Incidental Mutation 'R9717:Rock2'
ID 730555
Institutional Source Beutler Lab
Gene Symbol Rock2
Ensembl Gene ENSMUSG00000020580
Gene Name Rho-associated coiled-coil containing protein kinase 2
Synonyms Rock-II, ROKalpha, B230113H15Rik, Rock2m, Rho-kinase
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.821) question?
Stock # R9717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 16944896-17037824 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 17015602 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 833 (H833R)
Ref Sequence ENSEMBL: ENSMUSP00000152813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020904] [ENSMUST00000220688]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000020904
AA Change: H833R

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000020904
Gene: ENSMUSG00000020580
AA Change: H833R

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
S_TKc 92 354 9.2e-96 SMART
S_TK_X 357 417 3.24e-13 SMART
PDB:3O0Z|D 552 717 4e-46 PDB
low complexity region 723 743 N/A INTRINSIC
low complexity region 882 909 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
Pfam:Rho_Binding 978 1046 4.7e-28 PFAM
coiled coil region 1054 1126 N/A INTRINSIC
PH 1151 1351 2.88e-5 SMART
C1 1261 1315 2.21e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220688
AA Change: H833R

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase that regulates cytokinesis, smooth muscle contraction, the formation of actin stress fibers and focal adhesions, and the activation of the c-fos serum response element. This protein, which is an isozyme of ROCK1 is a target for the small GTPase Rho. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this genes tend to die before birth; those that survive are small. Hemorrhaging occurs in the placenta, at the tips of hind limb buds and occasionally the tail. Subsequent development is normal and the size deficit is made up. They are fertile as adults. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,668,900 (GRCm39) N2552I probably damaging Het
Amph G T 13: 19,309,253 (GRCm39) A444S probably benign Het
Ankrd52 A G 10: 128,216,457 (GRCm39) N157S probably benign Het
Arhgap29 T C 3: 121,797,920 (GRCm39) F537L probably benign Het
Asic1 A C 15: 99,590,657 (GRCm39) T136P probably damaging Het
Atg2b T C 12: 105,605,561 (GRCm39) Y1468C probably benign Het
Atm A G 9: 53,427,817 (GRCm39) L431P probably damaging Het
Atosb T C 4: 43,036,050 (GRCm39) H227R probably damaging Het
Btaf1 A G 19: 36,922,646 (GRCm39) T17A probably benign Het
Car10 A G 11: 93,195,367 (GRCm39) N58S probably benign Het
Cd79b A T 11: 106,202,845 (GRCm39) D252E probably damaging Het
Cdipt C T 7: 126,576,202 (GRCm39) probably benign Het
Cebpe T C 14: 54,949,165 (GRCm39) D84G probably damaging Het
Cenpj T C 14: 56,790,453 (GRCm39) E532G probably benign Het
Cherp A G 8: 73,216,920 (GRCm39) probably null Het
Chuk T C 19: 44,071,109 (GRCm39) D532G possibly damaging Het
Clec1b C T 6: 129,374,603 (GRCm39) T9I probably benign Het
Clspn G T 4: 126,458,756 (GRCm39) A280S possibly damaging Het
Cts3 T G 13: 61,712,799 (GRCm39) Y307S probably benign Het
Cyp2c39 T C 19: 39,556,493 (GRCm39) M443T possibly damaging Het
Dhx57 C T 17: 80,582,447 (GRCm39) R386H probably damaging Het
Dhx58 A T 11: 100,592,133 (GRCm39) M305K probably benign Het
Dlgap3 T C 4: 127,129,287 (GRCm39) L894P probably damaging Het
Dnah3 A T 7: 119,574,299 (GRCm39) N2164K probably damaging Het
Dnajb14 A G 3: 137,608,044 (GRCm39) N183S probably benign Het
Drd5 G T 5: 38,478,090 (GRCm39) R361L probably damaging Het
Duoxa1 T C 2: 122,135,622 (GRCm39) E159G probably damaging Het
Exoc1 T A 5: 76,711,079 (GRCm39) S659R probably benign Het
Fbln7 T C 2: 128,719,314 (GRCm39) I37T probably benign Het
Fcgrt T G 7: 44,744,853 (GRCm39) E205A possibly damaging Het
Fcho2 A T 13: 98,900,202 (GRCm39) S304T probably damaging Het
Gbp9 C A 5: 105,253,587 (GRCm39) G43* probably null Het
Gucy2d A G 7: 98,123,868 (GRCm39) K151R probably benign Het
Heatr4 T A 12: 84,024,829 (GRCm39) I331F probably damaging Het
Hmcn1 G A 1: 150,485,378 (GRCm39) T4408I probably damaging Het
Hoxc9 C T 15: 102,890,551 (GRCm39) T156M probably benign Het
Hrnr A T 3: 93,227,987 (GRCm39) E35V probably damaging Het
Idua C T 5: 108,818,037 (GRCm39) Q70* probably null Het
Klf5 A T 14: 99,539,189 (GRCm39) I201F probably damaging Het
Lonrf1 T C 8: 36,701,164 (GRCm39) K349E probably damaging Het
Lrp1b A T 2: 41,158,395 (GRCm39) D1721E Het
Mdh1 T A 11: 21,521,870 (GRCm39) probably benign Het
Mllt11 T C 3: 95,127,521 (GRCm39) H83R probably benign Het
Mrgprb4 A C 7: 47,848,583 (GRCm39) I115S possibly damaging Het
Mrpl38 A G 11: 116,023,296 (GRCm39) F319S probably damaging Het
Naif1 A T 2: 32,344,907 (GRCm39) M204L probably benign Het
Ncan T A 8: 70,554,628 (GRCm39) D1063V probably damaging Het
Noto A T 6: 85,401,327 (GRCm39) R119W possibly damaging Het
Or4c115 G A 2: 88,927,573 (GRCm39) L233F probably benign Het
Or51h7 A T 7: 102,591,165 (GRCm39) D206E probably damaging Het
Or6c69 T A 10: 129,748,048 (GRCm39) Y33F probably damaging Het
Or8b3 A T 9: 38,314,841 (GRCm39) I224F probably damaging Het
Ovch2 A G 7: 107,393,584 (GRCm39) W181R probably damaging Het
Palm G C 10: 79,655,117 (GRCm39) G292R probably damaging Het
Pdgfrb T A 18: 61,205,787 (GRCm39) L591* probably null Het
Pik3c2g T C 6: 139,841,910 (GRCm39) S772P Het
Prx C A 7: 27,217,411 (GRCm39) D776E probably benign Het
Ptpra A G 2: 130,384,366 (GRCm39) E562G possibly damaging Het
Rbm4b A G 19: 4,807,359 (GRCm39) Y25C probably damaging Het
Reln T C 5: 22,136,427 (GRCm39) T2534A probably benign Het
Rnf123 T C 9: 107,954,963 (GRCm39) S14G probably benign Het
Rxfp3 A G 15: 11,037,111 (GRCm39) V87A possibly damaging Het
S100b G A 10: 76,092,936 (GRCm39) G23D probably damaging Het
Scn9a T A 2: 66,357,002 (GRCm39) M1100L probably benign Het
Septin11 T A 5: 93,296,266 (GRCm39) S55T possibly damaging Het
Speer4a3 T C 5: 26,154,829 (GRCm39) E257G probably damaging Het
Sv2b T A 7: 74,769,676 (GRCm39) Q622L probably benign Het
Taar7a T C 10: 23,868,799 (GRCm39) D194G probably benign Het
Trappc3 T C 4: 126,169,014 (GRCm39) I168T probably benign Het
Trim27 T C 13: 21,374,296 (GRCm39) probably null Het
Wdr49 G A 3: 75,304,359 (GRCm39) T109I probably benign Het
Wdr64 T C 1: 175,544,854 (GRCm39) Y96H probably damaging Het
Zfp219 A T 14: 52,247,049 (GRCm39) L26Q probably damaging Het
Zfp758 T A 17: 22,593,829 (GRCm39) V105D possibly damaging Het
Zfp975 C G 7: 42,312,332 (GRCm39) E94Q possibly damaging Het
Zfyve9 C T 4: 108,539,334 (GRCm39) A289T probably benign Het
Zscan5b T C 7: 6,234,525 (GRCm39) S184P possibly damaging Het
Other mutations in Rock2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Rock2 APN 12 17,028,056 (GRCm39) missense probably benign 0.11
IGL01565:Rock2 APN 12 17,003,318 (GRCm39) missense possibly damaging 0.62
IGL01637:Rock2 APN 12 17,015,172 (GRCm39) missense probably benign
IGL02164:Rock2 APN 12 17,015,530 (GRCm39) missense probably damaging 1.00
IGL02249:Rock2 APN 12 17,021,042 (GRCm39) unclassified probably benign
IGL02490:Rock2 APN 12 16,998,564 (GRCm39) missense probably damaging 1.00
IGL02815:Rock2 APN 12 17,016,702 (GRCm39) splice site probably benign
IGL02979:Rock2 APN 12 17,027,941 (GRCm39) missense probably benign 0.00
IGL03095:Rock2 APN 12 17,003,341 (GRCm39) missense probably benign 0.00
IGL03198:Rock2 APN 12 17,025,508 (GRCm39) missense probably benign 0.27
R0087:Rock2 UTSW 12 16,978,967 (GRCm39) missense probably benign 0.20
R0189:Rock2 UTSW 12 17,009,517 (GRCm39) splice site probably benign
R0282:Rock2 UTSW 12 17,027,887 (GRCm39) splice site probably benign
R0497:Rock2 UTSW 12 17,004,954 (GRCm39) missense probably benign
R1210:Rock2 UTSW 12 17,015,470 (GRCm39) missense probably damaging 0.96
R1347:Rock2 UTSW 12 17,027,625 (GRCm39) missense possibly damaging 0.70
R1347:Rock2 UTSW 12 17,027,625 (GRCm39) missense possibly damaging 0.70
R1616:Rock2 UTSW 12 17,022,986 (GRCm39) missense probably benign 0.03
R1672:Rock2 UTSW 12 17,015,653 (GRCm39) missense probably benign 0.03
R1815:Rock2 UTSW 12 17,022,727 (GRCm39) missense probably benign 0.01
R1840:Rock2 UTSW 12 16,978,990 (GRCm39) missense probably benign
R2349:Rock2 UTSW 12 17,027,616 (GRCm39) missense probably benign 0.07
R3149:Rock2 UTSW 12 17,015,092 (GRCm39) missense probably damaging 1.00
R3979:Rock2 UTSW 12 17,022,737 (GRCm39) missense probably damaging 1.00
R4030:Rock2 UTSW 12 17,025,480 (GRCm39) missense probably damaging 1.00
R4470:Rock2 UTSW 12 17,021,276 (GRCm39) nonsense probably null
R4492:Rock2 UTSW 12 17,027,684 (GRCm39) missense probably damaging 1.00
R4519:Rock2 UTSW 12 17,027,738 (GRCm39) missense probably damaging 1.00
R4776:Rock2 UTSW 12 17,027,741 (GRCm39) missense probably damaging 1.00
R4794:Rock2 UTSW 12 16,990,408 (GRCm39) missense probably damaging 1.00
R4908:Rock2 UTSW 12 17,009,492 (GRCm39) missense probably benign 0.00
R5363:Rock2 UTSW 12 17,015,655 (GRCm39) critical splice donor site probably null
R5574:Rock2 UTSW 12 17,011,642 (GRCm39) missense possibly damaging 0.55
R5595:Rock2 UTSW 12 16,992,810 (GRCm39) missense probably damaging 1.00
R6158:Rock2 UTSW 12 17,004,919 (GRCm39) missense probably benign
R6728:Rock2 UTSW 12 17,011,737 (GRCm39) missense probably benign 0.00
R6828:Rock2 UTSW 12 16,992,960 (GRCm39) splice site probably null
R7019:Rock2 UTSW 12 17,027,741 (GRCm39) missense probably damaging 1.00
R7181:Rock2 UTSW 12 17,023,144 (GRCm39) missense probably benign 0.00
R7236:Rock2 UTSW 12 16,979,003 (GRCm39) missense probably damaging 1.00
R7362:Rock2 UTSW 12 17,008,422 (GRCm39) missense probably damaging 1.00
R7593:Rock2 UTSW 12 17,008,241 (GRCm39) missense probably benign 0.00
R7743:Rock2 UTSW 12 17,026,048 (GRCm39) missense probably damaging 1.00
R7782:Rock2 UTSW 12 17,021,111 (GRCm39) missense probably benign 0.17
R7935:Rock2 UTSW 12 16,998,558 (GRCm39) missense probably damaging 1.00
R8012:Rock2 UTSW 12 16,992,743 (GRCm39) missense probably damaging 1.00
R8339:Rock2 UTSW 12 17,024,861 (GRCm39) missense probably damaging 0.98
R8809:Rock2 UTSW 12 17,015,655 (GRCm39) critical splice donor site probably benign
R8918:Rock2 UTSW 12 16,990,422 (GRCm39) nonsense probably null
R9198:Rock2 UTSW 12 17,015,557 (GRCm39) missense probably benign
R9449:Rock2 UTSW 12 17,027,763 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTGCTTTATTGCGGAGGTC -3'
(R):5'- TGGCTCTGGAATTCAAATCTCTTG -3'

Sequencing Primer
(F):5'- CGGAGGTCTAGTGGTGAATGC -3'
(R):5'- GGAATTCAAATCTCTTGTTTCACCC -3'
Posted On 2022-10-06