Incidental Mutation 'R9717:Trim27'
ID 730559
Institutional Source Beutler Lab
Gene Symbol Trim27
Ensembl Gene ENSMUSG00000021326
Gene Name tripartite motif-containing 27
Synonyms Rfp
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.369) question?
Stock # R9717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 21363615-21378894 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 21374296 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021761] [ENSMUST00000221464] [ENSMUST00000222544] [ENSMUST00000223065]
AlphaFold Q62158
Predicted Effect probably null
Transcript: ENSMUST00000021761
SMART Domains Protein: ENSMUSP00000021761
Gene: ENSMUSG00000021326

DomainStartEndE-ValueType
RING 16 56 2.53e-6 SMART
BBOX 91 132 4.71e-15 SMART
low complexity region 146 170 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
PRY 315 367 7.09e-28 SMART
SPRY 368 493 1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139287
Predicted Effect probably benign
Transcript: ENSMUST00000221464
Predicted Effect probably benign
Transcript: ENSMUST00000222544
Predicted Effect probably benign
Transcript: ENSMUST00000223065
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to the nuclear matrix. It interacts with the enhancer of polycomb protein and represses gene transcription. It is also thought to be involved in the differentiation of male germ cells. Fusion of the N-terminus of this protein with the truncated C-terminus of the RET gene product has been shown to result in production of the ret transforming protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit exhibit increased potassium/calcium channel activity and TCR-stimulated calcium influx in Th1 and Th2 CD4 T cells. Mice homozygous for another gene trap allele exhibit decreased incidence of chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,668,900 (GRCm39) N2552I probably damaging Het
Amph G T 13: 19,309,253 (GRCm39) A444S probably benign Het
Ankrd52 A G 10: 128,216,457 (GRCm39) N157S probably benign Het
Arhgap29 T C 3: 121,797,920 (GRCm39) F537L probably benign Het
Asic1 A C 15: 99,590,657 (GRCm39) T136P probably damaging Het
Atg2b T C 12: 105,605,561 (GRCm39) Y1468C probably benign Het
Atm A G 9: 53,427,817 (GRCm39) L431P probably damaging Het
Atosb T C 4: 43,036,050 (GRCm39) H227R probably damaging Het
Btaf1 A G 19: 36,922,646 (GRCm39) T17A probably benign Het
Car10 A G 11: 93,195,367 (GRCm39) N58S probably benign Het
Cd79b A T 11: 106,202,845 (GRCm39) D252E probably damaging Het
Cdipt C T 7: 126,576,202 (GRCm39) probably benign Het
Cebpe T C 14: 54,949,165 (GRCm39) D84G probably damaging Het
Cenpj T C 14: 56,790,453 (GRCm39) E532G probably benign Het
Cherp A G 8: 73,216,920 (GRCm39) probably null Het
Chuk T C 19: 44,071,109 (GRCm39) D532G possibly damaging Het
Clec1b C T 6: 129,374,603 (GRCm39) T9I probably benign Het
Clspn G T 4: 126,458,756 (GRCm39) A280S possibly damaging Het
Cts3 T G 13: 61,712,799 (GRCm39) Y307S probably benign Het
Cyp2c39 T C 19: 39,556,493 (GRCm39) M443T possibly damaging Het
Dhx57 C T 17: 80,582,447 (GRCm39) R386H probably damaging Het
Dhx58 A T 11: 100,592,133 (GRCm39) M305K probably benign Het
Dlgap3 T C 4: 127,129,287 (GRCm39) L894P probably damaging Het
Dnah3 A T 7: 119,574,299 (GRCm39) N2164K probably damaging Het
Dnajb14 A G 3: 137,608,044 (GRCm39) N183S probably benign Het
Drd5 G T 5: 38,478,090 (GRCm39) R361L probably damaging Het
Duoxa1 T C 2: 122,135,622 (GRCm39) E159G probably damaging Het
Exoc1 T A 5: 76,711,079 (GRCm39) S659R probably benign Het
Fbln7 T C 2: 128,719,314 (GRCm39) I37T probably benign Het
Fcgrt T G 7: 44,744,853 (GRCm39) E205A possibly damaging Het
Fcho2 A T 13: 98,900,202 (GRCm39) S304T probably damaging Het
Gbp9 C A 5: 105,253,587 (GRCm39) G43* probably null Het
Gucy2d A G 7: 98,123,868 (GRCm39) K151R probably benign Het
Heatr4 T A 12: 84,024,829 (GRCm39) I331F probably damaging Het
Hmcn1 G A 1: 150,485,378 (GRCm39) T4408I probably damaging Het
Hoxc9 C T 15: 102,890,551 (GRCm39) T156M probably benign Het
Hrnr A T 3: 93,227,987 (GRCm39) E35V probably damaging Het
Idua C T 5: 108,818,037 (GRCm39) Q70* probably null Het
Klf5 A T 14: 99,539,189 (GRCm39) I201F probably damaging Het
Lonrf1 T C 8: 36,701,164 (GRCm39) K349E probably damaging Het
Lrp1b A T 2: 41,158,395 (GRCm39) D1721E Het
Mdh1 T A 11: 21,521,870 (GRCm39) probably benign Het
Mllt11 T C 3: 95,127,521 (GRCm39) H83R probably benign Het
Mrgprb4 A C 7: 47,848,583 (GRCm39) I115S possibly damaging Het
Mrpl38 A G 11: 116,023,296 (GRCm39) F319S probably damaging Het
Naif1 A T 2: 32,344,907 (GRCm39) M204L probably benign Het
Ncan T A 8: 70,554,628 (GRCm39) D1063V probably damaging Het
Noto A T 6: 85,401,327 (GRCm39) R119W possibly damaging Het
Or4c115 G A 2: 88,927,573 (GRCm39) L233F probably benign Het
Or51h7 A T 7: 102,591,165 (GRCm39) D206E probably damaging Het
Or6c69 T A 10: 129,748,048 (GRCm39) Y33F probably damaging Het
Or8b3 A T 9: 38,314,841 (GRCm39) I224F probably damaging Het
Ovch2 A G 7: 107,393,584 (GRCm39) W181R probably damaging Het
Palm G C 10: 79,655,117 (GRCm39) G292R probably damaging Het
Pdgfrb T A 18: 61,205,787 (GRCm39) L591* probably null Het
Pik3c2g T C 6: 139,841,910 (GRCm39) S772P Het
Prx C A 7: 27,217,411 (GRCm39) D776E probably benign Het
Ptpra A G 2: 130,384,366 (GRCm39) E562G possibly damaging Het
Rbm4b A G 19: 4,807,359 (GRCm39) Y25C probably damaging Het
Reln T C 5: 22,136,427 (GRCm39) T2534A probably benign Het
Rnf123 T C 9: 107,954,963 (GRCm39) S14G probably benign Het
Rock2 A G 12: 17,015,602 (GRCm39) H833R probably benign Het
Rxfp3 A G 15: 11,037,111 (GRCm39) V87A possibly damaging Het
S100b G A 10: 76,092,936 (GRCm39) G23D probably damaging Het
Scn9a T A 2: 66,357,002 (GRCm39) M1100L probably benign Het
Septin11 T A 5: 93,296,266 (GRCm39) S55T possibly damaging Het
Speer4a3 T C 5: 26,154,829 (GRCm39) E257G probably damaging Het
Sv2b T A 7: 74,769,676 (GRCm39) Q622L probably benign Het
Taar7a T C 10: 23,868,799 (GRCm39) D194G probably benign Het
Trappc3 T C 4: 126,169,014 (GRCm39) I168T probably benign Het
Wdr49 G A 3: 75,304,359 (GRCm39) T109I probably benign Het
Wdr64 T C 1: 175,544,854 (GRCm39) Y96H probably damaging Het
Zfp219 A T 14: 52,247,049 (GRCm39) L26Q probably damaging Het
Zfp758 T A 17: 22,593,829 (GRCm39) V105D possibly damaging Het
Zfp975 C G 7: 42,312,332 (GRCm39) E94Q possibly damaging Het
Zfyve9 C T 4: 108,539,334 (GRCm39) A289T probably benign Het
Zscan5b T C 7: 6,234,525 (GRCm39) S184P possibly damaging Het
Other mutations in Trim27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01865:Trim27 APN 13 21,376,662 (GRCm39) missense probably damaging 0.98
IGL02756:Trim27 APN 13 21,374,256 (GRCm39) splice site probably benign
IGL03199:Trim27 APN 13 21,375,421 (GRCm39) splice site probably null
R0016:Trim27 UTSW 13 21,375,399 (GRCm39) missense probably benign 0.14
R0016:Trim27 UTSW 13 21,375,399 (GRCm39) missense probably benign 0.14
R1709:Trim27 UTSW 13 21,372,235 (GRCm39) critical splice donor site probably null
R2188:Trim27 UTSW 13 21,367,987 (GRCm39) missense probably damaging 1.00
R4472:Trim27 UTSW 13 21,374,056 (GRCm39) missense probably benign 0.00
R4657:Trim27 UTSW 13 21,367,930 (GRCm39) missense probably damaging 1.00
R4677:Trim27 UTSW 13 21,365,086 (GRCm39) critical splice donor site probably null
R5019:Trim27 UTSW 13 21,374,134 (GRCm39) missense probably damaging 1.00
R5584:Trim27 UTSW 13 21,376,719 (GRCm39) missense probably damaging 1.00
R6226:Trim27 UTSW 13 21,365,086 (GRCm39) critical splice donor site probably benign
R6774:Trim27 UTSW 13 21,376,624 (GRCm39) missense probably damaging 1.00
R7378:Trim27 UTSW 13 21,376,631 (GRCm39) missense possibly damaging 0.92
R7573:Trim27 UTSW 13 21,364,770 (GRCm39) missense probably damaging 0.96
R7662:Trim27 UTSW 13 21,376,328 (GRCm39) missense probably benign 0.05
R8272:Trim27 UTSW 13 21,364,780 (GRCm39) missense probably benign 0.14
R8723:Trim27 UTSW 13 21,374,807 (GRCm39) intron probably benign
R8914:Trim27 UTSW 13 21,364,993 (GRCm39) missense possibly damaging 0.77
R9380:Trim27 UTSW 13 21,364,680 (GRCm39) missense probably benign 0.00
X0062:Trim27 UTSW 13 21,368,044 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CAGAAAGTCTAAAACAGTTCACAGG -3'
(R):5'- CTGGTTACTAGCCACCGAAC -3'

Sequencing Primer
(F):5'- TAAAACAGTTCACAGGTAATATGAGG -3'
(R):5'- GCTAGACTGGGCTACACATTATGAC -3'
Posted On 2022-10-06