Incidental Mutation 'R9717:Cebpe'
ID 730564
Institutional Source Beutler Lab
Gene Symbol Cebpe
Ensembl Gene ENSMUSG00000052435
Gene Name CCAAT/enhancer binding protein (C/EBP), epsilon
Synonyms CRP1, C/EBPepsilon, LOC239097, C/EBPe
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.432) question?
Stock # R9717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 54710360-54712174 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 54711708 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 84 (D84G)
Ref Sequence ENSEMBL: ENSMUSP00000068927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064290]
AlphaFold Q6PZD9
Predicted Effect probably damaging
Transcript: ENSMUST00000064290
AA Change: D84G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000068927
Gene: ENSMUSG00000052435
AA Change: D84G

DomainStartEndE-ValueType
PDB:3T92|A 37 61 8e-8 PDB
low complexity region 165 190 N/A INTRINSIC
BRLZ 202 266 4e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bZIP transcription factor which can bind as a homodimer to certain DNA regulatory regions. It can also form heterodimers with the related protein CEBP-delta. The encoded protein may be essential for terminal differentiation and functional maturation of committed granulocyte progenitor cells. Mutations in this gene have been associated with Specific Granule Deficiency, a rare congenital disorder. Multiple variants of this gene have been described, but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired neutrophil and eosinophil development and myelodysplasia. Mutant animals are susceptible to secondary bacterial infections such as conjuntivitis, rhinitis, and pneumonia, and become moribund between 2-5 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,520,781 N2552I probably damaging Het
Amph G T 13: 19,125,083 A444S probably benign Het
Ankrd52 A G 10: 128,380,588 N157S probably benign Het
Arhgap29 T C 3: 122,004,271 F537L probably benign Het
Asic1 A C 15: 99,692,776 T136P probably damaging Het
Atg2b T C 12: 105,639,302 Y1468C probably benign Het
Atm A G 9: 53,516,517 L431P probably damaging Het
Btaf1 A G 19: 36,945,246 T17A probably benign Het
Car10 A G 11: 93,304,541 N58S probably benign Het
Cd79b A T 11: 106,312,019 D252E probably damaging Het
Cdipt C T 7: 126,977,030 probably benign Het
Cenpj T C 14: 56,552,996 E532G probably benign Het
Cherp A G 8: 72,463,076 probably null Het
Chuk T C 19: 44,082,670 D532G possibly damaging Het
Clec1b C T 6: 129,397,640 T9I probably benign Het
Clspn G T 4: 126,564,963 A280S possibly damaging Het
Cts3 T G 13: 61,564,985 Y307S probably benign Het
Cyp2c39 T C 19: 39,568,049 M443T possibly damaging Het
Dhx57 C T 17: 80,275,018 R386H probably damaging Het
Dhx58 A T 11: 100,701,307 M305K probably benign Het
Dlgap3 T C 4: 127,235,494 L894P probably damaging Het
Dnah3 A T 7: 119,975,076 N2164K probably damaging Het
Dnajb14 A G 3: 137,902,283 N183S probably benign Het
Drd5 G T 5: 38,320,747 R361L probably damaging Het
Duoxa1 T C 2: 122,305,141 E159G probably damaging Het
Exoc1 T A 5: 76,563,232 S659R probably benign Het
Fam214b T C 4: 43,036,050 H227R probably damaging Het
Fbln7 T C 2: 128,877,394 I37T probably benign Het
Fcgrt T G 7: 45,095,429 E205A possibly damaging Het
Fcho2 A T 13: 98,763,694 S304T probably damaging Het
Gbp9 C A 5: 105,105,721 G43* probably null Het
Gm21671 T C 5: 25,949,831 E257G probably damaging Het
Gucy2d A G 7: 98,474,661 K151R probably benign Het
Heatr4 T A 12: 83,978,055 I331F probably damaging Het
Hmcn1 G A 1: 150,609,627 T4408I probably damaging Het
Hoxc9 C T 15: 102,982,119 T156M probably benign Het
Hrnr A T 3: 93,320,680 E35V probably damaging Het
Idua C T 5: 108,670,171 Q70* probably null Het
Klf5 A T 14: 99,301,753 I201F probably damaging Het
Lonrf1 T C 8: 36,234,010 K349E probably damaging Het
Lrp1b A T 2: 41,268,383 D1721E Het
Mdh1 T A 11: 21,571,870 probably benign Het
Mllt11 T C 3: 95,220,210 H83R probably benign Het
Mrgprb4 A C 7: 48,198,835 I115S possibly damaging Het
Mrpl38 A G 11: 116,132,470 F319S probably damaging Het
Naif1 A T 2: 32,454,895 M204L probably benign Het
Ncan T A 8: 70,101,978 D1063V probably damaging Het
Noto A T 6: 85,424,345 R119W possibly damaging Het
Olfr1220 G A 2: 89,097,229 L233F probably benign Het
Olfr147 A T 9: 38,403,545 I224F probably damaging Het
Olfr573-ps1 A T 7: 102,941,958 D206E probably damaging Het
Olfr816 T A 10: 129,912,179 Y33F probably damaging Het
Ovch2 A G 7: 107,794,377 W181R probably damaging Het
Palm G C 10: 79,819,283 G292R probably damaging Het
Pdgfrb T A 18: 61,072,715 L591* probably null Het
Pik3c2g T C 6: 139,896,184 S772P Het
Prx C A 7: 27,517,986 D776E probably benign Het
Ptpra A G 2: 130,542,446 E562G possibly damaging Het
Rbm4b A G 19: 4,757,331 Y25C probably damaging Het
Reln T C 5: 21,931,429 T2534A probably benign Het
Rnf123 T C 9: 108,077,764 S14G probably benign Het
Rock2 A G 12: 16,965,601 H833R probably benign Het
Rxfp3 A G 15: 11,037,025 V87A possibly damaging Het
S100b G A 10: 76,257,102 G23D probably damaging Het
Scn9a T A 2: 66,526,658 M1100L probably benign Het
Sept11 T A 5: 93,148,407 S55T possibly damaging Het
Sv2b T A 7: 75,119,928 Q622L probably benign Het
Taar7a T C 10: 23,992,901 D194G probably benign Het
Trappc3 T C 4: 126,275,221 I168T probably benign Het
Trim27 T C 13: 21,190,126 probably null Het
Wdr49 G A 3: 75,397,052 T109I probably benign Het
Wdr64 T C 1: 175,717,288 Y96H probably damaging Het
Zfp219 A T 14: 52,009,592 L26Q probably damaging Het
Zfp758 T A 17: 22,374,848 V105D possibly damaging Het
Zfp975 C G 7: 42,662,908 E94Q possibly damaging Het
Zfyve9 C T 4: 108,682,137 A289T probably benign Het
Zscan5b T C 7: 6,231,526 S184P possibly damaging Het
Other mutations in Cebpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02129:Cebpe APN 14 54711613 missense probably damaging 1.00
IGL02618:Cebpe APN 14 54710777 missense probably damaging 1.00
R0071:Cebpe UTSW 14 54710604 missense probably damaging 1.00
R0071:Cebpe UTSW 14 54710604 missense probably damaging 1.00
R1740:Cebpe UTSW 14 54711942 missense probably damaging 1.00
R1742:Cebpe UTSW 14 54711600 missense probably benign 0.19
R5497:Cebpe UTSW 14 54710595 missense probably benign 0.39
R7094:Cebpe UTSW 14 54710603 missense probably damaging 1.00
R7505:Cebpe UTSW 14 54710656 missense probably damaging 1.00
R7592:Cebpe UTSW 14 54711841 missense probably damaging 0.99
R8956:Cebpe UTSW 14 54711664 missense probably damaging 1.00
Z1177:Cebpe UTSW 14 54710580 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATTGTAGCTGCCTCGACTGG -3'
(R):5'- CTACTATGAGTGCGAGCCTC -3'

Sequencing Primer
(F):5'- ACTGGTGCCTCGGTTGC -3'
(R):5'- AGCAGCCACTTGAGTTCTCAG -3'
Posted On 2022-10-06