Incidental Mutation 'R9717:Mrpl38'
ID 730554
Institutional Source Beutler Lab
Gene Symbol Mrpl38
Ensembl Gene ENSMUSG00000020775
Gene Name mitochondrial ribosomal protein L38
Synonyms Rpml3, 1110036N21Rik, 4733401F03Rik, MRP-L3
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.935) question?
Stock # R9717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 116022643-116029694 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 116023296 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 319 (F319S)
Ref Sequence ENSEMBL: ENSMUSP00000102047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067632] [ENSMUST00000106439] [ENSMUST00000106440]
AlphaFold Q8K2M0
Predicted Effect probably benign
Transcript: ENSMUST00000067632
SMART Domains Protein: ENSMUSP00000063410
Gene: ENSMUSG00000054517

DomainStartEndE-ValueType
RING 13 51 2.47e-9 SMART
low complexity region 69 85 N/A INTRINSIC
Blast:BBOX 94 132 3e-10 BLAST
coiled coil region 140 175 N/A INTRINSIC
low complexity region 282 298 N/A INTRINSIC
PRY 333 383 3.67e-3 SMART
Pfam:SPRY 386 505 1.5e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106439
AA Change: F319S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102047
Gene: ENSMUSG00000020775
AA Change: F319S

DomainStartEndE-ValueType
low complexity region 55 67 N/A INTRINSIC
Pfam:PBP 183 313 3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106440
SMART Domains Protein: ENSMUSP00000102048
Gene: ENSMUSG00000054517

DomainStartEndE-ValueType
RING 13 51 2.47e-9 SMART
low complexity region 69 85 N/A INTRINSIC
Blast:BBOX 94 132 2e-10 BLAST
coiled coil region 140 175 N/A INTRINSIC
low complexity region 282 298 N/A INTRINSIC
PRY 333 383 3.67e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,668,900 (GRCm39) N2552I probably damaging Het
Amph G T 13: 19,309,253 (GRCm39) A444S probably benign Het
Ankrd52 A G 10: 128,216,457 (GRCm39) N157S probably benign Het
Arhgap29 T C 3: 121,797,920 (GRCm39) F537L probably benign Het
Asic1 A C 15: 99,590,657 (GRCm39) T136P probably damaging Het
Atg2b T C 12: 105,605,561 (GRCm39) Y1468C probably benign Het
Atm A G 9: 53,427,817 (GRCm39) L431P probably damaging Het
Atosb T C 4: 43,036,050 (GRCm39) H227R probably damaging Het
Btaf1 A G 19: 36,922,646 (GRCm39) T17A probably benign Het
Car10 A G 11: 93,195,367 (GRCm39) N58S probably benign Het
Cd79b A T 11: 106,202,845 (GRCm39) D252E probably damaging Het
Cdipt C T 7: 126,576,202 (GRCm39) probably benign Het
Cebpe T C 14: 54,949,165 (GRCm39) D84G probably damaging Het
Cenpj T C 14: 56,790,453 (GRCm39) E532G probably benign Het
Cherp A G 8: 73,216,920 (GRCm39) probably null Het
Chuk T C 19: 44,071,109 (GRCm39) D532G possibly damaging Het
Clec1b C T 6: 129,374,603 (GRCm39) T9I probably benign Het
Clspn G T 4: 126,458,756 (GRCm39) A280S possibly damaging Het
Cts3 T G 13: 61,712,799 (GRCm39) Y307S probably benign Het
Cyp2c39 T C 19: 39,556,493 (GRCm39) M443T possibly damaging Het
Dhx57 C T 17: 80,582,447 (GRCm39) R386H probably damaging Het
Dhx58 A T 11: 100,592,133 (GRCm39) M305K probably benign Het
Dlgap3 T C 4: 127,129,287 (GRCm39) L894P probably damaging Het
Dnah3 A T 7: 119,574,299 (GRCm39) N2164K probably damaging Het
Dnajb14 A G 3: 137,608,044 (GRCm39) N183S probably benign Het
Drd5 G T 5: 38,478,090 (GRCm39) R361L probably damaging Het
Duoxa1 T C 2: 122,135,622 (GRCm39) E159G probably damaging Het
Exoc1 T A 5: 76,711,079 (GRCm39) S659R probably benign Het
Fbln7 T C 2: 128,719,314 (GRCm39) I37T probably benign Het
Fcgrt T G 7: 44,744,853 (GRCm39) E205A possibly damaging Het
Fcho2 A T 13: 98,900,202 (GRCm39) S304T probably damaging Het
Gbp9 C A 5: 105,253,587 (GRCm39) G43* probably null Het
Gucy2d A G 7: 98,123,868 (GRCm39) K151R probably benign Het
Heatr4 T A 12: 84,024,829 (GRCm39) I331F probably damaging Het
Hmcn1 G A 1: 150,485,378 (GRCm39) T4408I probably damaging Het
Hoxc9 C T 15: 102,890,551 (GRCm39) T156M probably benign Het
Hrnr A T 3: 93,227,987 (GRCm39) E35V probably damaging Het
Idua C T 5: 108,818,037 (GRCm39) Q70* probably null Het
Klf5 A T 14: 99,539,189 (GRCm39) I201F probably damaging Het
Lonrf1 T C 8: 36,701,164 (GRCm39) K349E probably damaging Het
Lrp1b A T 2: 41,158,395 (GRCm39) D1721E Het
Mdh1 T A 11: 21,521,870 (GRCm39) probably benign Het
Mllt11 T C 3: 95,127,521 (GRCm39) H83R probably benign Het
Mrgprb4 A C 7: 47,848,583 (GRCm39) I115S possibly damaging Het
Naif1 A T 2: 32,344,907 (GRCm39) M204L probably benign Het
Ncan T A 8: 70,554,628 (GRCm39) D1063V probably damaging Het
Noto A T 6: 85,401,327 (GRCm39) R119W possibly damaging Het
Or4c115 G A 2: 88,927,573 (GRCm39) L233F probably benign Het
Or51h7 A T 7: 102,591,165 (GRCm39) D206E probably damaging Het
Or6c69 T A 10: 129,748,048 (GRCm39) Y33F probably damaging Het
Or8b3 A T 9: 38,314,841 (GRCm39) I224F probably damaging Het
Ovch2 A G 7: 107,393,584 (GRCm39) W181R probably damaging Het
Palm G C 10: 79,655,117 (GRCm39) G292R probably damaging Het
Pdgfrb T A 18: 61,205,787 (GRCm39) L591* probably null Het
Pik3c2g T C 6: 139,841,910 (GRCm39) S772P Het
Prx C A 7: 27,217,411 (GRCm39) D776E probably benign Het
Ptpra A G 2: 130,384,366 (GRCm39) E562G possibly damaging Het
Rbm4b A G 19: 4,807,359 (GRCm39) Y25C probably damaging Het
Reln T C 5: 22,136,427 (GRCm39) T2534A probably benign Het
Rnf123 T C 9: 107,954,963 (GRCm39) S14G probably benign Het
Rock2 A G 12: 17,015,602 (GRCm39) H833R probably benign Het
Rxfp3 A G 15: 11,037,111 (GRCm39) V87A possibly damaging Het
S100b G A 10: 76,092,936 (GRCm39) G23D probably damaging Het
Scn9a T A 2: 66,357,002 (GRCm39) M1100L probably benign Het
Septin11 T A 5: 93,296,266 (GRCm39) S55T possibly damaging Het
Speer4a3 T C 5: 26,154,829 (GRCm39) E257G probably damaging Het
Sv2b T A 7: 74,769,676 (GRCm39) Q622L probably benign Het
Taar7a T C 10: 23,868,799 (GRCm39) D194G probably benign Het
Trappc3 T C 4: 126,169,014 (GRCm39) I168T probably benign Het
Trim27 T C 13: 21,374,296 (GRCm39) probably null Het
Wdr49 G A 3: 75,304,359 (GRCm39) T109I probably benign Het
Wdr64 T C 1: 175,544,854 (GRCm39) Y96H probably damaging Het
Zfp219 A T 14: 52,247,049 (GRCm39) L26Q probably damaging Het
Zfp758 T A 17: 22,593,829 (GRCm39) V105D possibly damaging Het
Zfp975 C G 7: 42,312,332 (GRCm39) E94Q possibly damaging Het
Zfyve9 C T 4: 108,539,334 (GRCm39) A289T probably benign Het
Zscan5b T C 7: 6,234,525 (GRCm39) S184P possibly damaging Het
Other mutations in Mrpl38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01834:Mrpl38 APN 11 116,026,140 (GRCm39) nonsense probably null
PIT4445001:Mrpl38 UTSW 11 116,023,384 (GRCm39) critical splice acceptor site probably null
R0523:Mrpl38 UTSW 11 116,022,844 (GRCm39) missense probably benign 0.03
R1681:Mrpl38 UTSW 11 116,029,255 (GRCm39) splice site probably benign
R2209:Mrpl38 UTSW 11 116,029,288 (GRCm39) missense possibly damaging 0.68
R2329:Mrpl38 UTSW 11 116,022,845 (GRCm39) missense possibly damaging 0.68
R4617:Mrpl38 UTSW 11 116,023,278 (GRCm39) missense probably damaging 0.98
R4700:Mrpl38 UTSW 11 116,025,978 (GRCm39) unclassified probably benign
R4871:Mrpl38 UTSW 11 116,025,098 (GRCm39) missense probably damaging 1.00
R5293:Mrpl38 UTSW 11 116,023,599 (GRCm39) missense probably benign 0.07
R7014:Mrpl38 UTSW 11 116,025,741 (GRCm39) missense probably damaging 1.00
R7268:Mrpl38 UTSW 11 116,029,396 (GRCm39) missense possibly damaging 0.82
R7646:Mrpl38 UTSW 11 116,023,593 (GRCm39) missense probably damaging 0.99
R7701:Mrpl38 UTSW 11 116,026,104 (GRCm39) missense probably benign 0.00
R9420:Mrpl38 UTSW 11 116,023,276 (GRCm39) missense probably damaging 1.00
R9649:Mrpl38 UTSW 11 116,025,900 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGTGGACTTCTGCTGAC -3'
(R):5'- TAAGCGACACCCCTGTTTGTC -3'

Sequencing Primer
(F):5'- TGGCTGTCCTGGAACTCAGAAATC -3'
(R):5'- TGAGCCTCAAGCCAGCTCTC -3'
Posted On 2022-10-06