Incidental Mutation 'R9717:Asic1'
ID 730568
Institutional Source Beutler Lab
Gene Symbol Asic1
Ensembl Gene ENSMUSG00000023017
Gene Name acid-sensing ion channel 1
Synonyms B530003N02Rik, ASIC1 beta, Accn2, ASIC1b, ASIC, ASIC1a, BNaC2, ASICalpha
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.180) question?
Stock # R9717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 99568249-99599011 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 99590657 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 136 (T136P)
Ref Sequence ENSEMBL: ENSMUSP00000154379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023758] [ENSMUST00000228185]
AlphaFold Q6NXK8
Predicted Effect probably benign
Transcript: ENSMUST00000023758
SMART Domains Protein: ENSMUSP00000023758
Gene: ENSMUSG00000023017

DomainStartEndE-ValueType
Pfam:ASC 21 454 9.9e-95 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228185
AA Change: T136P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acid-sensing ion channel (ASIC) family of proteins, which are part of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. Members of the ASIC family are sensitive to amiloride and function in neurotransmission. The encoded proteins function in learning, pain transduction, touch sensation, and development of memory and fear. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of this gene results in absence of H+-gated currents in hippocampal neurons, impaired long term potentiation, reduced excitatory postsynaptic potentials, and defective spatial learning and eye blink conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,668,900 (GRCm39) N2552I probably damaging Het
Amph G T 13: 19,309,253 (GRCm39) A444S probably benign Het
Ankrd52 A G 10: 128,216,457 (GRCm39) N157S probably benign Het
Arhgap29 T C 3: 121,797,920 (GRCm39) F537L probably benign Het
Atg2b T C 12: 105,605,561 (GRCm39) Y1468C probably benign Het
Atm A G 9: 53,427,817 (GRCm39) L431P probably damaging Het
Atosb T C 4: 43,036,050 (GRCm39) H227R probably damaging Het
Btaf1 A G 19: 36,922,646 (GRCm39) T17A probably benign Het
Car10 A G 11: 93,195,367 (GRCm39) N58S probably benign Het
Cd79b A T 11: 106,202,845 (GRCm39) D252E probably damaging Het
Cdipt C T 7: 126,576,202 (GRCm39) probably benign Het
Cebpe T C 14: 54,949,165 (GRCm39) D84G probably damaging Het
Cenpj T C 14: 56,790,453 (GRCm39) E532G probably benign Het
Cherp A G 8: 73,216,920 (GRCm39) probably null Het
Chuk T C 19: 44,071,109 (GRCm39) D532G possibly damaging Het
Clec1b C T 6: 129,374,603 (GRCm39) T9I probably benign Het
Clspn G T 4: 126,458,756 (GRCm39) A280S possibly damaging Het
Cts3 T G 13: 61,712,799 (GRCm39) Y307S probably benign Het
Cyp2c39 T C 19: 39,556,493 (GRCm39) M443T possibly damaging Het
Dhx57 C T 17: 80,582,447 (GRCm39) R386H probably damaging Het
Dhx58 A T 11: 100,592,133 (GRCm39) M305K probably benign Het
Dlgap3 T C 4: 127,129,287 (GRCm39) L894P probably damaging Het
Dnah3 A T 7: 119,574,299 (GRCm39) N2164K probably damaging Het
Dnajb14 A G 3: 137,608,044 (GRCm39) N183S probably benign Het
Drd5 G T 5: 38,478,090 (GRCm39) R361L probably damaging Het
Duoxa1 T C 2: 122,135,622 (GRCm39) E159G probably damaging Het
Exoc1 T A 5: 76,711,079 (GRCm39) S659R probably benign Het
Fbln7 T C 2: 128,719,314 (GRCm39) I37T probably benign Het
Fcgrt T G 7: 44,744,853 (GRCm39) E205A possibly damaging Het
Fcho2 A T 13: 98,900,202 (GRCm39) S304T probably damaging Het
Gbp9 C A 5: 105,253,587 (GRCm39) G43* probably null Het
Gucy2d A G 7: 98,123,868 (GRCm39) K151R probably benign Het
Heatr4 T A 12: 84,024,829 (GRCm39) I331F probably damaging Het
Hmcn1 G A 1: 150,485,378 (GRCm39) T4408I probably damaging Het
Hoxc9 C T 15: 102,890,551 (GRCm39) T156M probably benign Het
Hrnr A T 3: 93,227,987 (GRCm39) E35V probably damaging Het
Idua C T 5: 108,818,037 (GRCm39) Q70* probably null Het
Klf5 A T 14: 99,539,189 (GRCm39) I201F probably damaging Het
Lonrf1 T C 8: 36,701,164 (GRCm39) K349E probably damaging Het
Lrp1b A T 2: 41,158,395 (GRCm39) D1721E Het
Mdh1 T A 11: 21,521,870 (GRCm39) probably benign Het
Mllt11 T C 3: 95,127,521 (GRCm39) H83R probably benign Het
Mrgprb4 A C 7: 47,848,583 (GRCm39) I115S possibly damaging Het
Mrpl38 A G 11: 116,023,296 (GRCm39) F319S probably damaging Het
Naif1 A T 2: 32,344,907 (GRCm39) M204L probably benign Het
Ncan T A 8: 70,554,628 (GRCm39) D1063V probably damaging Het
Noto A T 6: 85,401,327 (GRCm39) R119W possibly damaging Het
Or4c115 G A 2: 88,927,573 (GRCm39) L233F probably benign Het
Or51h7 A T 7: 102,591,165 (GRCm39) D206E probably damaging Het
Or6c69 T A 10: 129,748,048 (GRCm39) Y33F probably damaging Het
Or8b3 A T 9: 38,314,841 (GRCm39) I224F probably damaging Het
Ovch2 A G 7: 107,393,584 (GRCm39) W181R probably damaging Het
Palm G C 10: 79,655,117 (GRCm39) G292R probably damaging Het
Pdgfrb T A 18: 61,205,787 (GRCm39) L591* probably null Het
Pik3c2g T C 6: 139,841,910 (GRCm39) S772P Het
Prx C A 7: 27,217,411 (GRCm39) D776E probably benign Het
Ptpra A G 2: 130,384,366 (GRCm39) E562G possibly damaging Het
Rbm4b A G 19: 4,807,359 (GRCm39) Y25C probably damaging Het
Reln T C 5: 22,136,427 (GRCm39) T2534A probably benign Het
Rnf123 T C 9: 107,954,963 (GRCm39) S14G probably benign Het
Rock2 A G 12: 17,015,602 (GRCm39) H833R probably benign Het
Rxfp3 A G 15: 11,037,111 (GRCm39) V87A possibly damaging Het
S100b G A 10: 76,092,936 (GRCm39) G23D probably damaging Het
Scn9a T A 2: 66,357,002 (GRCm39) M1100L probably benign Het
Septin11 T A 5: 93,296,266 (GRCm39) S55T possibly damaging Het
Speer4a3 T C 5: 26,154,829 (GRCm39) E257G probably damaging Het
Sv2b T A 7: 74,769,676 (GRCm39) Q622L probably benign Het
Taar7a T C 10: 23,868,799 (GRCm39) D194G probably benign Het
Trappc3 T C 4: 126,169,014 (GRCm39) I168T probably benign Het
Trim27 T C 13: 21,374,296 (GRCm39) probably null Het
Wdr49 G A 3: 75,304,359 (GRCm39) T109I probably benign Het
Wdr64 T C 1: 175,544,854 (GRCm39) Y96H probably damaging Het
Zfp219 A T 14: 52,247,049 (GRCm39) L26Q probably damaging Het
Zfp758 T A 17: 22,593,829 (GRCm39) V105D possibly damaging Het
Zfp975 C G 7: 42,312,332 (GRCm39) E94Q possibly damaging Het
Zfyve9 C T 4: 108,539,334 (GRCm39) A289T probably benign Het
Zscan5b T C 7: 6,234,525 (GRCm39) S184P possibly damaging Het
Other mutations in Asic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Asic1 APN 15 99,569,998 (GRCm39) missense probably damaging 0.99
IGL01418:Asic1 APN 15 99,569,998 (GRCm39) missense probably damaging 0.99
IGL01718:Asic1 APN 15 99,569,883 (GRCm39) missense probably damaging 1.00
IGL01941:Asic1 APN 15 99,596,982 (GRCm39) missense possibly damaging 0.95
IGL01993:Asic1 APN 15 99,595,353 (GRCm39) missense probably benign 0.01
IGL02097:Asic1 APN 15 99,592,567 (GRCm39) splice site probably benign
IGL03028:Asic1 APN 15 99,570,038 (GRCm39) missense probably benign 0.03
IGL03082:Asic1 APN 15 99,594,428 (GRCm39) missense probably benign
IGL03183:Asic1 APN 15 99,569,898 (GRCm39) missense probably benign 0.43
IGL03231:Asic1 APN 15 99,596,983 (GRCm39) missense probably benign 0.42
R0111:Asic1 UTSW 15 99,594,864 (GRCm39) missense probably damaging 1.00
R0243:Asic1 UTSW 15 99,596,498 (GRCm39) unclassified probably benign
R0316:Asic1 UTSW 15 99,569,819 (GRCm39) missense probably benign 0.03
R0518:Asic1 UTSW 15 99,596,700 (GRCm39) missense probably damaging 1.00
R0520:Asic1 UTSW 15 99,593,416 (GRCm39) missense probably damaging 1.00
R0521:Asic1 UTSW 15 99,596,700 (GRCm39) missense probably damaging 1.00
R0610:Asic1 UTSW 15 99,596,780 (GRCm39) missense probably benign 0.14
R1034:Asic1 UTSW 15 99,595,939 (GRCm39) missense probably damaging 1.00
R1666:Asic1 UTSW 15 99,597,006 (GRCm39) missense probably damaging 1.00
R1796:Asic1 UTSW 15 99,594,535 (GRCm39) missense probably null 0.99
R1993:Asic1 UTSW 15 99,569,765 (GRCm39) missense probably damaging 1.00
R2130:Asic1 UTSW 15 99,569,756 (GRCm39) missense possibly damaging 0.73
R2180:Asic1 UTSW 15 99,569,846 (GRCm39) missense probably benign
R2895:Asic1 UTSW 15 99,594,483 (GRCm39) missense probably benign 0.22
R3793:Asic1 UTSW 15 99,569,906 (GRCm39) nonsense probably null
R3848:Asic1 UTSW 15 99,570,814 (GRCm39) missense probably benign 0.01
R5115:Asic1 UTSW 15 99,569,933 (GRCm39) missense probably damaging 0.97
R5186:Asic1 UTSW 15 99,596,684 (GRCm39) unclassified probably benign
R5187:Asic1 UTSW 15 99,596,684 (GRCm39) unclassified probably benign
R5409:Asic1 UTSW 15 99,596,684 (GRCm39) unclassified probably benign
R6011:Asic1 UTSW 15 99,596,960 (GRCm39) missense probably benign 0.05
R6383:Asic1 UTSW 15 99,596,761 (GRCm39) missense probably damaging 0.96
R7133:Asic1 UTSW 15 99,569,968 (GRCm39) missense probably damaging 1.00
R7255:Asic1 UTSW 15 99,595,338 (GRCm39) missense probably damaging 0.97
R7587:Asic1 UTSW 15 99,593,471 (GRCm39) missense probably damaging 1.00
R8012:Asic1 UTSW 15 99,594,532 (GRCm39) missense possibly damaging 0.92
R8030:Asic1 UTSW 15 99,592,722 (GRCm39) missense possibly damaging 0.56
R8089:Asic1 UTSW 15 99,595,968 (GRCm39) missense probably damaging 1.00
R8919:Asic1 UTSW 15 99,569,826 (GRCm39) missense probably benign 0.40
R9417:Asic1 UTSW 15 99,590,405 (GRCm39) missense probably benign
R9534:Asic1 UTSW 15 99,594,397 (GRCm39) missense probably benign 0.01
R9646:Asic1 UTSW 15 99,593,414 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGCCATGTCTTTGTGGAAGG -3'
(R):5'- CCCCACAGTAGGAGCAATAGAG -3'

Sequencing Primer
(F):5'- CTTTGTGGAAGGGGGCCC -3'
(R):5'- ATAGAGCAGCATGTCCTCCAGG -3'
Posted On 2022-10-06