Mutagenetix > Incidental Mutation

Incidental Mutation 'R9717:Cenpj'

730565

Institutional Source

Beutler Lab

Gene Symbol

Cenpj

Ensembl Gene

ENSMUSG00000064128

Gene Name

centromere protein J

Synonyms

4932437H03Rik, Sas4

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9717 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

56526761-56575425 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 56552996 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 532 (E532G)

Ref Sequence

ENSEMBL: ENSMUSP00000065949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065302] [ENSMUST00000225951]

AlphaFold

Q569L8

Predicted Effect

probably benign
Transcript: ENSMUST00000065302
AA Change: E532G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000065949
Gene: ENSMUSG00000064128
AA Change: E532G

Domain	Start	End	E-Value	Type
low complexity region	60	76	N/A	INTRINSIC
coiled coil region	140	185	N/A	INTRINSIC
low complexity region	330	350	N/A	INTRINSIC
low complexity region	547	570	N/A	INTRINSIC
low complexity region	860	871	N/A	INTRINSIC
coiled coil region	899	1046	N/A	INTRINSIC
low complexity region	1144	1154	N/A	INTRINSIC
Pfam:Tcp10_C	1167	1342	5.1e-90	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000225951
AA Change: E532G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

Predicted Effect

probably benign
Transcript: ENSMUST00000229861

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the centromere protein family. During cell division, this protein plays a structural role in the maintenance of centrosome integrity and normal spindle morphology, and it is involved in microtubule disassembly at the centrosome. This protein can function as a transcriptional coactivator in the Stat5 signaling pathway, and also as a coactivator of NF-kappaB-mediated transcription, likely via its interaction with the coactivator p300/CREB-binding protein. Mutations in this gene are associated with primary autosomal recessive microcephaly, a disorder characterized by severely reduced brain size and mental retardation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for null alleles exhibit embryonic lethality during early organogenesis and may show failure of embryo turning and absence of centrioles, cilia and centrosomes. Mice homozygous for a hypomorphic allele display partial lethality, dwarfism and a wide range of abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	T	A	13: 81,520,781	N2552I	probably damaging	Het
Amph	G	T	13: 19,125,083	A444S	probably benign	Het
Ankrd52	A	G	10: 128,380,588	N157S	probably benign	Het
Arhgap29	T	C	3: 122,004,271	F537L	probably benign	Het
Asic1	A	C	15: 99,692,776	T136P	probably damaging	Het
Atg2b	T	C	12: 105,639,302	Y1468C	probably benign	Het
Atm	A	G	9: 53,516,517	L431P	probably damaging	Het
Btaf1	A	G	19: 36,945,246	T17A	probably benign	Het
Car10	A	G	11: 93,304,541	N58S	probably benign	Het
Cd79b	A	T	11: 106,312,019	D252E	probably damaging	Het
Cdipt	C	T	7: 126,977,030		probably benign	Het
Cebpe	T	C	14: 54,711,708	D84G	probably damaging	Het
Cherp	A	G	8: 72,463,076		probably null	Het
Chuk	T	C	19: 44,082,670	D532G	possibly damaging	Het
Clec1b	C	T	6: 129,397,640	T9I	probably benign	Het
Clspn	G	T	4: 126,564,963	A280S	possibly damaging	Het
Cts3	T	G	13: 61,564,985	Y307S	probably benign	Het
Cyp2c39	T	C	19: 39,568,049	M443T	possibly damaging	Het
Dhx57	C	T	17: 80,275,018	R386H	probably damaging	Het
Dhx58	A	T	11: 100,701,307	M305K	probably benign	Het
Dlgap3	T	C	4: 127,235,494	L894P	probably damaging	Het
Dnah3	A	T	7: 119,975,076	N2164K	probably damaging	Het
Dnajb14	A	G	3: 137,902,283	N183S	probably benign	Het
Drd5	G	T	5: 38,320,747	R361L	probably damaging	Het
Duoxa1	T	C	2: 122,305,141	E159G	probably damaging	Het
Exoc1	T	A	5: 76,563,232	S659R	probably benign	Het
Fam214b	T	C	4: 43,036,050	H227R	probably damaging	Het
Fbln7	T	C	2: 128,877,394	I37T	probably benign	Het
Fcgrt	T	G	7: 45,095,429	E205A	possibly damaging	Het
Fcho2	A	T	13: 98,763,694	S304T	probably damaging	Het
Gbp9	C	A	5: 105,105,721	G43*	probably null	Het
Gm21671	T	C	5: 25,949,831	E257G	probably damaging	Het
Gucy2d	A	G	7: 98,474,661	K151R	probably benign	Het
Heatr4	T	A	12: 83,978,055	I331F	probably damaging	Het
Hmcn1	G	A	1: 150,609,627	T4408I	probably damaging	Het
Hoxc9	C	T	15: 102,982,119	T156M	probably benign	Het
Hrnr	A	T	3: 93,320,680	E35V	probably damaging	Het
Idua	C	T	5: 108,670,171	Q70*	probably null	Het
Klf5	A	T	14: 99,301,753	I201F	probably damaging	Het
Lonrf1	T	C	8: 36,234,010	K349E	probably damaging	Het
Lrp1b	A	T	2: 41,268,383	D1721E		Het
Mdh1	T	A	11: 21,571,870		probably benign	Het
Mllt11	T	C	3: 95,220,210	H83R	probably benign	Het
Mrgprb4	A	C	7: 48,198,835	I115S	possibly damaging	Het
Mrpl38	A	G	11: 116,132,470	F319S	probably damaging	Het
Naif1	A	T	2: 32,454,895	M204L	probably benign	Het
Ncan	T	A	8: 70,101,978	D1063V	probably damaging	Het
Noto	A	T	6: 85,424,345	R119W	possibly damaging	Het
Olfr1220	G	A	2: 89,097,229	L233F	probably benign	Het
Olfr147	A	T	9: 38,403,545	I224F	probably damaging	Het
Olfr573-ps1	A	T	7: 102,941,958	D206E	probably damaging	Het
Olfr816	T	A	10: 129,912,179	Y33F	probably damaging	Het
Ovch2	A	G	7: 107,794,377	W181R	probably damaging	Het
Palm	G	C	10: 79,819,283	G292R	probably damaging	Het
Pdgfrb	T	A	18: 61,072,715	L591*	probably null	Het
Pik3c2g	T	C	6: 139,896,184	S772P		Het
Prx	C	A	7: 27,517,986	D776E	probably benign	Het
Ptpra	A	G	2: 130,542,446	E562G	possibly damaging	Het
Rbm4b	A	G	19: 4,757,331	Y25C	probably damaging	Het
Reln	T	C	5: 21,931,429	T2534A	probably benign	Het
Rnf123	T	C	9: 108,077,764	S14G	probably benign	Het
Rock2	A	G	12: 16,965,601	H833R	probably benign	Het
Rxfp3	A	G	15: 11,037,025	V87A	possibly damaging	Het
S100b	G	A	10: 76,257,102	G23D	probably damaging	Het
Scn9a	T	A	2: 66,526,658	M1100L	probably benign	Het
Sept11	T	A	5: 93,148,407	S55T	possibly damaging	Het
Sv2b	T	A	7: 75,119,928	Q622L	probably benign	Het
Taar7a	T	C	10: 23,992,901	D194G	probably benign	Het
Trappc3	T	C	4: 126,275,221	I168T	probably benign	Het
Trim27	T	C	13: 21,190,126		probably null	Het
Wdr49	G	A	3: 75,397,052	T109I	probably benign	Het
Wdr64	T	C	1: 175,717,288	Y96H	probably damaging	Het
Zfp219	A	T	14: 52,009,592	L26Q	probably damaging	Het
Zfp758	T	A	17: 22,374,848	V105D	possibly damaging	Het
Zfp975	C	G	7: 42,662,908	E94Q	possibly damaging	Het
Zfyve9	C	T	4: 108,682,137	A289T	probably benign	Het
Zscan5b	T	C	7: 6,231,526	S184P	possibly damaging	Het

Other mutations in Cenpj

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00565:Cenpj	APN	14	56553030	missense	probably benign	0.04
IGL00969:Cenpj	APN	14	56564963	missense	possibly damaging	0.68
IGL01152:Cenpj	APN	14	56552300	missense	probably benign	0.01
IGL01475:Cenpj	APN	14	56565045	missense	possibly damaging	0.80
IGL01548:Cenpj	APN	14	56532319	missense	probably benign	0.00
IGL01893:Cenpj	APN	14	56553474	missense	probably damaging	1.00
IGL02647:Cenpj	APN	14	56530079	missense	probably damaging	0.99
IGL02683:Cenpj	APN	14	56552952	missense	possibly damaging	0.88
IGL02691:Cenpj	APN	14	56552090	missense	probably benign	0.28
IGL03008:Cenpj	APN	14	56526949	missense	probably benign	0.39
R0206:Cenpj	UTSW	14	56563970	missense	probably benign	0.00
R0208:Cenpj	UTSW	14	56563970	missense	probably benign	0.00
R0356:Cenpj	UTSW	14	56549496	missense	probably damaging	1.00
R0942:Cenpj	UTSW	14	56555209	unclassified	probably benign
R1392:Cenpj	UTSW	14	56534854	splice site	probably benign
R1564:Cenpj	UTSW	14	56552066	missense	probably benign	0.43
R1671:Cenpj	UTSW	14	56565045	missense	probably damaging	0.99
R1889:Cenpj	UTSW	14	56558725	missense	probably benign	0.43
R2059:Cenpj	UTSW	14	56563955	missense	possibly damaging	0.94
R2140:Cenpj	UTSW	14	56526932	missense	probably damaging	1.00
R2509:Cenpj	UTSW	14	56532237	missense	probably null	0.98
R2866:Cenpj	UTSW	14	56552180	missense	probably benign	0.01
R3813:Cenpj	UTSW	14	56553222	missense	probably benign	0.05
R4620:Cenpj	UTSW	14	56535454	missense	probably damaging	0.99
R4670:Cenpj	UTSW	14	56553383	missense	possibly damaging	0.80
R4671:Cenpj	UTSW	14	56553383	missense	possibly damaging	0.80
R4765:Cenpj	UTSW	14	56549545	nonsense	probably null
R4915:Cenpj	UTSW	14	56553718	missense	probably damaging	0.98
R4930:Cenpj	UTSW	14	56534781	nonsense	probably null
R5088:Cenpj	UTSW	14	56553691	missense	probably damaging	1.00
R5523:Cenpj	UTSW	14	56552423	missense	probably benign	0.00
R5527:Cenpj	UTSW	14	56526983	missense	probably damaging	1.00
R5717:Cenpj	UTSW	14	56553521	frame shift	probably null
R5944:Cenpj	UTSW	14	56553658	critical splice donor site	probably null
R5975:Cenpj	UTSW	14	56564066	missense	possibly damaging	0.92
R6019:Cenpj	UTSW	14	56534815	missense	probably benign	0.01
R6291:Cenpj	UTSW	14	56551976	missense	probably benign	0.01
R6948:Cenpj	UTSW	14	56553226	missense	probably damaging	0.96
R7212:Cenpj	UTSW	14	56552652	missense	probably benign	0.00
R7461:Cenpj	UTSW	14	56527044	nonsense	probably null
R7613:Cenpj	UTSW	14	56527044	nonsense	probably null
R7634:Cenpj	UTSW	14	56542800	missense	probably benign	0.00
R7837:Cenpj	UTSW	14	56558728	missense	probably benign	0.02
R8722:Cenpj	UTSW	14	56535518	missense	probably damaging	1.00
R8810:Cenpj	UTSW	14	56558619	missense	possibly damaging	0.78
R8813:Cenpj	UTSW	14	56552898	missense	probably damaging	1.00
R8842:Cenpj	UTSW	14	56542872	missense	probably damaging	0.97
R8916:Cenpj	UTSW	14	56552895	missense	probably damaging	1.00
R8987:Cenpj	UTSW	14	56526926	missense	possibly damaging	0.75
R9128:Cenpj	UTSW	14	56542862	missense	probably damaging	1.00
R9227:Cenpj	UTSW	14	56564719	missense	possibly damaging	0.51
R9229:Cenpj	UTSW	14	56564719	missense	possibly damaging	0.51
R9624:Cenpj	UTSW	14	56564930	missense	probably benign	0.01
R9686:Cenpj	UTSW	14	56552591	missense	probably benign	0.01
RF007:Cenpj	UTSW	14	56530048	critical splice donor site	probably null
Z1177:Cenpj	UTSW	14	56552879	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- GTAGAAGACAGCCTGTGACC -3'
(R):5'- ATGGACAGTTTAGACACCAGG -3'

Sequencing Primer
(F):5'- TGTGACCGTCGCAGATCTG -3'
(R):5'- CACCAGGTCAAAGGAGAACG -3'

Posted On

2022-10-06