Incidental Mutation 'R9717:Zscan5b'
ID 730528
Institutional Source Beutler Lab
Gene Symbol Zscan5b
Ensembl Gene ENSMUSG00000058028
Gene Name zinc finger and SCAN domain containing 5B
Synonyms Zfg1, Zfp371
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 6222278-6239423 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6231526 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 184 (S184P)
Ref Sequence ENSEMBL: ENSMUSP00000072449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072662] [ENSMUST00000155314] [ENSMUST00000165445]
AlphaFold B2RTN3
Predicted Effect possibly damaging
Transcript: ENSMUST00000072662
AA Change: S184P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000072449
Gene: ENSMUSG00000058028
AA Change: S184P

DomainStartEndE-ValueType
Pfam:SCAN 31 121 1.6e-25 PFAM
low complexity region 157 166 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 302 314 N/A INTRINSIC
ZnF_C2H2 326 348 3.11e-2 SMART
ZnF_C2H2 354 376 1.28e-3 SMART
ZnF_C2H2 382 404 1.36e-2 SMART
ZnF_C2H2 410 432 3.16e-3 SMART
ZnF_C2H2 438 460 1.06e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155314
SMART Domains Protein: ENSMUSP00000118508
Gene: ENSMUSG00000058028

DomainStartEndE-ValueType
Pfam:SCAN 31 121 4.1e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165445
AA Change: S184P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126044
Gene: ENSMUSG00000058028
AA Change: S184P

DomainStartEndE-ValueType
Pfam:SCAN 33 120 1e-25 PFAM
low complexity region 157 166 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 302 314 N/A INTRINSIC
ZnF_C2H2 326 348 3.11e-2 SMART
ZnF_C2H2 354 376 1.28e-3 SMART
ZnF_C2H2 382 404 1.36e-2 SMART
ZnF_C2H2 410 432 3.16e-3 SMART
ZnF_C2H2 438 460 1.06e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,520,781 N2552I probably damaging Het
Amph G T 13: 19,125,083 A444S probably benign Het
Ankrd52 A G 10: 128,380,588 N157S probably benign Het
Arhgap29 T C 3: 122,004,271 F537L probably benign Het
Asic1 A C 15: 99,692,776 T136P probably damaging Het
Atg2b T C 12: 105,639,302 Y1468C probably benign Het
Atm A G 9: 53,516,517 L431P probably damaging Het
Btaf1 A G 19: 36,945,246 T17A probably benign Het
Car10 A G 11: 93,304,541 N58S probably benign Het
Cd79b A T 11: 106,312,019 D252E probably damaging Het
Cdipt C T 7: 126,977,030 probably benign Het
Cebpe T C 14: 54,711,708 D84G probably damaging Het
Cenpj T C 14: 56,552,996 E532G probably benign Het
Cherp A G 8: 72,463,076 probably null Het
Chuk T C 19: 44,082,670 D532G possibly damaging Het
Clec1b C T 6: 129,397,640 T9I probably benign Het
Clspn G T 4: 126,564,963 A280S possibly damaging Het
Cts3 T G 13: 61,564,985 Y307S probably benign Het
Cyp2c39 T C 19: 39,568,049 M443T possibly damaging Het
Dhx57 C T 17: 80,275,018 R386H probably damaging Het
Dhx58 A T 11: 100,701,307 M305K probably benign Het
Dlgap3 T C 4: 127,235,494 L894P probably damaging Het
Dnah3 A T 7: 119,975,076 N2164K probably damaging Het
Dnajb14 A G 3: 137,902,283 N183S probably benign Het
Drd5 G T 5: 38,320,747 R361L probably damaging Het
Duoxa1 T C 2: 122,305,141 E159G probably damaging Het
Exoc1 T A 5: 76,563,232 S659R probably benign Het
Fam214b T C 4: 43,036,050 H227R probably damaging Het
Fbln7 T C 2: 128,877,394 I37T probably benign Het
Fcgrt T G 7: 45,095,429 E205A possibly damaging Het
Fcho2 A T 13: 98,763,694 S304T probably damaging Het
Gbp9 C A 5: 105,105,721 G43* probably null Het
Gm21671 T C 5: 25,949,831 E257G probably damaging Het
Gucy2d A G 7: 98,474,661 K151R probably benign Het
Heatr4 T A 12: 83,978,055 I331F probably damaging Het
Hmcn1 G A 1: 150,609,627 T4408I probably damaging Het
Hoxc9 C T 15: 102,982,119 T156M probably benign Het
Hrnr A T 3: 93,320,680 E35V probably damaging Het
Idua C T 5: 108,670,171 Q70* probably null Het
Klf5 A T 14: 99,301,753 I201F probably damaging Het
Lonrf1 T C 8: 36,234,010 K349E probably damaging Het
Lrp1b A T 2: 41,268,383 D1721E Het
Mdh1 T A 11: 21,571,870 probably benign Het
Mllt11 T C 3: 95,220,210 H83R probably benign Het
Mrgprb4 A C 7: 48,198,835 I115S possibly damaging Het
Mrpl38 A G 11: 116,132,470 F319S probably damaging Het
Naif1 A T 2: 32,454,895 M204L probably benign Het
Ncan T A 8: 70,101,978 D1063V probably damaging Het
Noto A T 6: 85,424,345 R119W possibly damaging Het
Olfr1220 G A 2: 89,097,229 L233F probably benign Het
Olfr147 A T 9: 38,403,545 I224F probably damaging Het
Olfr573-ps1 A T 7: 102,941,958 D206E probably damaging Het
Olfr816 T A 10: 129,912,179 Y33F probably damaging Het
Ovch2 A G 7: 107,794,377 W181R probably damaging Het
Palm G C 10: 79,819,283 G292R probably damaging Het
Pdgfrb T A 18: 61,072,715 L591* probably null Het
Pik3c2g T C 6: 139,896,184 S772P Het
Prx C A 7: 27,517,986 D776E probably benign Het
Ptpra A G 2: 130,542,446 E562G possibly damaging Het
Rbm4b A G 19: 4,757,331 Y25C probably damaging Het
Reln T C 5: 21,931,429 T2534A probably benign Het
Rnf123 T C 9: 108,077,764 S14G probably benign Het
Rock2 A G 12: 16,965,601 H833R probably benign Het
Rxfp3 A G 15: 11,037,025 V87A possibly damaging Het
S100b G A 10: 76,257,102 G23D probably damaging Het
Scn9a T A 2: 66,526,658 M1100L probably benign Het
Sept11 T A 5: 93,148,407 S55T possibly damaging Het
Sv2b T A 7: 75,119,928 Q622L probably benign Het
Taar7a T C 10: 23,992,901 D194G probably benign Het
Trappc3 T C 4: 126,275,221 I168T probably benign Het
Trim27 T C 13: 21,190,126 probably null Het
Wdr49 G A 3: 75,397,052 T109I probably benign Het
Wdr64 T C 1: 175,717,288 Y96H probably damaging Het
Zfp219 A T 14: 52,009,592 L26Q probably damaging Het
Zfp758 T A 17: 22,374,848 V105D possibly damaging Het
Zfp975 C G 7: 42,662,908 E94Q possibly damaging Het
Zfyve9 C T 4: 108,682,137 A289T probably benign Het
Other mutations in Zscan5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Zscan5b APN 7 6231422 missense probably benign 0.00
R0505:Zscan5b UTSW 7 6239075 missense probably damaging 0.99
R0535:Zscan5b UTSW 7 6233912 missense possibly damaging 0.72
R1401:Zscan5b UTSW 7 6230426 missense probably damaging 1.00
R1537:Zscan5b UTSW 7 6233851 missense probably benign 0.00
R1613:Zscan5b UTSW 7 6230375 missense probably damaging 1.00
R1820:Zscan5b UTSW 7 6239163 missense probably damaging 1.00
R1833:Zscan5b UTSW 7 6238966 missense possibly damaging 0.67
R2191:Zscan5b UTSW 7 6231443 missense possibly damaging 0.53
R3177:Zscan5b UTSW 7 6231346 missense possibly damaging 0.86
R3277:Zscan5b UTSW 7 6231346 missense possibly damaging 0.86
R4911:Zscan5b UTSW 7 6239190 makesense probably null
R5624:Zscan5b UTSW 7 6230519 missense probably benign 0.00
R8213:Zscan5b UTSW 7 6233947 missense possibly damaging 0.93
R8214:Zscan5b UTSW 7 6233947 missense possibly damaging 0.93
R8326:Zscan5b UTSW 7 6233947 missense possibly damaging 0.93
R8327:Zscan5b UTSW 7 6233947 missense possibly damaging 0.93
R8328:Zscan5b UTSW 7 6233947 missense possibly damaging 0.93
R8985:Zscan5b UTSW 7 6238835 missense probably damaging 0.99
R9474:Zscan5b UTSW 7 6231473 missense probably benign 0.00
X0018:Zscan5b UTSW 7 6230276 missense probably damaging 0.97
X0024:Zscan5b UTSW 7 6238949 missense probably benign 0.00
X0025:Zscan5b UTSW 7 6238615 missense probably benign 0.18
Z1177:Zscan5b UTSW 7 6230217 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TATCCAGGCTCTTACATGGGG -3'
(R):5'- CAGGTGGGTCTTCATTCTGC -3'

Sequencing Primer
(F):5'- ACATGGGGTCTGATCCTGACTC -3'
(R):5'- TCTGCACAGCAATGTCTAAGCATG -3'
Posted On 2022-10-06