Mutagenetix > Incidental Mutation

Incidental Mutation 'R9718:Dhx36'

730588

Institutional Source

Beutler Lab

Gene Symbol

Dhx36

Ensembl Gene

ENSMUSG00000027770

Gene Name

DEAH (Asp-Glu-Ala-His) box polypeptide 36

Synonyms

2810407E23Rik, Ddx36

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9718 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

62468013-62507004 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 62472045 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 874 (F874S)

Ref Sequence

ENSEMBL: ENSMUSP00000029336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029336]

AlphaFold

Q8VHK9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029336
AA Change: F874S

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000029336
Gene: ENSMUSG00000027770
AA Change: F874S

Domain	Start	End	E-Value	Type
low complexity region	10	45	N/A	INTRINSIC
DEXDc	198	389	1.53e-31	SMART
HELICc	495	600	5.61e-16	SMART
HA2	662	753	2.23e-26	SMART
Pfam:OB_NTP_bind	792	910	1.2e-20	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DEAH-box family of RNA-dependent NTPases which are named after the conserved amino acid sequence Asp-Glu-Ala-His in motif II. The protein encoded by this gene has been shown to enhance the deadenylation and decay of mRNAs with 3'-UTR AU-rich elements (ARE-mRNA). The protein has also been shown to resolve into single strands the highly stable tetramolecular DNA configuration (G4) that can form spontaneously in guanine-rich regions of DNA. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality around E7.0. Mice homozygous for a conditional allele activated in the hematopoiesis systemexhibit impaired erythropoiesis associated with cell cycle defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430097D07Rik	A	C	2: 32,575,235		probably benign	Het
Acvr1c	A	T	2: 58,315,995	D34E	probably benign	Het
Arhgef19	T	C	4: 141,249,292	V455A	probably damaging	Het
Cbfa2t3	T	A	8: 122,638,197	D282V	probably benign	Het
Ccl9	T	A	11: 83,575,412	N114I	probably benign	Het
Cdan1	G	T	2: 120,724,169	A875E	probably damaging	Het
Celf2	A	T	2: 6,721,538	F61L	probably damaging	Het
Chd9	T	C	8: 90,986,173	Y875H	unknown	Het
Ckap5	A	T	2: 91,548,832	K39M	probably benign	Het
Clcn3	T	C	8: 60,937,400	H169R	possibly damaging	Het
Csmd3	C	A	15: 47,696,687	V1416F		Het
Cyp4v3	A	T	8: 45,320,666	H155Q	probably damaging	Het
Dnah14	A	T	1: 181,622,979	Q719L	probably benign	Het
Evi2	C	T	11: 79,515,757	V331M	probably damaging	Het
Fcgrt	T	G	7: 45,095,429	E205A	possibly damaging	Het
Fkrp	G	T	7: 16,811,187	T250N	probably benign	Het
Galc	G	A	12: 98,259,314	P6S		Het
Gm13420	A	T	2: 29,747,536	L42Q	probably damaging	Het
Gm5134	A	T	10: 75,992,497	M304L	possibly damaging	Het
Gm813	A	G	16: 58,614,611	L117S	probably benign	Het
Haao	T	C	17: 83,834,786	E208G	probably damaging	Het
Hook1	T	A	4: 96,016,441	H553Q	probably benign	Het
Igdcc3	A	G	9: 65,182,998		probably null	Het
Ighv10-3	C	T	12: 114,523,634	V56I	probably benign	Het
Ighv1-62-1	G	T	12: 115,387,085	A15E	probably benign	Het
Krtap24-1	T	C	16: 88,611,490	*249W	probably null	Het
Ktn1	T	G	14: 47,673,051	I318R	probably damaging	Het
L3mbtl2	A	G	15: 81,687,922	T710A	unknown	Het
Ldha	A	T	7: 46,855,032	Q326L	possibly damaging	Het
Map4	G	A	9: 110,072,706		probably null	Het
Mdfic	T	A	6: 15,770,515	H173Q	probably damaging	Het
Noxred1	T	A	12: 87,224,918	Q159L	possibly damaging	Het
Olfr114	C	T	17: 37,590,023	G110D	probably benign	Het
Olfr584	T	C	7: 103,085,989	V152A	probably benign	Het
Omd	T	C	13: 49,589,860	S129P	probably damaging	Het
Parp16	A	G	9: 65,233,727	Y193C	probably damaging	Het
Pdzk1	A	G	3: 96,855,858	T201A		Het
Phldb2	T	A	16: 45,781,393	H728L	possibly damaging	Het
Ptchd4	C	T	17: 42,502,750	T514I	probably damaging	Het
Pusl1	T	C	4: 155,891,637	D24G	probably benign	Het
Rai1	G	A	11: 60,189,339	A1410T	probably benign	Het
Rint1	T	A	5: 23,800,723	H134Q	possibly damaging	Het
Rnf170	A	G	8: 26,129,215	S156G	unknown	Het
Rtf1	A	G	2: 119,705,505	D180G	possibly damaging	Het
Sectm1a	G	T	11: 121,069,664	D108E	probably damaging	Het
Senp7	T	A	16: 56,123,914	D200E	probably damaging	Het
Sfswap	A	G	5: 129,539,784	S431G	probably benign	Het
Sh3bp4	T	A	1: 89,145,750	D773E	probably damaging	Het
Shprh	T	C	10: 11,213,504	L1662P	probably damaging	Het
Slx4	G	T	16: 3,986,464	P829T	possibly damaging	Het
Snapc4	A	T	2: 26,378,521	S43T	probably damaging	Het
Ssh3	C	T	19: 4,262,409	R636Q	probably benign	Het
Strn4	G	A	7: 16,838,571	V679M	probably damaging	Het
Tas2r121	T	G	6: 132,700,802	Y69S	probably benign	Het
Tcerg1	C	T	18: 42,530,771	T341M	unknown	Het
Tjp2	A	C	19: 24,100,843	S895R	probably damaging	Het
Tmem220	G	T	11: 67,025,260	A28S	probably damaging	Het
Trdv1	G	A	14: 53,882,206	C109Y	probably damaging	Het
Trpc6	A	G	9: 8,634,189	Y423C	probably damaging	Het
Ttn	T	C	2: 76,794,683	M15184V	possibly damaging	Het
Ugt2b37	T	A	5: 87,242,943	Y355F	probably benign	Het
Vnn3	C	T	10: 23,869,556	R468*	probably null	Het
Washc5	T	A	15: 59,345,343	T792S	probably benign	Het
Wdfy4	T	C	14: 33,125,936	M820V		Het
Zfp961	T	A	8: 71,968,089	C149S	possibly damaging	Het
Zmat4	G	A	8: 23,748,491	V30M	probably damaging	Het

Other mutations in Dhx36

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00495:Dhx36	APN	3	62470558	utr 3 prime	probably benign
IGL00538:Dhx36	APN	3	62501045	missense	probably benign	0.04
IGL00706:Dhx36	APN	3	62496842	missense	probably damaging	1.00
IGL02040:Dhx36	APN	3	62501015	missense	probably benign
IGL02141:Dhx36	APN	3	62493889	missense	probably benign	0.25
IGL02514:Dhx36	APN	3	62500898	missense	possibly damaging	0.63
IGL02540:Dhx36	APN	3	62506888	missense	probably benign	0.07
IGL02629:Dhx36	APN	3	62506734	missense	probably benign	0.01
IGL02858:Dhx36	APN	3	62477376	splice site	probably benign
IGL03305:Dhx36	APN	3	62500836	nonsense	probably null
bundeswehr	UTSW	3	62479326	missense	probably benign
R0002:Dhx36	UTSW	3	62480839	missense	probably damaging	1.00
R0002:Dhx36	UTSW	3	62480839	missense	probably damaging	1.00
R0021:Dhx36	UTSW	3	62477595	missense	possibly damaging	0.66
R0021:Dhx36	UTSW	3	62477595	missense	possibly damaging	0.66
R0671:Dhx36	UTSW	3	62493741	missense	possibly damaging	0.96
R0735:Dhx36	UTSW	3	62472729	missense	probably benign	0.00
R0782:Dhx36	UTSW	3	62506714	splice site	probably benign
R1725:Dhx36	UTSW	3	62506939	start codon destroyed	probably benign	0.01
R1951:Dhx36	UTSW	3	62484273	missense	probably damaging	0.99
R1959:Dhx36	UTSW	3	62479385	missense	probably benign	0.01
R2257:Dhx36	UTSW	3	62477643	missense	probably damaging	1.00
R2397:Dhx36	UTSW	3	62498097	missense	probably benign	0.00
R2484:Dhx36	UTSW	3	62472815	missense	probably damaging	0.96
R2973:Dhx36	UTSW	3	62495495	missense	probably benign	0.00
R2973:Dhx36	UTSW	3	62495498	missense	possibly damaging	0.56
R3617:Dhx36	UTSW	3	62472007	missense	possibly damaging	0.96
R3617:Dhx36	UTSW	3	62487060	missense	probably benign	0.01
R3725:Dhx36	UTSW	3	62488222	splice site	probably benign
R3898:Dhx36	UTSW	3	62492369	missense	probably damaging	0.98
R4332:Dhx36	UTSW	3	62484991	missense	probably damaging	1.00
R4359:Dhx36	UTSW	3	62475278	missense	probably benign	0.05
R4493:Dhx36	UTSW	3	62488504	intron	probably benign
R4652:Dhx36	UTSW	3	62500998	missense	probably benign	0.01
R4866:Dhx36	UTSW	3	62472777	missense	probably damaging	1.00
R4884:Dhx36	UTSW	3	62484260	missense	probably damaging	1.00
R4960:Dhx36	UTSW	3	62496859	missense	probably damaging	1.00
R5083:Dhx36	UTSW	3	62471999	missense	probably benign	0.17
R5162:Dhx36	UTSW	3	62493780	missense	probably damaging	1.00
R5815:Dhx36	UTSW	3	62493755	missense	probably damaging	1.00
R6090:Dhx36	UTSW	3	62496820	missense	probably damaging	0.98
R6392:Dhx36	UTSW	3	62494369	missense	probably benign	0.00
R6433:Dhx36	UTSW	3	62484974	missense	probably damaging	1.00
R6504:Dhx36	UTSW	3	62488639	missense	probably benign
R6615:Dhx36	UTSW	3	62488917	missense	probably benign
R6672:Dhx36	UTSW	3	62495536	missense	probably damaging	1.00
R6672:Dhx36	UTSW	3	62500879	missense	probably benign	0.00
R7172:Dhx36	UTSW	3	62501015	missense	probably benign
R7302:Dhx36	UTSW	3	62479393	missense	probably benign
R7487:Dhx36	UTSW	3	62484202	missense	possibly damaging	0.91
R7515:Dhx36	UTSW	3	62472087	missense	probably benign	0.45
R7531:Dhx36	UTSW	3	62484968	missense	probably damaging	1.00
R7579:Dhx36	UTSW	3	62480873	missense	possibly damaging	0.64
R7726:Dhx36	UTSW	3	62488968	missense	probably benign	0.01
R7874:Dhx36	UTSW	3	62488631	missense	probably benign
R8056:Dhx36	UTSW	3	62488591	missense	possibly damaging	0.93
R8226:Dhx36	UTSW	3	62470570	missense	probably benign	0.01
R8361:Dhx36	UTSW	3	62480800	critical splice donor site	probably null
R8529:Dhx36	UTSW	3	62506856	small deletion	probably benign
R8737:Dhx36	UTSW	3	62479326	missense	probably benign
R8947:Dhx36	UTSW	3	62472966	missense	probably benign
R9098:Dhx36	UTSW	3	62506720	nonsense	probably null
R9098:Dhx36	UTSW	3	62506721	missense	probably benign	0.00
R9209:Dhx36	UTSW	3	62471474	missense	probably benign	0.21

Predicted Primers

PCR Primer
(F):5'- TCTTTACAAATTCCTGACAGCAC -3'
(R):5'- AGTGTAAGCTCCTTCCTAGTCC -3'

Sequencing Primer
(F):5'- CCTGACAGCACTTTTTGAAAGCAG -3'
(R):5'- GTAAGCTCCTTCCTAGTCCTTTCATG -3'

Posted On

2022-10-06