Incidental Mutation 'R9717:Hoxc9'
ID 730569
Institutional Source Beutler Lab
Gene Symbol Hoxc9
Ensembl Gene ENSMUSG00000036139
Gene Name homeobox C9
Synonyms Hox-3.2
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 102885467-102893324 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 102890551 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 156 (T156M)
Ref Sequence ENSEMBL: ENSMUSP00000001706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001706] [ENSMUST00000173306]
AlphaFold P09633
Predicted Effect probably benign
Transcript: ENSMUST00000001706
AA Change: T156M

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000001706
Gene: ENSMUSG00000036139
AA Change: T156M

DomainStartEndE-ValueType
Pfam:Hox9_act 1 179 2e-63 PFAM
HOX 192 254 8.84e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173306
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene grow more slowly than normal and develop hunched backs. Forward transformations seen in vertebrae from L1 and forward to around T10. Abnormalities in the sternum and ribs attachments to the sternum are also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,668,900 (GRCm39) N2552I probably damaging Het
Amph G T 13: 19,309,253 (GRCm39) A444S probably benign Het
Ankrd52 A G 10: 128,216,457 (GRCm39) N157S probably benign Het
Arhgap29 T C 3: 121,797,920 (GRCm39) F537L probably benign Het
Asic1 A C 15: 99,590,657 (GRCm39) T136P probably damaging Het
Atg2b T C 12: 105,605,561 (GRCm39) Y1468C probably benign Het
Atm A G 9: 53,427,817 (GRCm39) L431P probably damaging Het
Atosb T C 4: 43,036,050 (GRCm39) H227R probably damaging Het
Btaf1 A G 19: 36,922,646 (GRCm39) T17A probably benign Het
Car10 A G 11: 93,195,367 (GRCm39) N58S probably benign Het
Cd79b A T 11: 106,202,845 (GRCm39) D252E probably damaging Het
Cdipt C T 7: 126,576,202 (GRCm39) probably benign Het
Cebpe T C 14: 54,949,165 (GRCm39) D84G probably damaging Het
Cenpj T C 14: 56,790,453 (GRCm39) E532G probably benign Het
Cherp A G 8: 73,216,920 (GRCm39) probably null Het
Chuk T C 19: 44,071,109 (GRCm39) D532G possibly damaging Het
Clec1b C T 6: 129,374,603 (GRCm39) T9I probably benign Het
Clspn G T 4: 126,458,756 (GRCm39) A280S possibly damaging Het
Cts3 T G 13: 61,712,799 (GRCm39) Y307S probably benign Het
Cyp2c39 T C 19: 39,556,493 (GRCm39) M443T possibly damaging Het
Dhx57 C T 17: 80,582,447 (GRCm39) R386H probably damaging Het
Dhx58 A T 11: 100,592,133 (GRCm39) M305K probably benign Het
Dlgap3 T C 4: 127,129,287 (GRCm39) L894P probably damaging Het
Dnah3 A T 7: 119,574,299 (GRCm39) N2164K probably damaging Het
Dnajb14 A G 3: 137,608,044 (GRCm39) N183S probably benign Het
Drd5 G T 5: 38,478,090 (GRCm39) R361L probably damaging Het
Duoxa1 T C 2: 122,135,622 (GRCm39) E159G probably damaging Het
Exoc1 T A 5: 76,711,079 (GRCm39) S659R probably benign Het
Fbln7 T C 2: 128,719,314 (GRCm39) I37T probably benign Het
Fcgrt T G 7: 44,744,853 (GRCm39) E205A possibly damaging Het
Fcho2 A T 13: 98,900,202 (GRCm39) S304T probably damaging Het
Gbp9 C A 5: 105,253,587 (GRCm39) G43* probably null Het
Gucy2d A G 7: 98,123,868 (GRCm39) K151R probably benign Het
Heatr4 T A 12: 84,024,829 (GRCm39) I331F probably damaging Het
Hmcn1 G A 1: 150,485,378 (GRCm39) T4408I probably damaging Het
Hrnr A T 3: 93,227,987 (GRCm39) E35V probably damaging Het
Idua C T 5: 108,818,037 (GRCm39) Q70* probably null Het
Klf5 A T 14: 99,539,189 (GRCm39) I201F probably damaging Het
Lonrf1 T C 8: 36,701,164 (GRCm39) K349E probably damaging Het
Lrp1b A T 2: 41,158,395 (GRCm39) D1721E Het
Mdh1 T A 11: 21,521,870 (GRCm39) probably benign Het
Mllt11 T C 3: 95,127,521 (GRCm39) H83R probably benign Het
Mrgprb4 A C 7: 47,848,583 (GRCm39) I115S possibly damaging Het
Mrpl38 A G 11: 116,023,296 (GRCm39) F319S probably damaging Het
Naif1 A T 2: 32,344,907 (GRCm39) M204L probably benign Het
Ncan T A 8: 70,554,628 (GRCm39) D1063V probably damaging Het
Noto A T 6: 85,401,327 (GRCm39) R119W possibly damaging Het
Or4c115 G A 2: 88,927,573 (GRCm39) L233F probably benign Het
Or51h7 A T 7: 102,591,165 (GRCm39) D206E probably damaging Het
Or6c69 T A 10: 129,748,048 (GRCm39) Y33F probably damaging Het
Or8b3 A T 9: 38,314,841 (GRCm39) I224F probably damaging Het
Ovch2 A G 7: 107,393,584 (GRCm39) W181R probably damaging Het
Palm G C 10: 79,655,117 (GRCm39) G292R probably damaging Het
Pdgfrb T A 18: 61,205,787 (GRCm39) L591* probably null Het
Pik3c2g T C 6: 139,841,910 (GRCm39) S772P Het
Prx C A 7: 27,217,411 (GRCm39) D776E probably benign Het
Ptpra A G 2: 130,384,366 (GRCm39) E562G possibly damaging Het
Rbm4b A G 19: 4,807,359 (GRCm39) Y25C probably damaging Het
Reln T C 5: 22,136,427 (GRCm39) T2534A probably benign Het
Rnf123 T C 9: 107,954,963 (GRCm39) S14G probably benign Het
Rock2 A G 12: 17,015,602 (GRCm39) H833R probably benign Het
Rxfp3 A G 15: 11,037,111 (GRCm39) V87A possibly damaging Het
S100b G A 10: 76,092,936 (GRCm39) G23D probably damaging Het
Scn9a T A 2: 66,357,002 (GRCm39) M1100L probably benign Het
Septin11 T A 5: 93,296,266 (GRCm39) S55T possibly damaging Het
Speer4a3 T C 5: 26,154,829 (GRCm39) E257G probably damaging Het
Sv2b T A 7: 74,769,676 (GRCm39) Q622L probably benign Het
Taar7a T C 10: 23,868,799 (GRCm39) D194G probably benign Het
Trappc3 T C 4: 126,169,014 (GRCm39) I168T probably benign Het
Trim27 T C 13: 21,374,296 (GRCm39) probably null Het
Wdr49 G A 3: 75,304,359 (GRCm39) T109I probably benign Het
Wdr64 T C 1: 175,544,854 (GRCm39) Y96H probably damaging Het
Zfp219 A T 14: 52,247,049 (GRCm39) L26Q probably damaging Het
Zfp758 T A 17: 22,593,829 (GRCm39) V105D possibly damaging Het
Zfp975 C G 7: 42,312,332 (GRCm39) E94Q possibly damaging Het
Zfyve9 C T 4: 108,539,334 (GRCm39) A289T probably benign Het
Zscan5b T C 7: 6,234,525 (GRCm39) S184P possibly damaging Het
Other mutations in Hoxc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Hoxc9 APN 15 102,892,432 (GRCm39) missense probably damaging 1.00
IGL01418:Hoxc9 APN 15 102,892,432 (GRCm39) missense probably damaging 1.00
IGL03031:Hoxc9 APN 15 102,892,522 (GRCm39) missense probably damaging 1.00
R0498:Hoxc9 UTSW 15 102,892,359 (GRCm39) missense probably damaging 1.00
R1436:Hoxc9 UTSW 15 102,890,304 (GRCm39) missense probably benign 0.03
R2059:Hoxc9 UTSW 15 102,892,555 (GRCm39) missense probably benign 0.01
R2414:Hoxc9 UTSW 15 102,892,540 (GRCm39) missense probably damaging 1.00
R2900:Hoxc9 UTSW 15 102,890,185 (GRCm39) missense probably benign 0.00
R3807:Hoxc9 UTSW 15 102,890,116 (GRCm39) missense possibly damaging 0.94
R3821:Hoxc9 UTSW 15 102,890,596 (GRCm39) missense probably benign 0.32
R4824:Hoxc9 UTSW 15 102,890,225 (GRCm39) nonsense probably null
R5165:Hoxc9 UTSW 15 102,892,432 (GRCm39) missense probably damaging 1.00
R5700:Hoxc9 UTSW 15 102,890,313 (GRCm39) missense possibly damaging 0.65
R5701:Hoxc9 UTSW 15 102,890,313 (GRCm39) missense possibly damaging 0.65
R6003:Hoxc9 UTSW 15 102,890,311 (GRCm39) missense probably benign 0.15
R6145:Hoxc9 UTSW 15 102,892,391 (GRCm39) missense probably damaging 1.00
R6570:Hoxc9 UTSW 15 102,890,185 (GRCm39) missense probably benign 0.00
R7312:Hoxc9 UTSW 15 102,890,593 (GRCm39) missense probably benign 0.02
R7434:Hoxc9 UTSW 15 102,892,414 (GRCm39) missense probably damaging 1.00
R8080:Hoxc9 UTSW 15 102,890,551 (GRCm39) missense probably benign 0.22
R8519:Hoxc9 UTSW 15 102,892,341 (GRCm39) missense probably damaging 1.00
R8792:Hoxc9 UTSW 15 102,890,226 (GRCm39) missense probably benign 0.00
R9705:Hoxc9 UTSW 15 102,890,362 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CTGTGGTCTATCACCCTTACGG -3'
(R):5'- AGCTCCCCAAGGTAATTCGC -3'

Sequencing Primer
(F):5'- TACATGCGGACTTGGCTC -3'
(R):5'- CCCCAAGGTAATTCGCTTTTATTGAG -3'
Posted On 2022-10-06