Incidental Mutation 'R9718:Cdan1'
ID 730587
Institutional Source Beutler Lab
Gene Symbol Cdan1
Ensembl Gene ENSMUSG00000027284
Gene Name congenital dyserythropoietic anemia, type I (human)
Synonyms codanin-1, CDA-I, CDA1, 1500015A01Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9718 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 120716154-120850128 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 120724169 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 875 (A875E)
Ref Sequence ENSEMBL: ENSMUSP00000106329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110700] [ENSMUST00000110701] [ENSMUST00000154193]
AlphaFold Q8CC12
Predicted Effect probably damaging
Transcript: ENSMUST00000110700
AA Change: A875E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106328
Gene: ENSMUSG00000027284
AA Change: A875E

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
low complexity region 78 99 N/A INTRINSIC
low complexity region 102 151 N/A INTRINSIC
low complexity region 154 180 N/A INTRINSIC
low complexity region 326 337 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
low complexity region 724 735 N/A INTRINSIC
Pfam:Codanin-1_C 786 906 2.4e-48 PFAM
low complexity region 1157 1171 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110701
AA Change: A875E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106329
Gene: ENSMUSG00000027284
AA Change: A875E

DomainStartEndE-ValueType
low complexity region 77 98 N/A INTRINSIC
low complexity region 101 150 N/A INTRINSIC
low complexity region 153 179 N/A INTRINSIC
low complexity region 326 337 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
low complexity region 724 735 N/A INTRINSIC
Pfam:Codanin-1_C 789 904 2.4e-41 PFAM
low complexity region 1164 1178 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154193
SMART Domains Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
coiled coil region 409 450 N/A INTRINSIC
low complexity region 454 463 N/A INTRINSIC
low complexity region 469 486 N/A INTRINSIC
low complexity region 546 567 N/A INTRINSIC
SCOP:d1jssa_ 588 784 4e-29 SMART
Blast:START 589 785 6e-12 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that appears to play a role in nuclear envelope integrity, possibly related to microtubule attachments. Mutations in this gene cause congenital dyserythropoietic anemia type I, a disease resulting in morphological and functional abnormalities of erythropoiesis. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality between implantation and somite formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik A C 2: 32,575,235 probably benign Het
Acvr1c A T 2: 58,315,995 D34E probably benign Het
Arhgef19 T C 4: 141,249,292 V455A probably damaging Het
Cbfa2t3 T A 8: 122,638,197 D282V probably benign Het
Ccl9 T A 11: 83,575,412 N114I probably benign Het
Celf2 A T 2: 6,721,538 F61L probably damaging Het
Chd9 T C 8: 90,986,173 Y875H unknown Het
Ckap5 A T 2: 91,548,832 K39M probably benign Het
Clcn3 T C 8: 60,937,400 H169R possibly damaging Het
Csmd3 C A 15: 47,696,687 V1416F Het
Cyp4v3 A T 8: 45,320,666 H155Q probably damaging Het
Dhx36 A G 3: 62,472,045 F874S possibly damaging Het
Dnah14 A T 1: 181,622,979 Q719L probably benign Het
Evi2 C T 11: 79,515,757 V331M probably damaging Het
Fcgrt T G 7: 45,095,429 E205A possibly damaging Het
Fkrp G T 7: 16,811,187 T250N probably benign Het
Galc G A 12: 98,259,314 P6S Het
Gm13420 A T 2: 29,747,536 L42Q probably damaging Het
Gm5134 A T 10: 75,992,497 M304L possibly damaging Het
Gm813 A G 16: 58,614,611 L117S probably benign Het
Haao T C 17: 83,834,786 E208G probably damaging Het
Hook1 T A 4: 96,016,441 H553Q probably benign Het
Igdcc3 A G 9: 65,182,998 probably null Het
Ighv10-3 C T 12: 114,523,634 V56I probably benign Het
Ighv1-62-1 G T 12: 115,387,085 A15E probably benign Het
Krtap24-1 T C 16: 88,611,490 *249W probably null Het
Ktn1 T G 14: 47,673,051 I318R probably damaging Het
L3mbtl2 A G 15: 81,687,922 T710A unknown Het
Ldha A T 7: 46,855,032 Q326L possibly damaging Het
Map4 G A 9: 110,072,706 probably null Het
Mdfic T A 6: 15,770,515 H173Q probably damaging Het
Noxred1 T A 12: 87,224,918 Q159L possibly damaging Het
Olfr114 C T 17: 37,590,023 G110D probably benign Het
Olfr584 T C 7: 103,085,989 V152A probably benign Het
Omd T C 13: 49,589,860 S129P probably damaging Het
Parp16 A G 9: 65,233,727 Y193C probably damaging Het
Pdzk1 A G 3: 96,855,858 T201A Het
Phldb2 T A 16: 45,781,393 H728L possibly damaging Het
Ptchd4 C T 17: 42,502,750 T514I probably damaging Het
Pusl1 T C 4: 155,891,637 D24G probably benign Het
Rai1 G A 11: 60,189,339 A1410T probably benign Het
Rint1 T A 5: 23,800,723 H134Q possibly damaging Het
Rnf170 A G 8: 26,129,215 S156G unknown Het
Rtf1 A G 2: 119,705,505 D180G possibly damaging Het
Sectm1a G T 11: 121,069,664 D108E probably damaging Het
Senp7 T A 16: 56,123,914 D200E probably damaging Het
Sfswap A G 5: 129,539,784 S431G probably benign Het
Sh3bp4 T A 1: 89,145,750 D773E probably damaging Het
Shprh T C 10: 11,213,504 L1662P probably damaging Het
Slx4 G T 16: 3,986,464 P829T possibly damaging Het
Snapc4 A T 2: 26,378,521 S43T probably damaging Het
Ssh3 C T 19: 4,262,409 R636Q probably benign Het
Strn4 G A 7: 16,838,571 V679M probably damaging Het
Tas2r121 T G 6: 132,700,802 Y69S probably benign Het
Tcerg1 C T 18: 42,530,771 T341M unknown Het
Tjp2 A C 19: 24,100,843 S895R probably damaging Het
Tmem220 G T 11: 67,025,260 A28S probably damaging Het
Trdv1 G A 14: 53,882,206 C109Y probably damaging Het
Trpc6 A G 9: 8,634,189 Y423C probably damaging Het
Ttn T C 2: 76,794,683 M15184V possibly damaging Het
Ugt2b37 T A 5: 87,242,943 Y355F probably benign Het
Vnn3 C T 10: 23,869,556 R468* probably null Het
Washc5 T A 15: 59,345,343 T792S probably benign Het
Wdfy4 T C 14: 33,125,936 M820V Het
Zfp961 T A 8: 71,968,089 C149S possibly damaging Het
Zmat4 G A 8: 23,748,491 V30M probably damaging Het
Other mutations in Cdan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Cdan1 APN 2 120725985 missense probably damaging 1.00
IGL01660:Cdan1 APN 2 120725653 missense possibly damaging 0.63
IGL01930:Cdan1 APN 2 120726582 intron probably benign
IGL02597:Cdan1 APN 2 120725239 missense probably benign 0.08
IGL03025:Cdan1 APN 2 120730741 missense probably damaging 1.00
IGL03130:Cdan1 APN 2 120727912 missense possibly damaging 0.94
IGL03388:Cdan1 APN 2 120730511 utr 3 prime probably benign
FR4737:Cdan1 UTSW 2 120724971 missense probably damaging 0.96
R0001:Cdan1 UTSW 2 120723751 missense probably benign 0.41
R0650:Cdan1 UTSW 2 120726045 missense probably benign 0.00
R0781:Cdan1 UTSW 2 120720602 missense probably damaging 1.00
R0881:Cdan1 UTSW 2 120720985 missense probably damaging 1.00
R1110:Cdan1 UTSW 2 120720602 missense probably damaging 1.00
R1345:Cdan1 UTSW 2 120719139 critical splice donor site probably null
R1370:Cdan1 UTSW 2 120719139 critical splice donor site probably null
R1503:Cdan1 UTSW 2 120729575 missense probably damaging 1.00
R1579:Cdan1 UTSW 2 120730739 missense probably damaging 0.98
R1664:Cdan1 UTSW 2 120720506 missense probably damaging 0.99
R1749:Cdan1 UTSW 2 120729799 missense probably damaging 0.96
R1765:Cdan1 UTSW 2 120720749 missense probably damaging 1.00
R1806:Cdan1 UTSW 2 120731426 utr 3 prime probably benign
R1856:Cdan1 UTSW 2 120724936 missense probably benign
R2202:Cdan1 UTSW 2 120720760 missense probably damaging 1.00
R2203:Cdan1 UTSW 2 120720760 missense probably damaging 1.00
R2204:Cdan1 UTSW 2 120720760 missense probably damaging 1.00
R3957:Cdan1 UTSW 2 120725632 missense probably damaging 1.00
R3957:Cdan1 UTSW 2 120731020 utr 3 prime probably benign
R4060:Cdan1 UTSW 2 120725743 missense probably benign 0.00
R4324:Cdan1 UTSW 2 120724979 missense probably damaging 0.97
R4379:Cdan1 UTSW 2 120726618 missense probably damaging 1.00
R4611:Cdan1 UTSW 2 120730720 missense probably damaging 0.96
R4695:Cdan1 UTSW 2 120728383 missense probably damaging 1.00
R4866:Cdan1 UTSW 2 120731447 utr 3 prime probably benign
R5183:Cdan1 UTSW 2 120729580 missense probably damaging 0.96
R5347:Cdan1 UTSW 2 120730065 missense possibly damaging 0.95
R5789:Cdan1 UTSW 2 120729535 missense probably benign 0.22
R5958:Cdan1 UTSW 2 120723902 missense possibly damaging 0.80
R6608:Cdan1 UTSW 2 120726680 missense possibly damaging 0.78
R7055:Cdan1 UTSW 2 120727861 missense probably damaging 0.97
R7065:Cdan1 UTSW 2 120718921 missense probably benign 0.00
R7225:Cdan1 UTSW 2 120724912 missense probably benign
R7238:Cdan1 UTSW 2 120730302 missense probably benign
R7316:Cdan1 UTSW 2 120728332 critical splice donor site probably null
R7325:Cdan1 UTSW 2 120724704 missense probably benign 0.25
R7432:Cdan1 UTSW 2 120722755 missense probably damaging 1.00
R7517:Cdan1 UTSW 2 120727924 missense probably damaging 1.00
R7691:Cdan1 UTSW 2 120729567 missense probably damaging 1.00
R8004:Cdan1 UTSW 2 120731443 missense unknown
R8324:Cdan1 UTSW 2 120727325 missense probably benign 0.07
R8465:Cdan1 UTSW 2 120728440 missense possibly damaging 0.93
R8556:Cdan1 UTSW 2 120722990 missense probably damaging 1.00
R8932:Cdan1 UTSW 2 120731087 nonsense probably null
R9462:Cdan1 UTSW 2 120729579 missense possibly damaging 0.87
X0050:Cdan1 UTSW 2 120724145 missense probably benign 0.29
Z1088:Cdan1 UTSW 2 120730336 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGATAGAAGAAATTTCAGCCTCCC -3'
(R):5'- GGAAACTGCTTGCTTCCTGG -3'

Sequencing Primer
(F):5'- AGAAATTTCAGCCTCCCTGCCC -3'
(R):5'- TTTCAGGAAGCAGTGGGC -3'
Posted On 2022-10-06