Mutagenetix > Incidental Mutation

Incidental Mutation 'R9717:Asic1'

730568

Institutional Source

Beutler Lab

Gene Symbol

Asic1

Ensembl Gene

ENSMUSG00000023017

Gene Name

acid-sensing (proton-gated) ion channel 1

Synonyms

ASIC1a, ASICalpha, B530003N02Rik, ASIC, Accn2, BNaC2, ASIC1 beta

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.228) question?

Stock #

R9717 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

99670368-99701130 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 99692776 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 136 (T136P)

Ref Sequence

ENSEMBL: ENSMUSP00000154379 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023758] [ENSMUST00000228185]

AlphaFold

Q6NXK8

Predicted Effect

probably benign
Transcript: ENSMUST00000023758

SMART Domains

Protein: ENSMUSP00000023758
Gene: ENSMUSG00000023017

Domain	Start	End	E-Value	Type
Pfam:ASC	21	454	9.9e-95	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000228185
AA Change: T136P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acid-sensing ion channel (ASIC) family of proteins, which are part of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. Members of the ASIC family are sensitive to amiloride and function in neurotransmission. The encoded proteins function in learning, pain transduction, touch sensation, and development of memory and fear. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of this gene results in absence of H⁺-gated currents in hippocampal neurons, impaired long term potentiation, reduced excitatory postsynaptic potentials, and defective spatial learning and eye blink conditioning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	T	A	13: 81,520,781	N2552I	probably damaging	Het
Amph	G	T	13: 19,125,083	A444S	probably benign	Het
Ankrd52	A	G	10: 128,380,588	N157S	probably benign	Het
Arhgap29	T	C	3: 122,004,271	F537L	probably benign	Het
Atg2b	T	C	12: 105,639,302	Y1468C	probably benign	Het
Atm	A	G	9: 53,516,517	L431P	probably damaging	Het
Btaf1	A	G	19: 36,945,246	T17A	probably benign	Het
Car10	A	G	11: 93,304,541	N58S	probably benign	Het
Cd79b	A	T	11: 106,312,019	D252E	probably damaging	Het
Cdipt	C	T	7: 126,977,030		probably benign	Het
Cebpe	T	C	14: 54,711,708	D84G	probably damaging	Het
Cenpj	T	C	14: 56,552,996	E532G	probably benign	Het
Cherp	A	G	8: 72,463,076		probably null	Het
Chuk	T	C	19: 44,082,670	D532G	possibly damaging	Het
Clec1b	C	T	6: 129,397,640	T9I	probably benign	Het
Clspn	G	T	4: 126,564,963	A280S	possibly damaging	Het
Cts3	T	G	13: 61,564,985	Y307S	probably benign	Het
Cyp2c39	T	C	19: 39,568,049	M443T	possibly damaging	Het
Dhx57	C	T	17: 80,275,018	R386H	probably damaging	Het
Dhx58	A	T	11: 100,701,307	M305K	probably benign	Het
Dlgap3	T	C	4: 127,235,494	L894P	probably damaging	Het
Dnah3	A	T	7: 119,975,076	N2164K	probably damaging	Het
Dnajb14	A	G	3: 137,902,283	N183S	probably benign	Het
Drd5	G	T	5: 38,320,747	R361L	probably damaging	Het
Duoxa1	T	C	2: 122,305,141	E159G	probably damaging	Het
Exoc1	T	A	5: 76,563,232	S659R	probably benign	Het
Fam214b	T	C	4: 43,036,050	H227R	probably damaging	Het
Fbln7	T	C	2: 128,877,394	I37T	probably benign	Het
Fcgrt	T	G	7: 45,095,429	E205A	possibly damaging	Het
Fcho2	A	T	13: 98,763,694	S304T	probably damaging	Het
Gbp9	C	A	5: 105,105,721	G43*	probably null	Het
Gm21671	T	C	5: 25,949,831	E257G	probably damaging	Het
Gucy2d	A	G	7: 98,474,661	K151R	probably benign	Het
Heatr4	T	A	12: 83,978,055	I331F	probably damaging	Het
Hmcn1	G	A	1: 150,609,627	T4408I	probably damaging	Het
Hoxc9	C	T	15: 102,982,119	T156M	probably benign	Het
Hrnr	A	T	3: 93,320,680	E35V	probably damaging	Het
Idua	C	T	5: 108,670,171	Q70*	probably null	Het
Klf5	A	T	14: 99,301,753	I201F	probably damaging	Het
Lonrf1	T	C	8: 36,234,010	K349E	probably damaging	Het
Lrp1b	A	T	2: 41,268,383	D1721E		Het
Mdh1	T	A	11: 21,571,870		probably benign	Het
Mllt11	T	C	3: 95,220,210	H83R	probably benign	Het
Mrgprb4	A	C	7: 48,198,835	I115S	possibly damaging	Het
Mrpl38	A	G	11: 116,132,470	F319S	probably damaging	Het
Naif1	A	T	2: 32,454,895	M204L	probably benign	Het
Ncan	T	A	8: 70,101,978	D1063V	probably damaging	Het
Noto	A	T	6: 85,424,345	R119W	possibly damaging	Het
Olfr1220	G	A	2: 89,097,229	L233F	probably benign	Het
Olfr147	A	T	9: 38,403,545	I224F	probably damaging	Het
Olfr573-ps1	A	T	7: 102,941,958	D206E	probably damaging	Het
Olfr816	T	A	10: 129,912,179	Y33F	probably damaging	Het
Ovch2	A	G	7: 107,794,377	W181R	probably damaging	Het
Palm	G	C	10: 79,819,283	G292R	probably damaging	Het
Pdgfrb	T	A	18: 61,072,715	L591*	probably null	Het
Pik3c2g	T	C	6: 139,896,184	S772P		Het
Prx	C	A	7: 27,517,986	D776E	probably benign	Het
Ptpra	A	G	2: 130,542,446	E562G	possibly damaging	Het
Rbm4b	A	G	19: 4,757,331	Y25C	probably damaging	Het
Reln	T	C	5: 21,931,429	T2534A	probably benign	Het
Rnf123	T	C	9: 108,077,764	S14G	probably benign	Het
Rock2	A	G	12: 16,965,601	H833R	probably benign	Het
Rxfp3	A	G	15: 11,037,025	V87A	possibly damaging	Het
S100b	G	A	10: 76,257,102	G23D	probably damaging	Het
Scn9a	T	A	2: 66,526,658	M1100L	probably benign	Het
Sept11	T	A	5: 93,148,407	S55T	possibly damaging	Het
Sv2b	T	A	7: 75,119,928	Q622L	probably benign	Het
Taar7a	T	C	10: 23,992,901	D194G	probably benign	Het
Trappc3	T	C	4: 126,275,221	I168T	probably benign	Het
Trim27	T	C	13: 21,190,126		probably null	Het
Wdr49	G	A	3: 75,397,052	T109I	probably benign	Het
Wdr64	T	C	1: 175,717,288	Y96H	probably damaging	Het
Zfp219	A	T	14: 52,009,592	L26Q	probably damaging	Het
Zfp758	T	A	17: 22,374,848	V105D	possibly damaging	Het
Zfp975	C	G	7: 42,662,908	E94Q	possibly damaging	Het
Zfyve9	C	T	4: 108,682,137	A289T	probably benign	Het
Zscan5b	T	C	7: 6,231,526	S184P	possibly damaging	Het

Other mutations in Asic1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01413:Asic1	APN	15	99672117	missense	probably damaging	0.99
IGL01418:Asic1	APN	15	99672117	missense	probably damaging	0.99
IGL01718:Asic1	APN	15	99672002	missense	probably damaging	1.00
IGL01941:Asic1	APN	15	99699101	missense	possibly damaging	0.95
IGL01993:Asic1	APN	15	99697472	missense	probably benign	0.01
IGL02097:Asic1	APN	15	99694686	splice site	probably benign
IGL03028:Asic1	APN	15	99672157	missense	probably benign	0.03
IGL03082:Asic1	APN	15	99696547	missense	probably benign
IGL03183:Asic1	APN	15	99672017	missense	probably benign	0.43
IGL03231:Asic1	APN	15	99699102	missense	probably benign	0.42
R0111:Asic1	UTSW	15	99696983	missense	probably damaging	1.00
R0243:Asic1	UTSW	15	99698617	unclassified	probably benign
R0316:Asic1	UTSW	15	99671938	missense	probably benign	0.03
R0518:Asic1	UTSW	15	99698819	missense	probably damaging	1.00
R0520:Asic1	UTSW	15	99695535	missense	probably damaging	1.00
R0521:Asic1	UTSW	15	99698819	missense	probably damaging	1.00
R0610:Asic1	UTSW	15	99698899	missense	probably benign	0.14
R1034:Asic1	UTSW	15	99698058	missense	probably damaging	1.00
R1666:Asic1	UTSW	15	99699125	missense	probably damaging	1.00
R1796:Asic1	UTSW	15	99696654	missense	probably null	0.99
R1993:Asic1	UTSW	15	99671884	missense	probably damaging	1.00
R2130:Asic1	UTSW	15	99671875	missense	possibly damaging	0.73
R2180:Asic1	UTSW	15	99671965	missense	probably benign
R2895:Asic1	UTSW	15	99696602	missense	probably benign	0.22
R3793:Asic1	UTSW	15	99672025	nonsense	probably null
R3848:Asic1	UTSW	15	99672933	missense	probably benign	0.01
R5115:Asic1	UTSW	15	99672052	missense	probably damaging	0.97
R5186:Asic1	UTSW	15	99698803	unclassified	probably benign
R5187:Asic1	UTSW	15	99698803	unclassified	probably benign
R5409:Asic1	UTSW	15	99698803	unclassified	probably benign
R6011:Asic1	UTSW	15	99699079	missense	probably benign	0.05
R6383:Asic1	UTSW	15	99698880	missense	probably damaging	0.96
R7133:Asic1	UTSW	15	99672087	missense	probably damaging	1.00
R7255:Asic1	UTSW	15	99697457	missense	probably damaging	0.97
R7587:Asic1	UTSW	15	99695590	missense	probably damaging	1.00
R8012:Asic1	UTSW	15	99696651	missense	possibly damaging	0.92
R8030:Asic1	UTSW	15	99694841	missense	possibly damaging	0.56
R8089:Asic1	UTSW	15	99698087	missense	probably damaging	1.00
R8919:Asic1	UTSW	15	99671945	missense	probably benign	0.40
R9417:Asic1	UTSW	15	99692524	missense	probably benign
R9534:Asic1	UTSW	15	99696516	missense	probably benign	0.01
R9646:Asic1	UTSW	15	99695533	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- AGCCATGTCTTTGTGGAAGG -3'
(R):5'- CCCCACAGTAGGAGCAATAGAG -3'

Sequencing Primer
(F):5'- CTTTGTGGAAGGGGGCCC -3'
(R):5'- ATAGAGCAGCATGTCCTCCAGG -3'

Posted On

2022-10-06