Incidental Mutation 'R9717:Fcho2'
ID 730562
Institutional Source Beutler Lab
Gene Symbol Fcho2
Ensembl Gene ENSMUSG00000041685
Gene Name FCH domain only 2
Synonyms 5832424M12Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 98859911-98951957 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 98900202 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 304 (S304T)
Ref Sequence ENSEMBL: ENSMUSP00000042959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040340] [ENSMUST00000099277] [ENSMUST00000109403] [ENSMUST00000179563] [ENSMUST00000224992] [ENSMUST00000225840]
AlphaFold Q3UQN2
Predicted Effect probably damaging
Transcript: ENSMUST00000040340
AA Change: S304T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042959
Gene: ENSMUSG00000041685
AA Change: S304T

DomainStartEndE-ValueType
FCH 8 94 1.74e-19 SMART
low complexity region 341 351 N/A INTRINSIC
low complexity region 433 456 N/A INTRINSIC
low complexity region 485 501 N/A INTRINSIC
low complexity region 503 520 N/A INTRINSIC
Pfam:muHD 542 808 2.5e-71 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000096883
Gene: ENSMUSG00000041685
AA Change: S304T

DomainStartEndE-ValueType
FCH 8 94 1.74e-19 SMART
low complexity region 342 352 N/A INTRINSIC
low complexity region 434 457 N/A INTRINSIC
low complexity region 486 502 N/A INTRINSIC
low complexity region 504 521 N/A INTRINSIC
Pfam:muHD 543 803 4.7e-68 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109403
AA Change: S304T

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105030
Gene: ENSMUSG00000041685
AA Change: S304T

DomainStartEndE-ValueType
FCH 8 94 1.74e-19 SMART
low complexity region 341 351 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179563
AA Change: S304T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137422
Gene: ENSMUSG00000041685
AA Change: S304T

DomainStartEndE-ValueType
FCH 8 94 1.74e-19 SMART
low complexity region 341 351 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224992
AA Change: S304T

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000225840
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,668,900 (GRCm39) N2552I probably damaging Het
Amph G T 13: 19,309,253 (GRCm39) A444S probably benign Het
Ankrd52 A G 10: 128,216,457 (GRCm39) N157S probably benign Het
Arhgap29 T C 3: 121,797,920 (GRCm39) F537L probably benign Het
Asic1 A C 15: 99,590,657 (GRCm39) T136P probably damaging Het
Atg2b T C 12: 105,605,561 (GRCm39) Y1468C probably benign Het
Atm A G 9: 53,427,817 (GRCm39) L431P probably damaging Het
Atosb T C 4: 43,036,050 (GRCm39) H227R probably damaging Het
Btaf1 A G 19: 36,922,646 (GRCm39) T17A probably benign Het
Car10 A G 11: 93,195,367 (GRCm39) N58S probably benign Het
Cd79b A T 11: 106,202,845 (GRCm39) D252E probably damaging Het
Cdipt C T 7: 126,576,202 (GRCm39) probably benign Het
Cebpe T C 14: 54,949,165 (GRCm39) D84G probably damaging Het
Cenpj T C 14: 56,790,453 (GRCm39) E532G probably benign Het
Cherp A G 8: 73,216,920 (GRCm39) probably null Het
Chuk T C 19: 44,071,109 (GRCm39) D532G possibly damaging Het
Clec1b C T 6: 129,374,603 (GRCm39) T9I probably benign Het
Clspn G T 4: 126,458,756 (GRCm39) A280S possibly damaging Het
Cts3 T G 13: 61,712,799 (GRCm39) Y307S probably benign Het
Cyp2c39 T C 19: 39,556,493 (GRCm39) M443T possibly damaging Het
Dhx57 C T 17: 80,582,447 (GRCm39) R386H probably damaging Het
Dhx58 A T 11: 100,592,133 (GRCm39) M305K probably benign Het
Dlgap3 T C 4: 127,129,287 (GRCm39) L894P probably damaging Het
Dnah3 A T 7: 119,574,299 (GRCm39) N2164K probably damaging Het
Dnajb14 A G 3: 137,608,044 (GRCm39) N183S probably benign Het
Drd5 G T 5: 38,478,090 (GRCm39) R361L probably damaging Het
Duoxa1 T C 2: 122,135,622 (GRCm39) E159G probably damaging Het
Exoc1 T A 5: 76,711,079 (GRCm39) S659R probably benign Het
Fbln7 T C 2: 128,719,314 (GRCm39) I37T probably benign Het
Fcgrt T G 7: 44,744,853 (GRCm39) E205A possibly damaging Het
Gbp9 C A 5: 105,253,587 (GRCm39) G43* probably null Het
Gucy2d A G 7: 98,123,868 (GRCm39) K151R probably benign Het
Heatr4 T A 12: 84,024,829 (GRCm39) I331F probably damaging Het
Hmcn1 G A 1: 150,485,378 (GRCm39) T4408I probably damaging Het
Hoxc9 C T 15: 102,890,551 (GRCm39) T156M probably benign Het
Hrnr A T 3: 93,227,987 (GRCm39) E35V probably damaging Het
Idua C T 5: 108,818,037 (GRCm39) Q70* probably null Het
Klf5 A T 14: 99,539,189 (GRCm39) I201F probably damaging Het
Lonrf1 T C 8: 36,701,164 (GRCm39) K349E probably damaging Het
Lrp1b A T 2: 41,158,395 (GRCm39) D1721E Het
Mdh1 T A 11: 21,521,870 (GRCm39) probably benign Het
Mllt11 T C 3: 95,127,521 (GRCm39) H83R probably benign Het
Mrgprb4 A C 7: 47,848,583 (GRCm39) I115S possibly damaging Het
Mrpl38 A G 11: 116,023,296 (GRCm39) F319S probably damaging Het
Naif1 A T 2: 32,344,907 (GRCm39) M204L probably benign Het
Ncan T A 8: 70,554,628 (GRCm39) D1063V probably damaging Het
Noto A T 6: 85,401,327 (GRCm39) R119W possibly damaging Het
Or4c115 G A 2: 88,927,573 (GRCm39) L233F probably benign Het
Or51h7 A T 7: 102,591,165 (GRCm39) D206E probably damaging Het
Or6c69 T A 10: 129,748,048 (GRCm39) Y33F probably damaging Het
Or8b3 A T 9: 38,314,841 (GRCm39) I224F probably damaging Het
Ovch2 A G 7: 107,393,584 (GRCm39) W181R probably damaging Het
Palm G C 10: 79,655,117 (GRCm39) G292R probably damaging Het
Pdgfrb T A 18: 61,205,787 (GRCm39) L591* probably null Het
Pik3c2g T C 6: 139,841,910 (GRCm39) S772P Het
Prx C A 7: 27,217,411 (GRCm39) D776E probably benign Het
Ptpra A G 2: 130,384,366 (GRCm39) E562G possibly damaging Het
Rbm4b A G 19: 4,807,359 (GRCm39) Y25C probably damaging Het
Reln T C 5: 22,136,427 (GRCm39) T2534A probably benign Het
Rnf123 T C 9: 107,954,963 (GRCm39) S14G probably benign Het
Rock2 A G 12: 17,015,602 (GRCm39) H833R probably benign Het
Rxfp3 A G 15: 11,037,111 (GRCm39) V87A possibly damaging Het
S100b G A 10: 76,092,936 (GRCm39) G23D probably damaging Het
Scn9a T A 2: 66,357,002 (GRCm39) M1100L probably benign Het
Septin11 T A 5: 93,296,266 (GRCm39) S55T possibly damaging Het
Speer4a3 T C 5: 26,154,829 (GRCm39) E257G probably damaging Het
Sv2b T A 7: 74,769,676 (GRCm39) Q622L probably benign Het
Taar7a T C 10: 23,868,799 (GRCm39) D194G probably benign Het
Trappc3 T C 4: 126,169,014 (GRCm39) I168T probably benign Het
Trim27 T C 13: 21,374,296 (GRCm39) probably null Het
Wdr49 G A 3: 75,304,359 (GRCm39) T109I probably benign Het
Wdr64 T C 1: 175,544,854 (GRCm39) Y96H probably damaging Het
Zfp219 A T 14: 52,247,049 (GRCm39) L26Q probably damaging Het
Zfp758 T A 17: 22,593,829 (GRCm39) V105D possibly damaging Het
Zfp975 C G 7: 42,312,332 (GRCm39) E94Q possibly damaging Het
Zfyve9 C T 4: 108,539,334 (GRCm39) A289T probably benign Het
Zscan5b T C 7: 6,234,525 (GRCm39) S184P possibly damaging Het
Other mutations in Fcho2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Fcho2 APN 13 98,926,315 (GRCm39) missense probably benign
IGL02058:Fcho2 APN 13 98,867,414 (GRCm39) missense probably damaging 0.98
IGL02516:Fcho2 APN 13 98,866,720 (GRCm39) missense probably benign 0.08
IGL02715:Fcho2 APN 13 98,932,843 (GRCm39) missense probably damaging 1.00
IGL03243:Fcho2 APN 13 98,913,892 (GRCm39) splice site probably benign
R0044:Fcho2 UTSW 13 98,892,052 (GRCm39) intron probably benign
R0087:Fcho2 UTSW 13 98,871,594 (GRCm39) missense probably benign 0.00
R0472:Fcho2 UTSW 13 98,884,775 (GRCm39) missense probably benign 0.01
R0501:Fcho2 UTSW 13 98,901,023 (GRCm39) missense possibly damaging 0.92
R1022:Fcho2 UTSW 13 98,869,167 (GRCm39) missense probably damaging 1.00
R1024:Fcho2 UTSW 13 98,869,167 (GRCm39) missense probably damaging 1.00
R1130:Fcho2 UTSW 13 98,884,797 (GRCm39) missense probably damaging 1.00
R1495:Fcho2 UTSW 13 98,886,358 (GRCm39) critical splice donor site probably null
R1593:Fcho2 UTSW 13 98,921,315 (GRCm39) missense possibly damaging 0.92
R1608:Fcho2 UTSW 13 98,862,706 (GRCm39) missense probably benign 0.01
R1638:Fcho2 UTSW 13 98,882,403 (GRCm39) missense possibly damaging 0.83
R1643:Fcho2 UTSW 13 98,921,324 (GRCm39) missense probably benign 0.00
R2125:Fcho2 UTSW 13 98,912,406 (GRCm39) missense possibly damaging 0.83
R3117:Fcho2 UTSW 13 98,913,946 (GRCm39) missense probably damaging 1.00
R3968:Fcho2 UTSW 13 98,871,564 (GRCm39) missense probably benign 0.06
R3970:Fcho2 UTSW 13 98,871,564 (GRCm39) missense probably benign 0.06
R4079:Fcho2 UTSW 13 98,892,120 (GRCm39) missense probably damaging 0.99
R4816:Fcho2 UTSW 13 98,942,874 (GRCm39) missense probably damaging 1.00
R5338:Fcho2 UTSW 13 98,867,399 (GRCm39) missense probably damaging 1.00
R5437:Fcho2 UTSW 13 98,913,982 (GRCm39) missense possibly damaging 0.95
R5457:Fcho2 UTSW 13 98,926,275 (GRCm39) missense probably damaging 0.99
R5733:Fcho2 UTSW 13 98,926,310 (GRCm39) missense probably damaging 0.99
R6136:Fcho2 UTSW 13 98,926,275 (GRCm39) missense probably damaging 0.99
R6186:Fcho2 UTSW 13 98,951,591 (GRCm39) missense probably benign 0.01
R6365:Fcho2 UTSW 13 98,926,367 (GRCm39) missense probably benign 0.20
R7041:Fcho2 UTSW 13 98,921,334 (GRCm39) missense possibly damaging 0.72
R7168:Fcho2 UTSW 13 98,925,971 (GRCm39) missense probably benign
R7218:Fcho2 UTSW 13 98,890,121 (GRCm39) splice site probably null
R7243:Fcho2 UTSW 13 98,891,724 (GRCm39) missense possibly damaging 0.94
R7533:Fcho2 UTSW 13 98,921,307 (GRCm39) missense probably benign 0.00
R7757:Fcho2 UTSW 13 98,901,011 (GRCm39) critical splice donor site probably null
R7904:Fcho2 UTSW 13 98,932,871 (GRCm39) missense possibly damaging 0.54
R7993:Fcho2 UTSW 13 98,888,524 (GRCm39) splice site probably null
R8004:Fcho2 UTSW 13 98,926,013 (GRCm39) missense possibly damaging 0.80
R8358:Fcho2 UTSW 13 98,862,282 (GRCm39) nonsense probably null
R8512:Fcho2 UTSW 13 98,891,730 (GRCm39) missense possibly damaging 0.69
R8692:Fcho2 UTSW 13 98,882,382 (GRCm39) frame shift probably null
R8792:Fcho2 UTSW 13 98,951,769 (GRCm39) unclassified probably benign
R8954:Fcho2 UTSW 13 98,913,985 (GRCm39) missense probably benign 0.05
R8969:Fcho2 UTSW 13 98,891,604 (GRCm39) nonsense probably null
R9091:Fcho2 UTSW 13 98,925,869 (GRCm39) critical splice donor site probably null
R9092:Fcho2 UTSW 13 98,886,391 (GRCm39) missense probably benign 0.01
R9171:Fcho2 UTSW 13 98,891,607 (GRCm39) missense probably benign
R9270:Fcho2 UTSW 13 98,925,869 (GRCm39) critical splice donor site probably null
R9668:Fcho2 UTSW 13 98,913,965 (GRCm39) missense probably benign 0.12
R9672:Fcho2 UTSW 13 98,869,178 (GRCm39) nonsense probably null
X0018:Fcho2 UTSW 13 98,868,590 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGATGTCCATGAACAACC -3'
(R):5'- TCATCCAGAGTGTGCTTGAC -3'

Sequencing Primer
(F):5'- TGGGATGTCCATGAACAACCTATAG -3'
(R):5'- GTGCTTGACACTTACGAAAGATTTG -3'
Posted On 2022-10-06