Incidental Mutation 'R9717:Dhx57'
ID 730571
Institutional Source Beutler Lab
Gene Symbol Dhx57
Ensembl Gene ENSMUSG00000035051
Gene Name DExH-box helicase 57
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R9717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 80545733-80597620 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 80582447 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 386 (R386H)
Ref Sequence ENSEMBL: ENSMUSP00000083742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]
AlphaFold Q6P5D3
Predicted Effect probably damaging
Transcript: ENSMUST00000038166
AA Change: R333H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: R333H

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
UBA 129 166 1.04e-3 SMART
ZnF_C3H1 246 272 4.07e-6 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 381 390 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
DEXDc 490 678 1.27e-28 SMART
Blast:DEXDc 688 752 2e-28 BLAST
HELICc 810 918 3.22e-16 SMART
HA2 984 1074 1.64e-24 SMART
Pfam:OB_NTP_bind 1113 1262 1.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086555
AA Change: R386H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: R386H

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
UBA 182 219 1.04e-3 SMART
ZnF_C3H1 299 325 4.07e-6 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
DEXDc 543 731 1.27e-28 SMART
Blast:DEXDc 741 805 1e-28 BLAST
HELICc 863 971 3.22e-16 SMART
HA2 1037 1127 1.64e-24 SMART
Pfam:OB_NTP_bind 1166 1315 8.5e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,668,900 (GRCm39) N2552I probably damaging Het
Amph G T 13: 19,309,253 (GRCm39) A444S probably benign Het
Ankrd52 A G 10: 128,216,457 (GRCm39) N157S probably benign Het
Arhgap29 T C 3: 121,797,920 (GRCm39) F537L probably benign Het
Asic1 A C 15: 99,590,657 (GRCm39) T136P probably damaging Het
Atg2b T C 12: 105,605,561 (GRCm39) Y1468C probably benign Het
Atm A G 9: 53,427,817 (GRCm39) L431P probably damaging Het
Atosb T C 4: 43,036,050 (GRCm39) H227R probably damaging Het
Btaf1 A G 19: 36,922,646 (GRCm39) T17A probably benign Het
Car10 A G 11: 93,195,367 (GRCm39) N58S probably benign Het
Cd79b A T 11: 106,202,845 (GRCm39) D252E probably damaging Het
Cdipt C T 7: 126,576,202 (GRCm39) probably benign Het
Cebpe T C 14: 54,949,165 (GRCm39) D84G probably damaging Het
Cenpj T C 14: 56,790,453 (GRCm39) E532G probably benign Het
Cherp A G 8: 73,216,920 (GRCm39) probably null Het
Chuk T C 19: 44,071,109 (GRCm39) D532G possibly damaging Het
Clec1b C T 6: 129,374,603 (GRCm39) T9I probably benign Het
Clspn G T 4: 126,458,756 (GRCm39) A280S possibly damaging Het
Cts3 T G 13: 61,712,799 (GRCm39) Y307S probably benign Het
Cyp2c39 T C 19: 39,556,493 (GRCm39) M443T possibly damaging Het
Dhx58 A T 11: 100,592,133 (GRCm39) M305K probably benign Het
Dlgap3 T C 4: 127,129,287 (GRCm39) L894P probably damaging Het
Dnah3 A T 7: 119,574,299 (GRCm39) N2164K probably damaging Het
Dnajb14 A G 3: 137,608,044 (GRCm39) N183S probably benign Het
Drd5 G T 5: 38,478,090 (GRCm39) R361L probably damaging Het
Duoxa1 T C 2: 122,135,622 (GRCm39) E159G probably damaging Het
Exoc1 T A 5: 76,711,079 (GRCm39) S659R probably benign Het
Fbln7 T C 2: 128,719,314 (GRCm39) I37T probably benign Het
Fcgrt T G 7: 44,744,853 (GRCm39) E205A possibly damaging Het
Fcho2 A T 13: 98,900,202 (GRCm39) S304T probably damaging Het
Gbp9 C A 5: 105,253,587 (GRCm39) G43* probably null Het
Gucy2d A G 7: 98,123,868 (GRCm39) K151R probably benign Het
Heatr4 T A 12: 84,024,829 (GRCm39) I331F probably damaging Het
Hmcn1 G A 1: 150,485,378 (GRCm39) T4408I probably damaging Het
Hoxc9 C T 15: 102,890,551 (GRCm39) T156M probably benign Het
Hrnr A T 3: 93,227,987 (GRCm39) E35V probably damaging Het
Idua C T 5: 108,818,037 (GRCm39) Q70* probably null Het
Klf5 A T 14: 99,539,189 (GRCm39) I201F probably damaging Het
Lonrf1 T C 8: 36,701,164 (GRCm39) K349E probably damaging Het
Lrp1b A T 2: 41,158,395 (GRCm39) D1721E Het
Mdh1 T A 11: 21,521,870 (GRCm39) probably benign Het
Mllt11 T C 3: 95,127,521 (GRCm39) H83R probably benign Het
Mrgprb4 A C 7: 47,848,583 (GRCm39) I115S possibly damaging Het
Mrpl38 A G 11: 116,023,296 (GRCm39) F319S probably damaging Het
Naif1 A T 2: 32,344,907 (GRCm39) M204L probably benign Het
Ncan T A 8: 70,554,628 (GRCm39) D1063V probably damaging Het
Noto A T 6: 85,401,327 (GRCm39) R119W possibly damaging Het
Or4c115 G A 2: 88,927,573 (GRCm39) L233F probably benign Het
Or51h7 A T 7: 102,591,165 (GRCm39) D206E probably damaging Het
Or6c69 T A 10: 129,748,048 (GRCm39) Y33F probably damaging Het
Or8b3 A T 9: 38,314,841 (GRCm39) I224F probably damaging Het
Ovch2 A G 7: 107,393,584 (GRCm39) W181R probably damaging Het
Palm G C 10: 79,655,117 (GRCm39) G292R probably damaging Het
Pdgfrb T A 18: 61,205,787 (GRCm39) L591* probably null Het
Pik3c2g T C 6: 139,841,910 (GRCm39) S772P Het
Prx C A 7: 27,217,411 (GRCm39) D776E probably benign Het
Ptpra A G 2: 130,384,366 (GRCm39) E562G possibly damaging Het
Rbm4b A G 19: 4,807,359 (GRCm39) Y25C probably damaging Het
Reln T C 5: 22,136,427 (GRCm39) T2534A probably benign Het
Rnf123 T C 9: 107,954,963 (GRCm39) S14G probably benign Het
Rock2 A G 12: 17,015,602 (GRCm39) H833R probably benign Het
Rxfp3 A G 15: 11,037,111 (GRCm39) V87A possibly damaging Het
S100b G A 10: 76,092,936 (GRCm39) G23D probably damaging Het
Scn9a T A 2: 66,357,002 (GRCm39) M1100L probably benign Het
Septin11 T A 5: 93,296,266 (GRCm39) S55T possibly damaging Het
Speer4a3 T C 5: 26,154,829 (GRCm39) E257G probably damaging Het
Sv2b T A 7: 74,769,676 (GRCm39) Q622L probably benign Het
Taar7a T C 10: 23,868,799 (GRCm39) D194G probably benign Het
Trappc3 T C 4: 126,169,014 (GRCm39) I168T probably benign Het
Trim27 T C 13: 21,374,296 (GRCm39) probably null Het
Wdr49 G A 3: 75,304,359 (GRCm39) T109I probably benign Het
Wdr64 T C 1: 175,544,854 (GRCm39) Y96H probably damaging Het
Zfp219 A T 14: 52,247,049 (GRCm39) L26Q probably damaging Het
Zfp758 T A 17: 22,593,829 (GRCm39) V105D possibly damaging Het
Zfp975 C G 7: 42,312,332 (GRCm39) E94Q possibly damaging Het
Zfyve9 C T 4: 108,539,334 (GRCm39) A289T probably benign Het
Zscan5b T C 7: 6,234,525 (GRCm39) S184P possibly damaging Het
Other mutations in Dhx57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Dhx57 APN 17 80,582,405 (GRCm39) missense probably benign 0.00
IGL00811:Dhx57 APN 17 80,560,672 (GRCm39) missense probably damaging 1.00
IGL01389:Dhx57 APN 17 80,588,652 (GRCm39) missense probably benign 0.28
IGL01468:Dhx57 APN 17 80,563,039 (GRCm39) nonsense probably null
IGL01908:Dhx57 APN 17 80,558,872 (GRCm39) missense probably damaging 1.00
IGL01965:Dhx57 APN 17 80,576,279 (GRCm39) missense probably damaging 1.00
IGL02147:Dhx57 APN 17 80,567,752 (GRCm39) missense possibly damaging 0.95
IGL02275:Dhx57 APN 17 80,582,268 (GRCm39) missense probably benign 0.13
IGL02349:Dhx57 APN 17 80,563,000 (GRCm39) missense probably damaging 1.00
IGL02405:Dhx57 APN 17 80,562,979 (GRCm39) critical splice donor site probably null
IGL02588:Dhx57 APN 17 80,576,300 (GRCm39) missense probably damaging 1.00
IGL02673:Dhx57 APN 17 80,574,974 (GRCm39) missense probably damaging 1.00
IGL02836:Dhx57 APN 17 80,574,978 (GRCm39) missense probably damaging 1.00
IGL02889:Dhx57 APN 17 80,554,581 (GRCm39) missense possibly damaging 0.90
IGL03085:Dhx57 APN 17 80,565,526 (GRCm39) missense possibly damaging 0.48
P0014:Dhx57 UTSW 17 80,582,620 (GRCm39) missense probably benign 0.00
PIT4377001:Dhx57 UTSW 17 80,571,404 (GRCm39) missense probably damaging 0.96
R0100:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R0100:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R0129:Dhx57 UTSW 17 80,546,343 (GRCm39) missense probably damaging 1.00
R0200:Dhx57 UTSW 17 80,558,902 (GRCm39) missense probably damaging 1.00
R0309:Dhx57 UTSW 17 80,582,310 (GRCm39) missense probably damaging 1.00
R0375:Dhx57 UTSW 17 80,565,550 (GRCm39) missense probably damaging 1.00
R0396:Dhx57 UTSW 17 80,582,226 (GRCm39) missense probably benign 0.34
R0520:Dhx57 UTSW 17 80,565,604 (GRCm39) missense possibly damaging 0.95
R0554:Dhx57 UTSW 17 80,567,665 (GRCm39) nonsense probably null
R0661:Dhx57 UTSW 17 80,576,293 (GRCm39) missense probably damaging 1.00
R0883:Dhx57 UTSW 17 80,577,800 (GRCm39) missense probably damaging 1.00
R0900:Dhx57 UTSW 17 80,583,011 (GRCm39) missense probably benign
R0963:Dhx57 UTSW 17 80,582,956 (GRCm39) missense probably benign 0.01
R1469:Dhx57 UTSW 17 80,561,847 (GRCm39) missense probably damaging 1.00
R1469:Dhx57 UTSW 17 80,561,847 (GRCm39) missense probably damaging 1.00
R1660:Dhx57 UTSW 17 80,553,157 (GRCm39) missense possibly damaging 0.83
R1707:Dhx57 UTSW 17 80,582,655 (GRCm39) missense probably damaging 0.96
R1822:Dhx57 UTSW 17 80,560,514 (GRCm39) critical splice donor site probably null
R1853:Dhx57 UTSW 17 80,582,308 (GRCm39) nonsense probably null
R1942:Dhx57 UTSW 17 80,572,573 (GRCm39) missense probably damaging 1.00
R2043:Dhx57 UTSW 17 80,560,509 (GRCm39) splice site probably benign
R2106:Dhx57 UTSW 17 80,582,792 (GRCm39) missense probably damaging 1.00
R2127:Dhx57 UTSW 17 80,580,477 (GRCm39) missense probably damaging 1.00
R2183:Dhx57 UTSW 17 80,582,760 (GRCm39) missense probably benign 0.07
R2249:Dhx57 UTSW 17 80,588,663 (GRCm39) missense probably damaging 0.98
R2400:Dhx57 UTSW 17 80,567,845 (GRCm39) missense probably damaging 0.99
R2404:Dhx57 UTSW 17 80,561,733 (GRCm39) missense probably damaging 0.98
R2513:Dhx57 UTSW 17 80,549,378 (GRCm39) splice site probably null
R2869:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2869:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2870:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2870:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2871:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2871:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2874:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R3819:Dhx57 UTSW 17 80,572,503 (GRCm39) critical splice donor site probably null
R3964:Dhx57 UTSW 17 80,572,541 (GRCm39) nonsense probably null
R4535:Dhx57 UTSW 17 80,582,511 (GRCm39) missense probably damaging 1.00
R4666:Dhx57 UTSW 17 80,582,390 (GRCm39) missense probably damaging 1.00
R4788:Dhx57 UTSW 17 80,582,760 (GRCm39) missense probably benign 0.01
R4822:Dhx57 UTSW 17 80,549,596 (GRCm39) splice site probably null
R4863:Dhx57 UTSW 17 80,560,540 (GRCm39) missense probably damaging 1.00
R4988:Dhx57 UTSW 17 80,558,827 (GRCm39) missense probably damaging 1.00
R5391:Dhx57 UTSW 17 80,582,510 (GRCm39) missense probably damaging 1.00
R5559:Dhx57 UTSW 17 80,561,808 (GRCm39) missense possibly damaging 0.53
R5644:Dhx57 UTSW 17 80,546,302 (GRCm39) missense possibly damaging 0.73
R5997:Dhx57 UTSW 17 80,553,235 (GRCm39) missense probably damaging 0.96
R6090:Dhx57 UTSW 17 80,571,375 (GRCm39) critical splice donor site probably null
R6177:Dhx57 UTSW 17 80,580,395 (GRCm39) missense possibly damaging 0.91
R6283:Dhx57 UTSW 17 80,582,234 (GRCm39) missense probably benign 0.00
R6802:Dhx57 UTSW 17 80,582,750 (GRCm39) missense probably benign 0.43
R6924:Dhx57 UTSW 17 80,546,244 (GRCm39) missense possibly damaging 0.71
R7151:Dhx57 UTSW 17 80,580,476 (GRCm39) missense probably damaging 1.00
R7386:Dhx57 UTSW 17 80,575,006 (GRCm39) missense possibly damaging 0.89
R7393:Dhx57 UTSW 17 80,563,000 (GRCm39) missense probably damaging 1.00
R7451:Dhx57 UTSW 17 80,554,542 (GRCm39) missense probably damaging 1.00
R7602:Dhx57 UTSW 17 80,582,290 (GRCm39) missense probably benign 0.06
R7733:Dhx57 UTSW 17 80,572,503 (GRCm39) critical splice donor site probably null
R7748:Dhx57 UTSW 17 80,572,546 (GRCm39) missense probably damaging 1.00
R7749:Dhx57 UTSW 17 80,546,287 (GRCm39) missense probably benign 0.04
R7772:Dhx57 UTSW 17 80,580,507 (GRCm39) missense possibly damaging 0.71
R8213:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R8370:Dhx57 UTSW 17 80,553,192 (GRCm39) missense probably damaging 1.00
R8371:Dhx57 UTSW 17 80,582,919 (GRCm39) missense probably benign 0.18
R8403:Dhx57 UTSW 17 80,585,718 (GRCm39) missense probably damaging 1.00
R8467:Dhx57 UTSW 17 80,561,853 (GRCm39) missense probably damaging 1.00
R8690:Dhx57 UTSW 17 80,577,794 (GRCm39) critical splice donor site probably benign
R9210:Dhx57 UTSW 17 80,576,338 (GRCm39) missense probably damaging 1.00
R9212:Dhx57 UTSW 17 80,576,338 (GRCm39) missense probably damaging 1.00
R9447:Dhx57 UTSW 17 80,549,523 (GRCm39) missense probably damaging 1.00
R9562:Dhx57 UTSW 17 80,561,817 (GRCm39) missense probably damaging 1.00
R9669:Dhx57 UTSW 17 80,553,130 (GRCm39) missense probably benign 0.09
Z1088:Dhx57 UTSW 17 80,558,777 (GRCm39) missense probably damaging 1.00
Z1176:Dhx57 UTSW 17 80,553,234 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TACTTGGGACCACTGGTTTGC -3'
(R):5'- CCACATCAAATGATTGGGAGAG -3'

Sequencing Primer
(F):5'- ACTTATTCTGGTCTCGGAAGGTAC -3'
(R):5'- GCAGAAAGAAACGTAAATGACCCTC -3'
Posted On 2022-10-06