Mutagenetix > Incidental Mutation

Incidental Mutation 'R9717:Amph'

730558

Institutional Source

Beutler Lab

Gene Symbol

Amph

Ensembl Gene

ENSMUSG00000021314

Gene Name

amphiphysin

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.316) question?

Stock #

R9717 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

18948205-19150921 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 19125083 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 444 (A444S)

Ref Sequence

ENSEMBL: ENSMUSP00000142766 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003345] [ENSMUST00000200466]

AlphaFold

Q7TQF7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000003345
AA Change: A440S

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000003345
Gene: ENSMUSG00000021314
AA Change: A440S

Domain	Start	End	E-Value	Type
BAR	12	233	8.47e-80	SMART
low complexity region	260	277	N/A	INTRINSIC
low complexity region	282	295	N/A	INTRINSIC
low complexity region	301	315	N/A	INTRINSIC
low complexity region	341	362	N/A	INTRINSIC
low complexity region	424	445	N/A	INTRINSIC
low complexity region	479	499	N/A	INTRINSIC
SH3	616	686	7.82e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000200466
AA Change: A444S

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000142766
Gene: ENSMUSG00000021314
AA Change: A444S

Domain	Start	End	E-Value	Type
BAR	12	233	2.3e-82	SMART
low complexity region	260	277	N/A	INTRINSIC
low complexity region	282	295	N/A	INTRINSIC
low complexity region	301	315	N/A	INTRINSIC
low complexity region	341	362	N/A	INTRINSIC
low complexity region	428	449	N/A	INTRINSIC
low complexity region	483	503	N/A	INTRINSIC
SH3	620	690	4.9e-12	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the cytoplasmic surface of synaptic vesicles. A subset of patients with stiff-man syndrome who were also affected by breast cancer are positive for autoantibodies against this protein. Alternate splicing of this gene results in two transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences have not been determined. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene exhibit learning deficits and synaptic vesicle recycling defects, and die between 2 to 5 months of age from rare irreversible seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	T	A	13: 81,520,781	N2552I	probably damaging	Het
Ankrd52	A	G	10: 128,380,588	N157S	probably benign	Het
Arhgap29	T	C	3: 122,004,271	F537L	probably benign	Het
Asic1	A	C	15: 99,692,776	T136P	probably damaging	Het
Atg2b	T	C	12: 105,639,302	Y1468C	probably benign	Het
Atm	A	G	9: 53,516,517	L431P	probably damaging	Het
Btaf1	A	G	19: 36,945,246	T17A	probably benign	Het
Car10	A	G	11: 93,304,541	N58S	probably benign	Het
Cd79b	A	T	11: 106,312,019	D252E	probably damaging	Het
Cdipt	C	T	7: 126,977,030		probably benign	Het
Cebpe	T	C	14: 54,711,708	D84G	probably damaging	Het
Cenpj	T	C	14: 56,552,996	E532G	probably benign	Het
Cherp	A	G	8: 72,463,076		probably null	Het
Chuk	T	C	19: 44,082,670	D532G	possibly damaging	Het
Clec1b	C	T	6: 129,397,640	T9I	probably benign	Het
Clspn	G	T	4: 126,564,963	A280S	possibly damaging	Het
Cts3	T	G	13: 61,564,985	Y307S	probably benign	Het
Cyp2c39	T	C	19: 39,568,049	M443T	possibly damaging	Het
Dhx57	C	T	17: 80,275,018	R386H	probably damaging	Het
Dhx58	A	T	11: 100,701,307	M305K	probably benign	Het
Dlgap3	T	C	4: 127,235,494	L894P	probably damaging	Het
Dnah3	A	T	7: 119,975,076	N2164K	probably damaging	Het
Dnajb14	A	G	3: 137,902,283	N183S	probably benign	Het
Drd5	G	T	5: 38,320,747	R361L	probably damaging	Het
Duoxa1	T	C	2: 122,305,141	E159G	probably damaging	Het
Exoc1	T	A	5: 76,563,232	S659R	probably benign	Het
Fam214b	T	C	4: 43,036,050	H227R	probably damaging	Het
Fbln7	T	C	2: 128,877,394	I37T	probably benign	Het
Fcgrt	T	G	7: 45,095,429	E205A	possibly damaging	Het
Fcho2	A	T	13: 98,763,694	S304T	probably damaging	Het
Gbp9	C	A	5: 105,105,721	G43*	probably null	Het
Gm21671	T	C	5: 25,949,831	E257G	probably damaging	Het
Gucy2d	A	G	7: 98,474,661	K151R	probably benign	Het
Heatr4	T	A	12: 83,978,055	I331F	probably damaging	Het
Hmcn1	G	A	1: 150,609,627	T4408I	probably damaging	Het
Hoxc9	C	T	15: 102,982,119	T156M	probably benign	Het
Hrnr	A	T	3: 93,320,680	E35V	probably damaging	Het
Idua	C	T	5: 108,670,171	Q70*	probably null	Het
Klf5	A	T	14: 99,301,753	I201F	probably damaging	Het
Lonrf1	T	C	8: 36,234,010	K349E	probably damaging	Het
Lrp1b	A	T	2: 41,268,383	D1721E		Het
Mdh1	T	A	11: 21,571,870		probably benign	Het
Mllt11	T	C	3: 95,220,210	H83R	probably benign	Het
Mrgprb4	A	C	7: 48,198,835	I115S	possibly damaging	Het
Mrpl38	A	G	11: 116,132,470	F319S	probably damaging	Het
Naif1	A	T	2: 32,454,895	M204L	probably benign	Het
Ncan	T	A	8: 70,101,978	D1063V	probably damaging	Het
Noto	A	T	6: 85,424,345	R119W	possibly damaging	Het
Olfr1220	G	A	2: 89,097,229	L233F	probably benign	Het
Olfr147	A	T	9: 38,403,545	I224F	probably damaging	Het
Olfr573-ps1	A	T	7: 102,941,958	D206E	probably damaging	Het
Olfr816	T	A	10: 129,912,179	Y33F	probably damaging	Het
Ovch2	A	G	7: 107,794,377	W181R	probably damaging	Het
Palm	G	C	10: 79,819,283	G292R	probably damaging	Het
Pdgfrb	T	A	18: 61,072,715	L591*	probably null	Het
Pik3c2g	T	C	6: 139,896,184	S772P		Het
Prx	C	A	7: 27,517,986	D776E	probably benign	Het
Ptpra	A	G	2: 130,542,446	E562G	possibly damaging	Het
Rbm4b	A	G	19: 4,757,331	Y25C	probably damaging	Het
Reln	T	C	5: 21,931,429	T2534A	probably benign	Het
Rnf123	T	C	9: 108,077,764	S14G	probably benign	Het
Rock2	A	G	12: 16,965,601	H833R	probably benign	Het
Rxfp3	A	G	15: 11,037,025	V87A	possibly damaging	Het
S100b	G	A	10: 76,257,102	G23D	probably damaging	Het
Scn9a	T	A	2: 66,526,658	M1100L	probably benign	Het
Sept11	T	A	5: 93,148,407	S55T	possibly damaging	Het
Sv2b	T	A	7: 75,119,928	Q622L	probably benign	Het
Taar7a	T	C	10: 23,992,901	D194G	probably benign	Het
Trappc3	T	C	4: 126,275,221	I168T	probably benign	Het
Trim27	T	C	13: 21,190,126		probably null	Het
Wdr49	G	A	3: 75,397,052	T109I	probably benign	Het
Wdr64	T	C	1: 175,717,288	Y96H	probably damaging	Het
Zfp219	A	T	14: 52,009,592	L26Q	probably damaging	Het
Zfp758	T	A	17: 22,374,848	V105D	possibly damaging	Het
Zfp975	C	G	7: 42,662,908	E94Q	possibly damaging	Het
Zfyve9	C	T	4: 108,682,137	A289T	probably benign	Het
Zscan5b	T	C	7: 6,231,526	S184P	possibly damaging	Het

Other mutations in Amph

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Amph	APN	13	19120606	missense	probably damaging	1.00
IGL01866:Amph	APN	13	19142002	missense	probably damaging	1.00
IGL02157:Amph	APN	13	19104231	missense	possibly damaging	0.60
IGL02300:Amph	APN	13	19086604	missense	probably damaging	1.00
IGL02435:Amph	APN	13	19139163	splice site	probably benign
IGL03060:Amph	APN	13	19094814	missense	probably damaging	0.99
IGL03122:Amph	APN	13	19102943	missense	probably damaging	0.98
R0037:Amph	UTSW	13	19100653	missense	possibly damaging	0.90
R0646:Amph	UTSW	13	19113116	missense	possibly damaging	0.95
R0652:Amph	UTSW	13	19086621	splice site	probably null
R1005:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1006:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1199:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1200:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1201:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1333:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1334:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1335:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1337:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1338:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1384:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1397:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1501:Amph	UTSW	13	19104291	nonsense	probably null
R1528:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1822:Amph	UTSW	13	18948455	missense	probably damaging	0.98
R2004:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R2006:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R2061:Amph	UTSW	13	19125035	nonsense	probably null
R2111:Amph	UTSW	13	19116266	splice site	probably benign
R2329:Amph	UTSW	13	19139350	missense	probably benign
R2878:Amph	UTSW	13	19104267	missense	possibly damaging	0.95
R3121:Amph	UTSW	13	19113146	nonsense	probably null
R3548:Amph	UTSW	13	19102959	missense	probably damaging	1.00
R4059:Amph	UTSW	13	19141998	missense	probably damaging	1.00
R4369:Amph	UTSW	13	19137700	missense	probably benign	0.20
R4492:Amph	UTSW	13	19149758	missense	possibly damaging	0.76
R4855:Amph	UTSW	13	19084208	missense	probably damaging	1.00
R4937:Amph	UTSW	13	19104345	missense	probably damaging	1.00
R4965:Amph	UTSW	13	19137699	missense	probably benign	0.12
R5777:Amph	UTSW	13	19046016	missense	probably damaging	1.00
R5787:Amph	UTSW	13	18948454	missense	possibly damaging	0.75
R6091:Amph	UTSW	13	19125123	missense	probably benign	0.01
R7100:Amph	UTSW	13	19149841	makesense	probably null
R7103:Amph	UTSW	13	19149738	missense	probably benign	0.00
R7451:Amph	UTSW	13	19077368	missense	probably damaging	1.00
R7522:Amph	UTSW	13	19086545	missense	probably damaging	0.96
R8165:Amph	UTSW	13	19094837	missense	probably benign	0.05
R8166:Amph	UTSW	13	18948490	missense	possibly damaging	0.91
R8214:Amph	UTSW	13	19104298	missense	possibly damaging	0.81
R9021:Amph	UTSW	13	19099901	missense	probably benign	0.35
R9241:Amph	UTSW	13	19094802	missense	probably damaging	1.00
R9469:Amph	UTSW	13	19086599	missense	probably damaging	1.00
R9755:Amph	UTSW	13	19113155	missense	probably damaging	1.00
V1662:Amph	UTSW	13	19139370	missense	probably benign	0.36
Z1177:Amph	UTSW	13	19139334	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- CAGTTCTACAAGACCCAGTGAC -3'
(R):5'- TATGCAGGGCAGCTAAGACC -3'

Sequencing Primer
(F):5'- ATGAATTCAGTGGAACTGGCTGC -3'
(R):5'- GCAGCTAAGACCCGGATAG -3'

Posted On

2022-10-06