Incidental Mutation 'R9718:Tas2r121'
ID 730597
Institutional Source Beutler Lab
Gene Symbol Tas2r121
Ensembl Gene ENSMUSG00000071150
Gene Name taste receptor, type 2, member 121
Synonyms mGR21, T2R21, Tas2r21, mT2r48
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R9718 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 132677053-132677970 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 132677765 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Serine at position 69 (Y69S)
Ref Sequence ENSEMBL: ENSMUSP00000093044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095395]
AlphaFold Q7M720
Predicted Effect probably benign
Transcript: ENSMUST00000095395
AA Change: Y69S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000093044
Gene: ENSMUSG00000071150
AA Change: Y69S

DomainStartEndE-ValueType
Pfam:TAS2R 1 300 4.5e-108 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik A C 2: 32,465,247 (GRCm39) probably benign Het
Acvr1c A T 2: 58,206,007 (GRCm39) D34E probably benign Het
Arhgef19 T C 4: 140,976,603 (GRCm39) V455A probably damaging Het
Cbfa2t3 T A 8: 123,364,936 (GRCm39) D282V probably benign Het
Ccl9 T A 11: 83,466,238 (GRCm39) N114I probably benign Het
Cdan1 G T 2: 120,554,650 (GRCm39) A875E probably damaging Het
Celf2 A T 2: 6,726,349 (GRCm39) F61L probably damaging Het
Chd9 T C 8: 91,712,801 (GRCm39) Y875H unknown Het
Ckap5 A T 2: 91,379,177 (GRCm39) K39M probably benign Het
Clcn3 T C 8: 61,390,434 (GRCm39) H169R possibly damaging Het
Csmd3 C A 15: 47,560,083 (GRCm39) V1416F Het
Cyp4v3 A T 8: 45,773,703 (GRCm39) H155Q probably damaging Het
Dhx36 A G 3: 62,379,466 (GRCm39) F874S possibly damaging Het
Dnah14 A T 1: 181,450,544 (GRCm39) Q719L probably benign Het
Evi2 C T 11: 79,406,583 (GRCm39) V331M probably damaging Het
Fcgrt T G 7: 44,744,853 (GRCm39) E205A possibly damaging Het
Fkrp G T 7: 16,545,112 (GRCm39) T250N probably benign Het
Ftdc1 A G 16: 58,434,974 (GRCm39) L117S probably benign Het
Galc G A 12: 98,225,573 (GRCm39) P6S Het
Gm5134 A T 10: 75,828,331 (GRCm39) M304L possibly damaging Het
Haao T C 17: 84,142,215 (GRCm39) E208G probably damaging Het
Hook1 T A 4: 95,904,678 (GRCm39) H553Q probably benign Het
Igdcc3 A G 9: 65,090,280 (GRCm39) probably null Het
Ighv10-3 C T 12: 114,487,254 (GRCm39) V56I probably benign Het
Ighv1-62-1 G T 12: 115,350,705 (GRCm39) A15E probably benign Het
Krtap24-1 T C 16: 88,408,378 (GRCm39) *249W probably null Het
Ktn1 T G 14: 47,910,508 (GRCm39) I318R probably damaging Het
L3mbtl2 A G 15: 81,572,123 (GRCm39) T710A unknown Het
Ldha A T 7: 46,504,456 (GRCm39) Q326L possibly damaging Het
Map4 G A 9: 109,901,774 (GRCm39) probably null Het
Mdfic T A 6: 15,770,514 (GRCm39) H173Q probably damaging Het
Noxred1 T A 12: 87,271,692 (GRCm39) Q159L possibly damaging Het
Omd T C 13: 49,743,336 (GRCm39) S129P probably damaging Het
Or14j3 C T 17: 37,900,914 (GRCm39) G110D probably benign Het
Or52r1c T C 7: 102,735,196 (GRCm39) V152A probably benign Het
Parp16 A G 9: 65,141,009 (GRCm39) Y193C probably damaging Het
Pdzk1 A G 3: 96,763,174 (GRCm39) T201A Het
Phldb2 T A 16: 45,601,756 (GRCm39) H728L possibly damaging Het
Prrt1b A T 2: 29,637,548 (GRCm39) L42Q probably damaging Het
Ptchd4 C T 17: 42,813,641 (GRCm39) T514I probably damaging Het
Pusl1 T C 4: 155,976,094 (GRCm39) D24G probably benign Het
Rai1 G A 11: 60,080,165 (GRCm39) A1410T probably benign Het
Rint1 T A 5: 24,005,721 (GRCm39) H134Q possibly damaging Het
Rnf170 A G 8: 26,619,243 (GRCm39) S156G unknown Het
Rtf1 A G 2: 119,535,986 (GRCm39) D180G possibly damaging Het
Sectm1a G T 11: 120,960,490 (GRCm39) D108E probably damaging Het
Senp7 T A 16: 55,944,277 (GRCm39) D200E probably damaging Het
Sfswap A G 5: 129,616,848 (GRCm39) S431G probably benign Het
Sh3bp4 T A 1: 89,073,472 (GRCm39) D773E probably damaging Het
Shprh T C 10: 11,089,248 (GRCm39) L1662P probably damaging Het
Slx4 G T 16: 3,804,328 (GRCm39) P829T possibly damaging Het
Snapc4 A T 2: 26,268,533 (GRCm39) S43T probably damaging Het
Ssh3 C T 19: 4,312,437 (GRCm39) R636Q probably benign Het
Strn4 G A 7: 16,572,496 (GRCm39) V679M probably damaging Het
Tcerg1 C T 18: 42,663,836 (GRCm39) T341M unknown Het
Tjp2 A C 19: 24,078,207 (GRCm39) S895R probably damaging Het
Tmem220 G T 11: 66,916,086 (GRCm39) A28S probably damaging Het
Trdv1 G A 14: 54,119,663 (GRCm39) C109Y probably damaging Het
Trpc6 A G 9: 8,634,190 (GRCm39) Y423C probably damaging Het
Ttn T C 2: 76,625,027 (GRCm39) M15184V possibly damaging Het
Ugt2b37 T A 5: 87,390,802 (GRCm39) Y355F probably benign Het
Vnn3 C T 10: 23,745,454 (GRCm39) R468* probably null Het
Washc5 T A 15: 59,217,192 (GRCm39) T792S probably benign Het
Wdfy4 T C 14: 32,847,893 (GRCm39) M820V Het
Zfp961 T A 8: 72,721,933 (GRCm39) C149S possibly damaging Het
Zmat4 G A 8: 24,238,507 (GRCm39) V30M probably damaging Het
Other mutations in Tas2r121
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Tas2r121 APN 6 132,677,484 (GRCm39) missense probably benign 0.28
IGL01868:Tas2r121 APN 6 132,677,235 (GRCm39) missense probably benign 0.00
IGL02182:Tas2r121 APN 6 132,677,133 (GRCm39) missense probably damaging 0.99
IGL02728:Tas2r121 APN 6 132,677,480 (GRCm39) missense probably damaging 1.00
R0833:Tas2r121 UTSW 6 132,677,325 (GRCm39) missense probably damaging 1.00
R0836:Tas2r121 UTSW 6 132,677,325 (GRCm39) missense probably damaging 1.00
R1181:Tas2r121 UTSW 6 132,677,132 (GRCm39) missense probably damaging 1.00
R1424:Tas2r121 UTSW 6 132,677,645 (GRCm39) missense probably damaging 1.00
R1583:Tas2r121 UTSW 6 132,677,193 (GRCm39) nonsense probably null
R2179:Tas2r121 UTSW 6 132,677,831 (GRCm39) missense probably damaging 1.00
R4711:Tas2r121 UTSW 6 132,677,853 (GRCm39) missense probably benign 0.28
R5274:Tas2r121 UTSW 6 132,677,811 (GRCm39) missense probably damaging 1.00
R5308:Tas2r121 UTSW 6 132,677,480 (GRCm39) missense possibly damaging 0.84
R5663:Tas2r121 UTSW 6 132,677,520 (GRCm39) missense probably benign 0.10
R5668:Tas2r121 UTSW 6 132,677,756 (GRCm39) missense possibly damaging 0.95
R5885:Tas2r121 UTSW 6 132,677,254 (GRCm39) missense probably damaging 1.00
R6395:Tas2r121 UTSW 6 132,677,495 (GRCm39) missense probably benign 0.23
R7552:Tas2r121 UTSW 6 132,677,505 (GRCm39) missense probably benign 0.17
R8094:Tas2r121 UTSW 6 132,677,772 (GRCm39) missense probably benign
R9192:Tas2r121 UTSW 6 132,677,492 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGACAATCAGAAGCACTTTCTTC -3'
(R):5'- TCTGGACATGGGAAGCAATGTG -3'

Sequencing Primer
(F):5'- TCTTCTCTCTCCACTTCAAATAGAG -3'
(R):5'- CATGGGAAGCAATGTGTATGGTATC -3'
Posted On 2022-10-06