Mutagenetix > Incidental Mutation

Incidental Mutation 'R9717:Rock2'

730555

Institutional Source

Beutler Lab

Gene Symbol

Rock2

Ensembl Gene

ENSMUSG00000020580

Gene Name

Rho-associated coiled-coil containing protein kinase 2

Synonyms

B230113H15Rik, ROKalpha, Rho-kinase, Rock-II, Rock2m

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.857) question?

Stock #

R9717 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

16894895-16987823 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 16965601 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 833 (H833R)

Ref Sequence

ENSEMBL: ENSMUSP00000152813 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020904] [ENSMUST00000220688]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000020904
AA Change: H833R

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000020904
Gene: ENSMUSG00000020580
AA Change: H833R

Domain	Start	End	E-Value	Type
low complexity region	46	58	N/A	INTRINSIC
S_TKc	92	354	9.2e-96	SMART
S_TK_X	357	417	3.24e-13	SMART
PDB:3O0Z\|D	552	717	4e-46	PDB
low complexity region	723	743	N/A	INTRINSIC
low complexity region	882	909	N/A	INTRINSIC
low complexity region	939	954	N/A	INTRINSIC
Pfam:Rho_Binding	978	1046	4.7e-28	PFAM
coiled coil region	1054	1126	N/A	INTRINSIC
PH	1151	1351	2.88e-5	SMART
C1	1261	1315	2.21e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000220688
AA Change: H833R

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase that regulates cytokinesis, smooth muscle contraction, the formation of actin stress fibers and focal adhesions, and the activation of the c-fos serum response element. This protein, which is an isozyme of ROCK1 is a target for the small GTPase Rho. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this genes tend to die before birth; those that survive are small. Hemorrhaging occurs in the placenta, at the tips of hind limb buds and occasionally the tail. Subsequent development is normal and the size deficit is made up. They are fertile as adults. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	T	A	13: 81,520,781	N2552I	probably damaging	Het
Amph	G	T	13: 19,125,083	A444S	probably benign	Het
Ankrd52	A	G	10: 128,380,588	N157S	probably benign	Het
Arhgap29	T	C	3: 122,004,271	F537L	probably benign	Het
Asic1	A	C	15: 99,692,776	T136P	probably damaging	Het
Atg2b	T	C	12: 105,639,302	Y1468C	probably benign	Het
Atm	A	G	9: 53,516,517	L431P	probably damaging	Het
Btaf1	A	G	19: 36,945,246	T17A	probably benign	Het
Car10	A	G	11: 93,304,541	N58S	probably benign	Het
Cd79b	A	T	11: 106,312,019	D252E	probably damaging	Het
Cdipt	C	T	7: 126,977,030		probably benign	Het
Cebpe	T	C	14: 54,711,708	D84G	probably damaging	Het
Cenpj	T	C	14: 56,552,996	E532G	probably benign	Het
Cherp	A	G	8: 72,463,076		probably null	Het
Chuk	T	C	19: 44,082,670	D532G	possibly damaging	Het
Clec1b	C	T	6: 129,397,640	T9I	probably benign	Het
Clspn	G	T	4: 126,564,963	A280S	possibly damaging	Het
Cts3	T	G	13: 61,564,985	Y307S	probably benign	Het
Cyp2c39	T	C	19: 39,568,049	M443T	possibly damaging	Het
Dhx57	C	T	17: 80,275,018	R386H	probably damaging	Het
Dhx58	A	T	11: 100,701,307	M305K	probably benign	Het
Dlgap3	T	C	4: 127,235,494	L894P	probably damaging	Het
Dnah3	A	T	7: 119,975,076	N2164K	probably damaging	Het
Dnajb14	A	G	3: 137,902,283	N183S	probably benign	Het
Drd5	G	T	5: 38,320,747	R361L	probably damaging	Het
Duoxa1	T	C	2: 122,305,141	E159G	probably damaging	Het
Exoc1	T	A	5: 76,563,232	S659R	probably benign	Het
Fam214b	T	C	4: 43,036,050	H227R	probably damaging	Het
Fbln7	T	C	2: 128,877,394	I37T	probably benign	Het
Fcgrt	T	G	7: 45,095,429	E205A	possibly damaging	Het
Fcho2	A	T	13: 98,763,694	S304T	probably damaging	Het
Gbp9	C	A	5: 105,105,721	G43*	probably null	Het
Gm21671	T	C	5: 25,949,831	E257G	probably damaging	Het
Gucy2d	A	G	7: 98,474,661	K151R	probably benign	Het
Heatr4	T	A	12: 83,978,055	I331F	probably damaging	Het
Hmcn1	G	A	1: 150,609,627	T4408I	probably damaging	Het
Hoxc9	C	T	15: 102,982,119	T156M	probably benign	Het
Hrnr	A	T	3: 93,320,680	E35V	probably damaging	Het
Idua	C	T	5: 108,670,171	Q70*	probably null	Het
Klf5	A	T	14: 99,301,753	I201F	probably damaging	Het
Lonrf1	T	C	8: 36,234,010	K349E	probably damaging	Het
Lrp1b	A	T	2: 41,268,383	D1721E		Het
Mdh1	T	A	11: 21,571,870		probably benign	Het
Mllt11	T	C	3: 95,220,210	H83R	probably benign	Het
Mrgprb4	A	C	7: 48,198,835	I115S	possibly damaging	Het
Mrpl38	A	G	11: 116,132,470	F319S	probably damaging	Het
Naif1	A	T	2: 32,454,895	M204L	probably benign	Het
Ncan	T	A	8: 70,101,978	D1063V	probably damaging	Het
Noto	A	T	6: 85,424,345	R119W	possibly damaging	Het
Olfr1220	G	A	2: 89,097,229	L233F	probably benign	Het
Olfr147	A	T	9: 38,403,545	I224F	probably damaging	Het
Olfr573-ps1	A	T	7: 102,941,958	D206E	probably damaging	Het
Olfr816	T	A	10: 129,912,179	Y33F	probably damaging	Het
Ovch2	A	G	7: 107,794,377	W181R	probably damaging	Het
Palm	G	C	10: 79,819,283	G292R	probably damaging	Het
Pdgfrb	T	A	18: 61,072,715	L591*	probably null	Het
Pik3c2g	T	C	6: 139,896,184	S772P		Het
Prx	C	A	7: 27,517,986	D776E	probably benign	Het
Ptpra	A	G	2: 130,542,446	E562G	possibly damaging	Het
Rbm4b	A	G	19: 4,757,331	Y25C	probably damaging	Het
Reln	T	C	5: 21,931,429	T2534A	probably benign	Het
Rnf123	T	C	9: 108,077,764	S14G	probably benign	Het
Rxfp3	A	G	15: 11,037,025	V87A	possibly damaging	Het
S100b	G	A	10: 76,257,102	G23D	probably damaging	Het
Scn9a	T	A	2: 66,526,658	M1100L	probably benign	Het
Sept11	T	A	5: 93,148,407	S55T	possibly damaging	Het
Sv2b	T	A	7: 75,119,928	Q622L	probably benign	Het
Taar7a	T	C	10: 23,992,901	D194G	probably benign	Het
Trappc3	T	C	4: 126,275,221	I168T	probably benign	Het
Trim27	T	C	13: 21,190,126		probably null	Het
Wdr49	G	A	3: 75,397,052	T109I	probably benign	Het
Wdr64	T	C	1: 175,717,288	Y96H	probably damaging	Het
Zfp219	A	T	14: 52,009,592	L26Q	probably damaging	Het
Zfp758	T	A	17: 22,374,848	V105D	possibly damaging	Het
Zfp975	C	G	7: 42,662,908	E94Q	possibly damaging	Het
Zfyve9	C	T	4: 108,682,137	A289T	probably benign	Het
Zscan5b	T	C	7: 6,231,526	S184P	possibly damaging	Het

Other mutations in Rock2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00959:Rock2	APN	12	16978055	missense	probably benign	0.11
IGL01565:Rock2	APN	12	16953317	missense	possibly damaging	0.62
IGL01637:Rock2	APN	12	16965171	missense	probably benign
IGL02164:Rock2	APN	12	16965529	missense	probably damaging	1.00
IGL02249:Rock2	APN	12	16971041	unclassified	probably benign
IGL02490:Rock2	APN	12	16948563	missense	probably damaging	1.00
IGL02815:Rock2	APN	12	16966701	splice site	probably benign
IGL02979:Rock2	APN	12	16977940	missense	probably benign	0.00
IGL03095:Rock2	APN	12	16953340	missense	probably benign	0.00
IGL03198:Rock2	APN	12	16975507	missense	probably benign	0.27
R0087:Rock2	UTSW	12	16928966	missense	probably benign	0.20
R0189:Rock2	UTSW	12	16959516	splice site	probably benign
R0282:Rock2	UTSW	12	16977886	splice site	probably benign
R0497:Rock2	UTSW	12	16954953	missense	probably benign
R1210:Rock2	UTSW	12	16965469	missense	probably damaging	0.96
R1347:Rock2	UTSW	12	16977624	missense	possibly damaging	0.70
R1347:Rock2	UTSW	12	16977624	missense	possibly damaging	0.70
R1616:Rock2	UTSW	12	16972985	missense	probably benign	0.03
R1672:Rock2	UTSW	12	16965652	missense	probably benign	0.03
R1815:Rock2	UTSW	12	16972726	missense	probably benign	0.01
R1840:Rock2	UTSW	12	16928989	missense	probably benign
R2349:Rock2	UTSW	12	16977615	missense	probably benign	0.07
R3149:Rock2	UTSW	12	16965091	missense	probably damaging	1.00
R3979:Rock2	UTSW	12	16972736	missense	probably damaging	1.00
R4030:Rock2	UTSW	12	16975479	missense	probably damaging	1.00
R4470:Rock2	UTSW	12	16971275	nonsense	probably null
R4492:Rock2	UTSW	12	16977683	missense	probably damaging	1.00
R4519:Rock2	UTSW	12	16977737	missense	probably damaging	1.00
R4776:Rock2	UTSW	12	16977740	missense	probably damaging	1.00
R4794:Rock2	UTSW	12	16940407	missense	probably damaging	1.00
R4908:Rock2	UTSW	12	16959491	missense	probably benign	0.00
R5363:Rock2	UTSW	12	16965654	critical splice donor site	probably null
R5574:Rock2	UTSW	12	16961641	missense	possibly damaging	0.55
R5595:Rock2	UTSW	12	16942809	missense	probably damaging	1.00
R6158:Rock2	UTSW	12	16954918	missense	probably benign
R6728:Rock2	UTSW	12	16961736	missense	probably benign	0.00
R6828:Rock2	UTSW	12	16942959	splice site	probably null
R7019:Rock2	UTSW	12	16977740	missense	probably damaging	1.00
R7181:Rock2	UTSW	12	16973143	missense	probably benign	0.00
R7236:Rock2	UTSW	12	16929002	missense	probably damaging	1.00
R7362:Rock2	UTSW	12	16958421	missense	probably damaging	1.00
R7593:Rock2	UTSW	12	16958240	missense	probably benign	0.00
R7743:Rock2	UTSW	12	16976047	missense	probably damaging	1.00
R7782:Rock2	UTSW	12	16971110	missense	probably benign	0.17
R7935:Rock2	UTSW	12	16948557	missense	probably damaging	1.00
R8012:Rock2	UTSW	12	16942742	missense	probably damaging	1.00
R8339:Rock2	UTSW	12	16974860	missense	probably damaging	0.98
R8809:Rock2	UTSW	12	16965654	critical splice donor site	probably benign
R8918:Rock2	UTSW	12	16940421	nonsense	probably null
R9198:Rock2	UTSW	12	16965556	missense	probably benign
R9449:Rock2	UTSW	12	16977762	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACTTGCTTTATTGCGGAGGTC -3'
(R):5'- TGGCTCTGGAATTCAAATCTCTTG -3'

Sequencing Primer
(F):5'- CGGAGGTCTAGTGGTGAATGC -3'
(R):5'- GGAATTCAAATCTCTTGTTTCACCC -3'

Posted On

2022-10-06