Incidental Mutation 'R9717:Cdipt'
ID 730538
Institutional Source Beutler Lab
Gene Symbol Cdipt
Ensembl Gene ENSMUSG00000030682
Gene Name CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)
Synonyms D7Bwg0575e, 9530042F15Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 126975914-126980501 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) C to T at 126977030 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032920] [ENSMUST00000205437] [ENSMUST00000205830] [ENSMUST00000205903] [ENSMUST00000206170] [ENSMUST00000206296] [ENSMUST00000206346] [ENSMUST00000206450] [ENSMUST00000206780] [ENSMUST00000206794] [ENSMUST00000206816]
AlphaFold Q8VDP6
Predicted Effect silent
Transcript: ENSMUST00000032920
SMART Domains Protein: ENSMUSP00000032920
Gene: ENSMUSG00000030682

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 9 72 2.4e-16 PFAM
transmembrane domain 141 160 N/A INTRINSIC
transmembrane domain 175 197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205437
Predicted Effect silent
Transcript: ENSMUST00000205830
Predicted Effect probably benign
Transcript: ENSMUST00000205903
Predicted Effect silent
Transcript: ENSMUST00000206170
Predicted Effect probably benign
Transcript: ENSMUST00000206296
Predicted Effect silent
Transcript: ENSMUST00000206346
Predicted Effect silent
Transcript: ENSMUST00000206450
Predicted Effect probably benign
Transcript: ENSMUST00000206780
Predicted Effect silent
Transcript: ENSMUST00000206794
Predicted Effect probably benign
Transcript: ENSMUST00000206816
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol breakdown products are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. Two enzymes, CDP-diacylglycerol synthase and phosphatidylinositol synthase, are involved in the biosynthesis of phosphatidylinositol. Phosphatidylinositol synthase, a member of the CDP-alcohol phosphatidyl transferase class-I family, is an integral membrane protein found on the cytoplasmic side of the endoplasmic reticulum and the Golgi apparatus. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,520,781 N2552I probably damaging Het
Amph G T 13: 19,125,083 A444S probably benign Het
Ankrd52 A G 10: 128,380,588 N157S probably benign Het
Arhgap29 T C 3: 122,004,271 F537L probably benign Het
Asic1 A C 15: 99,692,776 T136P probably damaging Het
Atg2b T C 12: 105,639,302 Y1468C probably benign Het
Atm A G 9: 53,516,517 L431P probably damaging Het
Btaf1 A G 19: 36,945,246 T17A probably benign Het
Car10 A G 11: 93,304,541 N58S probably benign Het
Cd79b A T 11: 106,312,019 D252E probably damaging Het
Cebpe T C 14: 54,711,708 D84G probably damaging Het
Cenpj T C 14: 56,552,996 E532G probably benign Het
Cherp A G 8: 72,463,076 probably null Het
Chuk T C 19: 44,082,670 D532G possibly damaging Het
Clec1b C T 6: 129,397,640 T9I probably benign Het
Clspn G T 4: 126,564,963 A280S possibly damaging Het
Cts3 T G 13: 61,564,985 Y307S probably benign Het
Cyp2c39 T C 19: 39,568,049 M443T possibly damaging Het
Dhx57 C T 17: 80,275,018 R386H probably damaging Het
Dhx58 A T 11: 100,701,307 M305K probably benign Het
Dlgap3 T C 4: 127,235,494 L894P probably damaging Het
Dnah3 A T 7: 119,975,076 N2164K probably damaging Het
Dnajb14 A G 3: 137,902,283 N183S probably benign Het
Drd5 G T 5: 38,320,747 R361L probably damaging Het
Duoxa1 T C 2: 122,305,141 E159G probably damaging Het
Exoc1 T A 5: 76,563,232 S659R probably benign Het
Fam214b T C 4: 43,036,050 H227R probably damaging Het
Fbln7 T C 2: 128,877,394 I37T probably benign Het
Fcgrt T G 7: 45,095,429 E205A possibly damaging Het
Fcho2 A T 13: 98,763,694 S304T probably damaging Het
Gbp9 C A 5: 105,105,721 G43* probably null Het
Gm21671 T C 5: 25,949,831 E257G probably damaging Het
Gucy2d A G 7: 98,474,661 K151R probably benign Het
Heatr4 T A 12: 83,978,055 I331F probably damaging Het
Hmcn1 G A 1: 150,609,627 T4408I probably damaging Het
Hoxc9 C T 15: 102,982,119 T156M probably benign Het
Hrnr A T 3: 93,320,680 E35V probably damaging Het
Idua C T 5: 108,670,171 Q70* probably null Het
Klf5 A T 14: 99,301,753 I201F probably damaging Het
Lonrf1 T C 8: 36,234,010 K349E probably damaging Het
Lrp1b A T 2: 41,268,383 D1721E Het
Mdh1 T A 11: 21,571,870 probably benign Het
Mllt11 T C 3: 95,220,210 H83R probably benign Het
Mrgprb4 A C 7: 48,198,835 I115S possibly damaging Het
Mrpl38 A G 11: 116,132,470 F319S probably damaging Het
Naif1 A T 2: 32,454,895 M204L probably benign Het
Ncan T A 8: 70,101,978 D1063V probably damaging Het
Noto A T 6: 85,424,345 R119W possibly damaging Het
Olfr1220 G A 2: 89,097,229 L233F probably benign Het
Olfr147 A T 9: 38,403,545 I224F probably damaging Het
Olfr573-ps1 A T 7: 102,941,958 D206E probably damaging Het
Olfr816 T A 10: 129,912,179 Y33F probably damaging Het
Ovch2 A G 7: 107,794,377 W181R probably damaging Het
Palm G C 10: 79,819,283 G292R probably damaging Het
Pdgfrb T A 18: 61,072,715 L591* probably null Het
Pik3c2g T C 6: 139,896,184 S772P Het
Prx C A 7: 27,517,986 D776E probably benign Het
Ptpra A G 2: 130,542,446 E562G possibly damaging Het
Rbm4b A G 19: 4,757,331 Y25C probably damaging Het
Reln T C 5: 21,931,429 T2534A probably benign Het
Rnf123 T C 9: 108,077,764 S14G probably benign Het
Rock2 A G 12: 16,965,601 H833R probably benign Het
Rxfp3 A G 15: 11,037,025 V87A possibly damaging Het
S100b G A 10: 76,257,102 G23D probably damaging Het
Scn9a T A 2: 66,526,658 M1100L probably benign Het
Sept11 T A 5: 93,148,407 S55T possibly damaging Het
Sv2b T A 7: 75,119,928 Q622L probably benign Het
Taar7a T C 10: 23,992,901 D194G probably benign Het
Trappc3 T C 4: 126,275,221 I168T probably benign Het
Trim27 T C 13: 21,190,126 probably null Het
Wdr49 G A 3: 75,397,052 T109I probably benign Het
Wdr64 T C 1: 175,717,288 Y96H probably damaging Het
Zfp219 A T 14: 52,009,592 L26Q probably damaging Het
Zfp758 T A 17: 22,374,848 V105D possibly damaging Het
Zfp975 C G 7: 42,662,908 E94Q possibly damaging Het
Zfyve9 C T 4: 108,682,137 A289T probably benign Het
Zscan5b T C 7: 6,231,526 S184P possibly damaging Het
Other mutations in Cdipt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Cdipt APN 7 126979553 missense possibly damaging 0.84
R0063:Cdipt UTSW 7 126979600 missense probably benign
R0063:Cdipt UTSW 7 126979600 missense probably benign
R0446:Cdipt UTSW 7 126978264 missense probably damaging 1.00
R0578:Cdipt UTSW 7 126979530 splice site probably null
R0828:Cdipt UTSW 7 126976920 missense probably damaging 1.00
R2020:Cdipt UTSW 7 126976933 missense possibly damaging 0.69
R4669:Cdipt UTSW 7 126978406 missense possibly damaging 0.82
R4731:Cdipt UTSW 7 126978358 missense probably damaging 1.00
R4732:Cdipt UTSW 7 126978358 missense probably damaging 1.00
R4733:Cdipt UTSW 7 126978358 missense probably damaging 1.00
R5590:Cdipt UTSW 7 126979532 splice site probably null
R5870:Cdipt UTSW 7 126978922 missense probably benign 0.28
R6034:Cdipt UTSW 7 126978325 missense probably damaging 0.99
R6034:Cdipt UTSW 7 126978325 missense probably damaging 0.99
R6084:Cdipt UTSW 7 126979601 missense probably benign 0.10
R6090:Cdipt UTSW 7 126976959 missense possibly damaging 0.94
R7571:Cdipt UTSW 7 126979622 missense probably benign 0.05
R8245:Cdipt UTSW 7 126979560 missense probably benign
R8929:Cdipt UTSW 7 126979653 missense probably damaging 0.99
Z1177:Cdipt UTSW 7 126976944 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCTTATCGGTGAGTGCTGC -3'
(R):5'- AGGGTCTAGGTCTTCCACAC -3'

Sequencing Primer
(F):5'- TGCGGCCCCAAAACCAG -3'
(R):5'- GGTCTAGGTCTTCCACACCCATC -3'
Posted On 2022-10-06