Incidental Mutation 'R9717:Btaf1'
ID 730574
Institutional Source Beutler Lab
Gene Symbol Btaf1
Ensembl Gene ENSMUSG00000040565
Gene Name B-TFIID TATA-box binding protein associated factor 1
Synonyms E430027O22Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001080706
Essential gene? Probably essential (E-score: 0.968) question?
Stock # R9717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 36926079-37012752 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36945246 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 17 (T17A)
Ref Sequence ENSEMBL: ENSMUSP00000097093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099494]
AlphaFold E9QAE3
Predicted Effect probably benign
Transcript: ENSMUST00000099494
AA Change: T17A

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097093
Gene: ENSMUSG00000040565
AA Change: T17A

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
low complexity region 143 152 N/A INTRINSIC
PDB:3OC3|B 276 414 3e-6 PDB
low complexity region 438 454 N/A INTRINSIC
Pfam:DUF3535 585 1051 1.1e-133 PFAM
low complexity region 1099 1110 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
DEXDc 1261 1469 3.02e-30 SMART
low complexity region 1630 1641 N/A INTRINSIC
HELICc 1657 1743 2.22e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TAF (TATA box-binding protein-associated factor), which associates with TBP (TATA box-binding protein) to form the B-TFIID complex that is required for transcription initiation of genes by RNA polymerase II. This TAF has DNA-dependent ATPase activity, which drives the dissociation of TBP from DNA, freeing the TBP to associate with other TATA boxes or TATA-less promoters. [provided by RefSeq, Sep 2011]
PHENOTYPE: Embryos homozygous for a gene-trapped allele display growth retardation. Embryos homozygous for an ENU-induced allele show growth retardation, edema, abnormal blood circulation, myocardial trabeculae hypoplasia, and delayed head and brain development. [provided by MGI curators]
Allele List at MGI

All alleles(40) : Gene trapped(40)
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,520,781 N2552I probably damaging Het
Amph G T 13: 19,125,083 A444S probably benign Het
Ankrd52 A G 10: 128,380,588 N157S probably benign Het
Arhgap29 T C 3: 122,004,271 F537L probably benign Het
Asic1 A C 15: 99,692,776 T136P probably damaging Het
Atg2b T C 12: 105,639,302 Y1468C probably benign Het
Atm A G 9: 53,516,517 L431P probably damaging Het
Car10 A G 11: 93,304,541 N58S probably benign Het
Cd79b A T 11: 106,312,019 D252E probably damaging Het
Cdipt C T 7: 126,977,030 probably benign Het
Cebpe T C 14: 54,711,708 D84G probably damaging Het
Cenpj T C 14: 56,552,996 E532G probably benign Het
Cherp A G 8: 72,463,076 probably null Het
Chuk T C 19: 44,082,670 D532G possibly damaging Het
Clec1b C T 6: 129,397,640 T9I probably benign Het
Clspn G T 4: 126,564,963 A280S possibly damaging Het
Cts3 T G 13: 61,564,985 Y307S probably benign Het
Cyp2c39 T C 19: 39,568,049 M443T possibly damaging Het
Dhx57 C T 17: 80,275,018 R386H probably damaging Het
Dhx58 A T 11: 100,701,307 M305K probably benign Het
Dlgap3 T C 4: 127,235,494 L894P probably damaging Het
Dnah3 A T 7: 119,975,076 N2164K probably damaging Het
Dnajb14 A G 3: 137,902,283 N183S probably benign Het
Drd5 G T 5: 38,320,747 R361L probably damaging Het
Duoxa1 T C 2: 122,305,141 E159G probably damaging Het
Exoc1 T A 5: 76,563,232 S659R probably benign Het
Fam214b T C 4: 43,036,050 H227R probably damaging Het
Fbln7 T C 2: 128,877,394 I37T probably benign Het
Fcgrt T G 7: 45,095,429 E205A possibly damaging Het
Fcho2 A T 13: 98,763,694 S304T probably damaging Het
Gbp9 C A 5: 105,105,721 G43* probably null Het
Gm21671 T C 5: 25,949,831 E257G probably damaging Het
Gucy2d A G 7: 98,474,661 K151R probably benign Het
Heatr4 T A 12: 83,978,055 I331F probably damaging Het
Hmcn1 G A 1: 150,609,627 T4408I probably damaging Het
Hoxc9 C T 15: 102,982,119 T156M probably benign Het
Hrnr A T 3: 93,320,680 E35V probably damaging Het
Idua C T 5: 108,670,171 Q70* probably null Het
Klf5 A T 14: 99,301,753 I201F probably damaging Het
Lonrf1 T C 8: 36,234,010 K349E probably damaging Het
Lrp1b A T 2: 41,268,383 D1721E Het
Mdh1 T A 11: 21,571,870 probably benign Het
Mllt11 T C 3: 95,220,210 H83R probably benign Het
Mrgprb4 A C 7: 48,198,835 I115S possibly damaging Het
Mrpl38 A G 11: 116,132,470 F319S probably damaging Het
Naif1 A T 2: 32,454,895 M204L probably benign Het
Ncan T A 8: 70,101,978 D1063V probably damaging Het
Noto A T 6: 85,424,345 R119W possibly damaging Het
Olfr1220 G A 2: 89,097,229 L233F probably benign Het
Olfr147 A T 9: 38,403,545 I224F probably damaging Het
Olfr573-ps1 A T 7: 102,941,958 D206E probably damaging Het
Olfr816 T A 10: 129,912,179 Y33F probably damaging Het
Ovch2 A G 7: 107,794,377 W181R probably damaging Het
Palm G C 10: 79,819,283 G292R probably damaging Het
Pdgfrb T A 18: 61,072,715 L591* probably null Het
Pik3c2g T C 6: 139,896,184 S772P Het
Prx C A 7: 27,517,986 D776E probably benign Het
Ptpra A G 2: 130,542,446 E562G possibly damaging Het
Rbm4b A G 19: 4,757,331 Y25C probably damaging Het
Reln T C 5: 21,931,429 T2534A probably benign Het
Rnf123 T C 9: 108,077,764 S14G probably benign Het
Rock2 A G 12: 16,965,601 H833R probably benign Het
Rxfp3 A G 15: 11,037,025 V87A possibly damaging Het
S100b G A 10: 76,257,102 G23D probably damaging Het
Scn9a T A 2: 66,526,658 M1100L probably benign Het
Sept11 T A 5: 93,148,407 S55T possibly damaging Het
Sv2b T A 7: 75,119,928 Q622L probably benign Het
Taar7a T C 10: 23,992,901 D194G probably benign Het
Trappc3 T C 4: 126,275,221 I168T probably benign Het
Trim27 T C 13: 21,190,126 probably null Het
Wdr49 G A 3: 75,397,052 T109I probably benign Het
Wdr64 T C 1: 175,717,288 Y96H probably damaging Het
Zfp219 A T 14: 52,009,592 L26Q probably damaging Het
Zfp758 T A 17: 22,374,848 V105D possibly damaging Het
Zfp975 C G 7: 42,662,908 E94Q possibly damaging Het
Zfyve9 C T 4: 108,682,137 A289T probably benign Het
Zscan5b T C 7: 6,231,526 S184P possibly damaging Het
Other mutations in Btaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Btaf1 APN 19 37009702 missense probably damaging 1.00
IGL00535:Btaf1 APN 19 36997535 missense probably damaging 1.00
IGL00574:Btaf1 APN 19 36969930 missense probably benign 0.00
IGL00969:Btaf1 APN 19 37011252 splice site probably benign
IGL01325:Btaf1 APN 19 37004649 splice site probably benign
IGL01399:Btaf1 APN 19 37000170 nonsense probably null
IGL02024:Btaf1 APN 19 36992426 splice site probably benign
IGL02471:Btaf1 APN 19 37000192 missense probably damaging 0.96
IGL02664:Btaf1 APN 19 36978428 splice site probably benign
IGL02898:Btaf1 APN 19 36969068 missense probably benign
IGL02995:Btaf1 APN 19 36981135 splice site probably benign
IGL03023:Btaf1 APN 19 37010015 missense possibly damaging 0.85
IGL03188:Btaf1 APN 19 36949108 missense possibly damaging 0.91
IGL03353:Btaf1 APN 19 36992500 missense probably damaging 1.00
freudenberg UTSW 19 36988173 critical splice donor site probably null
Galanos UTSW 19 36949102 missense probably damaging 1.00
3-1:Btaf1 UTSW 19 37010078 missense probably damaging 1.00
R0013:Btaf1 UTSW 19 36958373 missense probably benign
R0048:Btaf1 UTSW 19 37003524 missense probably benign 0.01
R0117:Btaf1 UTSW 19 36969968 missense probably benign 0.06
R0207:Btaf1 UTSW 19 37009648 nonsense probably null
R0310:Btaf1 UTSW 19 37004534 missense probably damaging 0.96
R0377:Btaf1 UTSW 19 36989002 missense probably benign
R0419:Btaf1 UTSW 19 36945229 missense probably damaging 0.99
R0440:Btaf1 UTSW 19 36986653 missense probably damaging 0.99
R0532:Btaf1 UTSW 19 36951186 splice site probably benign
R0612:Btaf1 UTSW 19 36969137 missense probably damaging 0.99
R0731:Btaf1 UTSW 19 36997495 splice site probably null
R0780:Btaf1 UTSW 19 36988922 missense probably damaging 0.99
R0919:Btaf1 UTSW 19 36990743 missense probably benign 0.03
R1104:Btaf1 UTSW 19 37004602 missense probably damaging 1.00
R1263:Btaf1 UTSW 19 36956524 missense probably benign 0.10
R1325:Btaf1 UTSW 19 36969162 missense possibly damaging 0.68
R1447:Btaf1 UTSW 19 36992454 missense probably benign 0.00
R1554:Btaf1 UTSW 19 36996598 missense probably benign 0.02
R1649:Btaf1 UTSW 19 36981722 missense probably benign
R1715:Btaf1 UTSW 19 36969121 missense probably damaging 0.99
R1733:Btaf1 UTSW 19 36994962 missense probably benign
R1764:Btaf1 UTSW 19 36951118 missense probably benign 0.12
R1874:Btaf1 UTSW 19 36980583 missense probably benign
R1911:Btaf1 UTSW 19 36986630 missense probably benign
R1933:Btaf1 UTSW 19 36972957 missense probably damaging 1.00
R2080:Btaf1 UTSW 19 36951148 missense probably benign 0.09
R2483:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R2510:Btaf1 UTSW 19 37002445 missense probably benign 0.08
R3623:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R3624:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R3801:Btaf1 UTSW 19 36986548 missense probably benign
R3801:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R3802:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R3802:Btaf1 UTSW 19 36986548 missense probably benign
R3803:Btaf1 UTSW 19 36986548 missense probably benign
R3803:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R4077:Btaf1 UTSW 19 36986479 missense probably benign 0.00
R4079:Btaf1 UTSW 19 36986479 missense probably benign 0.00
R4133:Btaf1 UTSW 19 36961738 missense probably benign 0.00
R4673:Btaf1 UTSW 19 36978372 missense probably benign 0.00
R4731:Btaf1 UTSW 19 36981078 missense probably benign 0.03
R4796:Btaf1 UTSW 19 36956428 missense possibly damaging 0.95
R4824:Btaf1 UTSW 19 36981048 missense possibly damaging 0.84
R4835:Btaf1 UTSW 19 37002458 missense probably benign 0.00
R4837:Btaf1 UTSW 19 36966785 missense probably benign
R4925:Btaf1 UTSW 19 37011333 missense probably benign
R4968:Btaf1 UTSW 19 36969951 missense probably null 0.71
R4976:Btaf1 UTSW 19 36986579 missense probably benign
R5001:Btaf1 UTSW 19 36986652 missense possibly damaging 0.90
R5037:Btaf1 UTSW 19 37003531 missense probably damaging 1.00
R5039:Btaf1 UTSW 19 36990762 missense probably benign
R5211:Btaf1 UTSW 19 36996562 missense probably benign 0.32
R5422:Btaf1 UTSW 19 36951107 missense probably benign 0.09
R5429:Btaf1 UTSW 19 36994857 missense possibly damaging 0.58
R5530:Btaf1 UTSW 19 36990775 missense possibly damaging 0.85
R5582:Btaf1 UTSW 19 36988173 critical splice donor site probably null
R5654:Btaf1 UTSW 19 36983615 missense probably benign 0.35
R5744:Btaf1 UTSW 19 37004490 missense probably benign 0.02
R6082:Btaf1 UTSW 19 36983542 missense probably damaging 1.00
R6243:Btaf1 UTSW 19 36981120 missense probably benign 0.02
R6291:Btaf1 UTSW 19 36973008 missense probably benign 0.00
R6502:Btaf1 UTSW 19 36983617 missense probably benign
R7034:Btaf1 UTSW 19 37004469 missense probably benign
R7036:Btaf1 UTSW 19 37004469 missense probably benign
R7085:Btaf1 UTSW 19 36972918 missense probably benign
R7097:Btaf1 UTSW 19 36949102 missense probably damaging 1.00
R7248:Btaf1 UTSW 19 36945314 missense possibly damaging 0.54
R7386:Btaf1 UTSW 19 36958382 missense probably benign 0.02
R7402:Btaf1 UTSW 19 37003515 missense probably damaging 1.00
R7452:Btaf1 UTSW 19 36969127 missense probably damaging 1.00
R7493:Btaf1 UTSW 19 37009605 missense probably damaging 1.00
R7513:Btaf1 UTSW 19 36978403 missense probably benign 0.30
R7888:Btaf1 UTSW 19 36965636 missense probably benign 0.10
R7944:Btaf1 UTSW 19 36949165 missense probably benign
R8062:Btaf1 UTSW 19 36992465 missense probably benign 0.00
R8559:Btaf1 UTSW 19 36986873 missense probably benign 0.00
R8793:Btaf1 UTSW 19 36981029 missense probably benign 0.21
R8855:Btaf1 UTSW 19 36958501 missense probably benign
R8866:Btaf1 UTSW 19 36958501 missense probably benign
R9016:Btaf1 UTSW 19 36994305 missense probably benign 0.00
R9028:Btaf1 UTSW 19 36969108 missense probably damaging 1.00
R9109:Btaf1 UTSW 19 36986714 missense probably benign
R9172:Btaf1 UTSW 19 37000230 missense probably damaging 0.98
R9298:Btaf1 UTSW 19 36986714 missense probably benign
W0251:Btaf1 UTSW 19 37003504 missense probably damaging 1.00
X0027:Btaf1 UTSW 19 36949096 nonsense probably null
Z1088:Btaf1 UTSW 19 36986618 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCATCTCTTATACCCACAGCTTTTAAG -3'
(R):5'- ACCCCAAGGTCACTTAGGAC -3'

Sequencing Primer
(F):5'- TGTCAGAATTCAGAAATCCGCCTG -3'
(R):5'- GGTCACTTAGGACGATTTTTACC -3'
Posted On 2022-10-06