Mutagenetix > Incidental Mutation

Incidental Mutation 'R9718:Clcn3'

730606

Institutional Source

Beutler Lab

Gene Symbol

Clcn3

Ensembl Gene

ENSMUSG00000004319

Gene Name

chloride channel, voltage-sensitive 3

Synonyms

Clc3

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.431) question?

Stock #

R9718 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

60910389-60983300 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 60937400 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 169 (H169R)

Ref Sequence

ENSEMBL: ENSMUSP00000004430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004430] [ENSMUST00000056508] [ENSMUST00000093490] [ENSMUST00000110301] [ENSMUST00000110302]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000004430
AA Change: H169R

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000004430
Gene: ENSMUSG00000004319
AA Change: H169R

Domain	Start	End	E-Value	Type
transmembrane domain	128	150	N/A	INTRINSIC
Pfam:Voltage_CLC	220	623	1.4e-111	PFAM
CBS	667	717	2.46e-1	SMART
CBS	758	805	2.08e-8	SMART
low complexity region	847	861	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000056508
AA Change: H142R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000058648
Gene: ENSMUSG00000004319
AA Change: H142R

Domain	Start	End	E-Value	Type
transmembrane domain	101	123	N/A	INTRINSIC
Pfam:Voltage_CLC	193	596	1.4e-103	PFAM
CBS	640	690	2.46e-1	SMART
CBS	731	778	6.59e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000093490
AA Change: H111R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000091202
Gene: ENSMUSG00000004319
AA Change: H111R

Domain	Start	End	E-Value	Type
transmembrane domain	70	92	N/A	INTRINSIC
Pfam:Voltage_CLC	162	565	1.2e-103	PFAM
CBS	609	659	2.46e-1	SMART
CBS	700	747	6.59e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110301
AA Change: H169R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000105930
Gene: ENSMUSG00000004319
AA Change: H169R

Domain	Start	End	E-Value	Type
transmembrane domain	128	150	N/A	INTRINSIC
Pfam:Voltage_CLC	220	623	2.7e-103	PFAM
CBS	667	717	2.46e-1	SMART
CBS	758	805	6.59e-11	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110302
AA Change: H142R

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105931
Gene: ENSMUSG00000004319
AA Change: H142R

Domain	Start	End	E-Value	Type
transmembrane domain	101	123	N/A	INTRINSIC
Pfam:Voltage_CLC	193	596	1.3e-103	PFAM
CBS	640	690	2.46e-1	SMART
CBS	731	778	2.08e-8	SMART
low complexity region	820	834	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the voltage-gated chloride channel (ClC) family. The encoded protein is present in all cell types and localized in plasma membranes and in intracellular vesicles. It is a multi-pass membrane protein which contains a ClC domain and two additional C-terminal CBS (cystathionine beta-synthase) domains. The ClC domain catalyzes the selective flow of Cl- ions across cell membranes, and the CBS domain may have a regulatory function. This protein plays a role in both acidification and transmitter loading of GABAergic synaptic vesicles, and in smooth muscle cell activation and neointima formation. This protein is required for lysophosphatidic acid (LPA)-activated Cl- current activity and fibroblast-to-myofibroblast differentiation. The protein activity is regulated by Ca(2+)/calmodulin-dependent protein kinase II (CaMKII) in glioma cells. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations cause degeneration of hippocampal neurons and retinal photoreceptors, reduced body weight, behavioral deficits, gliosis, kyphosis and premature death, and may alter male fertility, ileum morphology, liver physiology, seizure susceptibility, and behavioral response to drugs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430097D07Rik	A	C	2: 32,575,235		probably benign	Het
Acvr1c	A	T	2: 58,315,995	D34E	probably benign	Het
Arhgef19	T	C	4: 141,249,292	V455A	probably damaging	Het
Cbfa2t3	T	A	8: 122,638,197	D282V	probably benign	Het
Ccl9	T	A	11: 83,575,412	N114I	probably benign	Het
Cdan1	G	T	2: 120,724,169	A875E	probably damaging	Het
Celf2	A	T	2: 6,721,538	F61L	probably damaging	Het
Chd9	T	C	8: 90,986,173	Y875H	unknown	Het
Ckap5	A	T	2: 91,548,832	K39M	probably benign	Het
Csmd3	C	A	15: 47,696,687	V1416F		Het
Cyp4v3	A	T	8: 45,320,666	H155Q	probably damaging	Het
Dhx36	A	G	3: 62,472,045	F874S	possibly damaging	Het
Dnah14	A	T	1: 181,622,979	Q719L	probably benign	Het
Evi2	C	T	11: 79,515,757	V331M	probably damaging	Het
Fcgrt	T	G	7: 45,095,429	E205A	possibly damaging	Het
Fkrp	G	T	7: 16,811,187	T250N	probably benign	Het
Galc	G	A	12: 98,259,314	P6S		Het
Gm13420	A	T	2: 29,747,536	L42Q	probably damaging	Het
Gm5134	A	T	10: 75,992,497	M304L	possibly damaging	Het
Gm813	A	G	16: 58,614,611	L117S	probably benign	Het
Haao	T	C	17: 83,834,786	E208G	probably damaging	Het
Hook1	T	A	4: 96,016,441	H553Q	probably benign	Het
Igdcc3	A	G	9: 65,182,998		probably null	Het
Ighv10-3	C	T	12: 114,523,634	V56I	probably benign	Het
Ighv1-62-1	G	T	12: 115,387,085	A15E	probably benign	Het
Krtap24-1	T	C	16: 88,611,490	*249W	probably null	Het
Ktn1	T	G	14: 47,673,051	I318R	probably damaging	Het
L3mbtl2	A	G	15: 81,687,922	T710A	unknown	Het
Ldha	A	T	7: 46,855,032	Q326L	possibly damaging	Het
Map4	G	A	9: 110,072,706		probably null	Het
Mdfic	T	A	6: 15,770,515	H173Q	probably damaging	Het
Noxred1	T	A	12: 87,224,918	Q159L	possibly damaging	Het
Olfr114	C	T	17: 37,590,023	G110D	probably benign	Het
Olfr584	T	C	7: 103,085,989	V152A	probably benign	Het
Omd	T	C	13: 49,589,860	S129P	probably damaging	Het
Parp16	A	G	9: 65,233,727	Y193C	probably damaging	Het
Pdzk1	A	G	3: 96,855,858	T201A		Het
Phldb2	T	A	16: 45,781,393	H728L	possibly damaging	Het
Ptchd4	C	T	17: 42,502,750	T514I	probably damaging	Het
Pusl1	T	C	4: 155,891,637	D24G	probably benign	Het
Rai1	G	A	11: 60,189,339	A1410T	probably benign	Het
Rint1	T	A	5: 23,800,723	H134Q	possibly damaging	Het
Rnf170	A	G	8: 26,129,215	S156G	unknown	Het
Rtf1	A	G	2: 119,705,505	D180G	possibly damaging	Het
Sectm1a	G	T	11: 121,069,664	D108E	probably damaging	Het
Senp7	T	A	16: 56,123,914	D200E	probably damaging	Het
Sfswap	A	G	5: 129,539,784	S431G	probably benign	Het
Sh3bp4	T	A	1: 89,145,750	D773E	probably damaging	Het
Shprh	T	C	10: 11,213,504	L1662P	probably damaging	Het
Slx4	G	T	16: 3,986,464	P829T	possibly damaging	Het
Snapc4	A	T	2: 26,378,521	S43T	probably damaging	Het
Ssh3	C	T	19: 4,262,409	R636Q	probably benign	Het
Strn4	G	A	7: 16,838,571	V679M	probably damaging	Het
Tas2r121	T	G	6: 132,700,802	Y69S	probably benign	Het
Tcerg1	C	T	18: 42,530,771	T341M	unknown	Het
Tjp2	A	C	19: 24,100,843	S895R	probably damaging	Het
Tmem220	G	T	11: 67,025,260	A28S	probably damaging	Het
Trdv1	G	A	14: 53,882,206	C109Y	probably damaging	Het
Trpc6	A	G	9: 8,634,189	Y423C	probably damaging	Het
Ttn	T	C	2: 76,794,683	M15184V	possibly damaging	Het
Ugt2b37	T	A	5: 87,242,943	Y355F	probably benign	Het
Vnn3	C	T	10: 23,869,556	R468*	probably null	Het
Washc5	T	A	15: 59,345,343	T792S	probably benign	Het
Wdfy4	T	C	14: 33,125,936	M820V		Het
Zfp961	T	A	8: 71,968,089	C149S	possibly damaging	Het
Zmat4	G	A	8: 23,748,491	V30M	probably damaging	Het

Other mutations in Clcn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00782:Clcn3	APN	8	60922792	missense	probably damaging	0.99
IGL01088:Clcn3	APN	8	60937347	missense	probably damaging	1.00
IGL01449:Clcn3	APN	8	60934598	missense	probably damaging	0.97
IGL01792:Clcn3	APN	8	60929322	missense	probably damaging	1.00
IGL01845:Clcn3	APN	8	60913095	missense	probably benign	0.08
IGL01984:Clcn3	APN	8	60929580	missense	probably damaging	1.00
IGL02041:Clcn3	APN	8	60923153	missense	probably damaging	0.99
IGL02199:Clcn3	APN	8	60933092	nonsense	probably null
IGL02199:Clcn3	APN	8	60927274	missense	possibly damaging	0.82
IGL02456:Clcn3	APN	8	60941357	missense	probably damaging	1.00
IGL03353:Clcn3	APN	8	60922988	missense	probably benign	0.37
Precipice	UTSW	8	60941399	missense	probably benign	0.16
R0003:Clcn3	UTSW	8	60927296	nonsense	probably null
R0023:Clcn3	UTSW	8	60933070	splice site	probably benign
R0023:Clcn3	UTSW	8	60933070	splice site	probably benign
R0349:Clcn3	UTSW	8	60941348	missense	possibly damaging	0.91
R0437:Clcn3	UTSW	8	60934537	missense	possibly damaging	0.69
R0784:Clcn3	UTSW	8	60929203	missense	probably benign	0.25
R0840:Clcn3	UTSW	8	60929154	missense	probably benign	0.22
R1167:Clcn3	UTSW	8	60922788	critical splice donor site	probably null
R2035:Clcn3	UTSW	8	60934598	missense	probably damaging	0.97
R2193:Clcn3	UTSW	8	60929187	missense	possibly damaging	0.56
R3697:Clcn3	UTSW	8	60913123	missense	probably benign	0.02
R3736:Clcn3	UTSW	8	60983652	unclassified	probably benign
R4676:Clcn3	UTSW	8	60930651	intron	probably benign
R4807:Clcn3	UTSW	8	60934530	missense	probably damaging	1.00
R5112:Clcn3	UTSW	8	60954552	missense	probably benign	0.07
R5200:Clcn3	UTSW	8	60923005	missense	probably damaging	0.99
R5652:Clcn3	UTSW	8	60919353	missense	possibly damaging	0.81
R5712:Clcn3	UTSW	8	60937298	critical splice donor site	probably null
R5731:Clcn3	UTSW	8	60922889	missense	possibly damaging	0.46
R5814:Clcn3	UTSW	8	60934573	missense	probably damaging	1.00
R6134:Clcn3	UTSW	8	60934573	missense	probably damaging	1.00
R6370:Clcn3	UTSW	8	60923024	missense	probably damaging	1.00
R6371:Clcn3	UTSW	8	60937335	missense	probably benign	0.06
R6394:Clcn3	UTSW	8	60941291	missense	probably damaging	0.99
R6466:Clcn3	UTSW	8	60929561	missense	probably damaging	1.00
R6588:Clcn3	UTSW	8	60914827	missense	probably benign	0.03
R6750:Clcn3	UTSW	8	60914775	missense	possibly damaging	0.93
R7522:Clcn3	UTSW	8	60941412	missense	probably benign
R7556:Clcn3	UTSW	8	60929487	missense	probably damaging	0.99
R7557:Clcn3	UTSW	8	60937368	missense	probably damaging	0.99
R7685:Clcn3	UTSW	8	60933085	missense	possibly damaging	0.54
R7887:Clcn3	UTSW	8	60941399	missense	probably benign	0.16
R8219:Clcn3	UTSW	8	60922966	missense	probably damaging	0.98
R8478:Clcn3	UTSW	8	60919488	missense	probably benign
R8825:Clcn3	UTSW	8	60929488	missense	probably damaging	0.99
R9132:Clcn3	UTSW	8	60929102	missense	probably damaging	0.99
R9313:Clcn3	UTSW	8	60937469	missense	probably damaging	0.99
R9473:Clcn3	UTSW	8	60954617	missense	probably benign	0.01
R9475:Clcn3	UTSW	8	60934517	missense	probably damaging	0.96
R9598:Clcn3	UTSW	8	60913027	missense	unknown
R9697:Clcn3	UTSW	8	60919484	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGGAGACCATCTGCACTTG -3'
(R):5'- CCTAACTGACTCTTTATCTATGGGATG -3'

Sequencing Primer
(F):5'- GAGACCATCTGCACTTGCTCTC -3'
(R):5'- GTATTCTTACAGGGGCACT -3'

Posted On

2022-10-06