSW 5 108,829,538 (GRCm39) missense probably benign 0.00
R2024:Idua UTSW 5 108,828,600 (GRCm39) missense probably damaging 1.00
R2126:Idua UTSW 5 108,829,304 (GRCm39) missense possibly damaging 0.93
R3760:Idua UTSW 5 108,817,978 (GRCm39) unclassified probably benign
R4747:Idua UTSW 5 108,828,902 (GRCm39) missense probably damaging 0.97
R4832:Idua UTSW 5 108,817,247 (GRCm39) missense probably benign
R5140:Idua UTSW 5 108,828,180 (GRCm39) missense probably damaging 1.00
R5543:Idua UTSW 5 108,818,095 (GRCm39) missense probably benign 0.22
R5643:Idua UTSW 5 108,828,090 (GRCm39) utr 3 prime probably benign
R5821:Idua UTSW 5 108,827,600 (GRCm39) missense probably benign 0.29
R6004:Idua UTSW 5 108,828,510 (GRCm39) missense probably benign
R6330:Idua UTSW 5 108,829,574 (GRCm39) missense probably benign 0.21
R6963:Idua UTSW 5 108,827,641 (GRCm39) missense possibly damaging 0.84
R7180:Idua UTSW 5 108,828,761 (GRCm39) missense probably benign 0.43
R7453:Idua UTSW 5 108,829,362 (GRCm39) missense probably benign
R7575:Idua UTSW 5 108,829,565 (GRCm39) missense probably damaging 1.00
R7712:Idua UTSW 5 108,829,388 (GRCm39) missense probably benign 0.10
R7923:Idua UTSW 5 108,828,449 (GRCm39) missense probably damaging 1.00
R7980:Idua UTSW 5 108,828,486 (GRCm39) missense probably benign 0.00
R8026:Idua UTSW 5 108,818,115 (GRCm39) missense probably benign 0.01
R8029:Idua UTSW 5 108,817,278 (GRCm39) missense probably benign 0.23
R8074:Idua UTSW 5 108,828,441 (GRCm39) missense possibly damaging 0.65
R8089:Idua UTSW 5 108,829,646 (GRCm39) missense probably damaging 1.00
R8384:Idua UTSW 5 108,829,305 (GRCm39) missense possibly damaging 0.70
R9040:Idua UTSW 5 108,828,929 (GRCm39) missense probably damaging 1.00
Z1177:Idua UTSW 5 108,828,489 (GRCm39) frame shift probably null
Z1177:Idua UTSW 5 108,827,450 (GRCm39) missense probably null 0.80
Predicted Primers PCR Primer
(F):5'- TCTGGAGACACATAATTCATCCAC -3'
(R):5'- TGCTCTAACAGGAAGCACAGC -3'

Sequencing Primer
(F):5'- TTCATCCACAAGGGTCTAGGCAG -3'
(R):5'- ACAGCCCAGCACTGTGTC -3'
Posted On 2022-10-06