Mutagenetix > Incidental Mutation

Incidental Mutation 'R9718:Chd9'

730608

Institutional Source

Beutler Lab

Gene Symbol

Chd9

Ensembl Gene

ENSMUSG00000056608

Gene Name

chromodomain helicase DNA binding protein 9

Synonyms

1810014J18Rik, AD013, 9030205D12Rik, A330063D19Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9718 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

90828352-91054516 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 90986173 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 875 (Y875H)

Ref Sequence

ENSEMBL: ENSMUSP00000046356 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048665] [ENSMUST00000109614] [ENSMUST00000209203] [ENSMUST00000209423] [ENSMUST00000210947]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000048665
AA Change: Y875H

SMART Domains

Protein: ENSMUSP00000046356
Gene: ENSMUSG00000056608
AA Change: Y875H

Domain	Start	End	E-Value	Type
low complexity region	323	334	N/A	INTRINSIC
low complexity region	586	605	N/A	INTRINSIC
CHROMO	687	753	2.41e-10	SMART
CHROMO	770	828	4.35e-8	SMART
DEXDc	855	1056	3.8e-36	SMART
Blast:DEXDc	1149	1174	7e-6	BLAST
HELICc	1211	1295	2.86e-22	SMART
low complexity region	1462	1475	N/A	INTRINSIC
Blast:DEXDc	1506	1551	3e-16	BLAST
low complexity region	2048	2067	N/A	INTRINSIC
low complexity region	2127	2199	N/A	INTRINSIC
BRK	2456	2505	6.77e-25	SMART
BRK	2530	2574	1.5e-17	SMART
low complexity region	2594	2608	N/A	INTRINSIC
low complexity region	2609	2639	N/A	INTRINSIC
low complexity region	2642	2659	N/A	INTRINSIC
low complexity region	2690	2704	N/A	INTRINSIC
low complexity region	2746	2771	N/A	INTRINSIC
low complexity region	2802	2813	N/A	INTRINSIC
low complexity region	2843	2869	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000109614
AA Change: Y875H

SMART Domains

Protein: ENSMUSP00000105243
Gene: ENSMUSG00000056608
AA Change: Y875H

Domain	Start	End	E-Value	Type
low complexity region	323	334	N/A	INTRINSIC
low complexity region	586	605	N/A	INTRINSIC
CHROMO	687	753	2.41e-10	SMART
CHROMO	770	828	4.35e-8	SMART
DEXDc	855	1056	3.8e-36	SMART
Blast:DEXDc	1149	1174	7e-6	BLAST
HELICc	1211	1295	2.86e-22	SMART
low complexity region	1462	1475	N/A	INTRINSIC
Blast:DEXDc	1506	1551	3e-16	BLAST
low complexity region	2048	2067	N/A	INTRINSIC
low complexity region	2127	2199	N/A	INTRINSIC
BRK	2472	2521	6.77e-25	SMART
BRK	2546	2590	1.5e-17	SMART
low complexity region	2610	2624	N/A	INTRINSIC
low complexity region	2625	2655	N/A	INTRINSIC
low complexity region	2658	2675	N/A	INTRINSIC
low complexity region	2706	2720	N/A	INTRINSIC
low complexity region	2762	2787	N/A	INTRINSIC
low complexity region	2818	2829	N/A	INTRINSIC
low complexity region	2859	2885	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000209203
AA Change: Y875H

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

unknown
Transcript: ENSMUST00000209423
AA Change: Y875H

Predicted Effect

probably damaging
Transcript: ENSMUST00000210947
AA Change: Y402H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430097D07Rik	A	C	2: 32,575,235		probably benign	Het
Acvr1c	A	T	2: 58,315,995	D34E	probably benign	Het
Arhgef19	T	C	4: 141,249,292	V455A	probably damaging	Het
Cbfa2t3	T	A	8: 122,638,197	D282V	probably benign	Het
Ccl9	T	A	11: 83,575,412	N114I	probably benign	Het
Cdan1	G	T	2: 120,724,169	A875E	probably damaging	Het
Celf2	A	T	2: 6,721,538	F61L	probably damaging	Het
Ckap5	A	T	2: 91,548,832	K39M	probably benign	Het
Clcn3	T	C	8: 60,937,400	H169R	possibly damaging	Het
Csmd3	C	A	15: 47,696,687	V1416F		Het
Cyp4v3	A	T	8: 45,320,666	H155Q	probably damaging	Het
Dhx36	A	G	3: 62,472,045	F874S	possibly damaging	Het
Dnah14	A	T	1: 181,622,979	Q719L	probably benign	Het
Evi2	C	T	11: 79,515,757	V331M	probably damaging	Het
Fcgrt	T	G	7: 45,095,429	E205A	possibly damaging	Het
Fkrp	G	T	7: 16,811,187	T250N	probably benign	Het
Galc	G	A	12: 98,259,314	P6S		Het
Gm13420	A	T	2: 29,747,536	L42Q	probably damaging	Het
Gm5134	A	T	10: 75,992,497	M304L	possibly damaging	Het
Gm813	A	G	16: 58,614,611	L117S	probably benign	Het
Haao	T	C	17: 83,834,786	E208G	probably damaging	Het
Hook1	T	A	4: 96,016,441	H553Q	probably benign	Het
Igdcc3	A	G	9: 65,182,998		probably null	Het
Ighv10-3	C	T	12: 114,523,634	V56I	probably benign	Het
Ighv1-62-1	G	T	12: 115,387,085	A15E	probably benign	Het
Krtap24-1	T	C	16: 88,611,490	*249W	probably null	Het
Ktn1	T	G	14: 47,673,051	I318R	probably damaging	Het
L3mbtl2	A	G	15: 81,687,922	T710A	unknown	Het
Ldha	A	T	7: 46,855,032	Q326L	possibly damaging	Het
Map4	G	A	9: 110,072,706		probably null	Het
Mdfic	T	A	6: 15,770,515	H173Q	probably damaging	Het
Noxred1	T	A	12: 87,224,918	Q159L	possibly damaging	Het
Olfr114	C	T	17: 37,590,023	G110D	probably benign	Het
Olfr584	T	C	7: 103,085,989	V152A	probably benign	Het
Omd	T	C	13: 49,589,860	S129P	probably damaging	Het
Parp16	A	G	9: 65,233,727	Y193C	probably damaging	Het
Pdzk1	A	G	3: 96,855,858	T201A		Het
Phldb2	T	A	16: 45,781,393	H728L	possibly damaging	Het
Ptchd4	C	T	17: 42,502,750	T514I	probably damaging	Het
Pusl1	T	C	4: 155,891,637	D24G	probably benign	Het
Rai1	G	A	11: 60,189,339	A1410T	probably benign	Het
Rint1	T	A	5: 23,800,723	H134Q	possibly damaging	Het
Rnf170	A	G	8: 26,129,215	S156G	unknown	Het
Rtf1	A	G	2: 119,705,505	D180G	possibly damaging	Het
Sectm1a	G	T	11: 121,069,664	D108E	probably damaging	Het
Senp7	T	A	16: 56,123,914	D200E	probably damaging	Het
Sfswap	A	G	5: 129,539,784	S431G	probably benign	Het
Sh3bp4	T	A	1: 89,145,750	D773E	probably damaging	Het
Shprh	T	C	10: 11,213,504	L1662P	probably damaging	Het
Slx4	G	T	16: 3,986,464	P829T	possibly damaging	Het
Snapc4	A	T	2: 26,378,521	S43T	probably damaging	Het
Ssh3	C	T	19: 4,262,409	R636Q	probably benign	Het
Strn4	G	A	7: 16,838,571	V679M	probably damaging	Het
Tas2r121	T	G	6: 132,700,802	Y69S	probably benign	Het
Tcerg1	C	T	18: 42,530,771	T341M	unknown	Het
Tjp2	A	C	19: 24,100,843	S895R	probably damaging	Het
Tmem220	G	T	11: 67,025,260	A28S	probably damaging	Het
Trdv1	G	A	14: 53,882,206	C109Y	probably damaging	Het
Trpc6	A	G	9: 8,634,189	Y423C	probably damaging	Het
Ttn	T	C	2: 76,794,683	M15184V	possibly damaging	Het
Ugt2b37	T	A	5: 87,242,943	Y355F	probably benign	Het
Vnn3	C	T	10: 23,869,556	R468*	probably null	Het
Washc5	T	A	15: 59,345,343	T792S	probably benign	Het
Wdfy4	T	C	14: 33,125,936	M820V		Het
Zfp961	T	A	8: 71,968,089	C149S	possibly damaging	Het
Zmat4	G	A	8: 23,748,491	V30M	probably damaging	Het

Other mutations in Chd9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Chd9	APN	8	91025392	missense	possibly damaging	0.79
IGL00547:Chd9	APN	8	91005798	missense	probably damaging	1.00
IGL00589:Chd9	APN	8	91015846	missense	probably damaging	1.00
IGL00640:Chd9	APN	8	90986132	missense	probably damaging	0.99
IGL00663:Chd9	APN	8	90983490	missense	probably damaging	1.00
IGL00852:Chd9	APN	8	90973207	missense	probably benign	0.29
IGL00908:Chd9	APN	8	90996880	missense	probably damaging	1.00
IGL00911:Chd9	APN	8	91051692	missense	probably damaging	1.00
IGL01068:Chd9	APN	8	91042116	missense	probably benign	0.13
IGL01668:Chd9	APN	8	91026776	missense	possibly damaging	0.53
IGL01873:Chd9	APN	8	90933767	missense	probably benign	0.00
IGL01969:Chd9	APN	8	91033510	missense	possibly damaging	0.72
IGL02105:Chd9	APN	8	90932488	missense	probably damaging	1.00
IGL02153:Chd9	APN	8	90956494	nonsense	probably null
IGL02164:Chd9	APN	8	90933221	missense	possibly damaging	0.94
IGL02725:Chd9	APN	8	91051684	missense	possibly damaging	0.78
IGL02755:Chd9	APN	8	91033582	missense	probably benign	0.33
IGL02892:Chd9	APN	8	90976915	splice site	probably benign
IGL02897:Chd9	APN	8	90933868	splice site	probably benign
IGL03005:Chd9	APN	8	91011447	missense	probably damaging	0.98
IGL03062:Chd9	APN	8	91015267	splice site	probably benign
IGL03140:Chd9	APN	8	91042228	missense	possibly damaging	0.91
hovel	UTSW	8	91015204	missense	probably benign	0.19
shack	UTSW	8	90932798	missense	probably damaging	1.00
R0056:Chd9	UTSW	8	90933537	missense	possibly damaging	0.62
R0157:Chd9	UTSW	8	91008836	splice site	probably null
R0238:Chd9	UTSW	8	90932828	missense	probably damaging	1.00
R0238:Chd9	UTSW	8	90932828	missense	probably damaging	1.00
R0432:Chd9	UTSW	8	90994450	splice site	probably benign
R0454:Chd9	UTSW	8	90973231	missense	possibly damaging	0.83
R0573:Chd9	UTSW	8	90998595	missense	probably damaging	1.00
R0580:Chd9	UTSW	8	90994563	missense	possibly damaging	0.91
R0604:Chd9	UTSW	8	91036542	missense	possibly damaging	0.82
R0662:Chd9	UTSW	8	90977676	missense	probably damaging	0.99
R0825:Chd9	UTSW	8	91051197	missense	probably benign	0.06
R0945:Chd9	UTSW	8	90933002	missense	possibly damaging	0.60
R0964:Chd9	UTSW	8	91015204	missense	probably benign	0.19
R0967:Chd9	UTSW	8	90989479	missense	probably damaging	1.00
R1015:Chd9	UTSW	8	90932578	missense	probably damaging	0.99
R1066:Chd9	UTSW	8	90986136	nonsense	probably null
R1244:Chd9	UTSW	8	91022929	missense	probably damaging	0.99
R1505:Chd9	UTSW	8	91006495	splice site	probably null
R1570:Chd9	UTSW	8	91036542	missense	probably benign	0.03
R1591:Chd9	UTSW	8	90983538	missense	probably damaging	0.97
R1624:Chd9	UTSW	8	90998535	missense	probably benign	0.17
R1626:Chd9	UTSW	8	90994596	missense	probably benign	0.00
R1632:Chd9	UTSW	8	90956707	nonsense	probably null
R1649:Chd9	UTSW	8	90932601	missense	possibly damaging	0.88
R1664:Chd9	UTSW	8	91022790	splice site	probably null
R1668:Chd9	UTSW	8	91041186	missense	probably damaging	0.99
R1681:Chd9	UTSW	8	90973135	missense	probably damaging	0.98
R1695:Chd9	UTSW	8	91001782	missense	probably damaging	1.00
R1714:Chd9	UTSW	8	91034225	utr 3 prime	probably benign
R1746:Chd9	UTSW	8	91010698	missense	probably benign	0.01
R1843:Chd9	UTSW	8	91010794	missense	probably benign	0.19
R1844:Chd9	UTSW	8	90956695	nonsense	probably null
R1941:Chd9	UTSW	8	90977069	critical splice donor site	probably null
R2022:Chd9	UTSW	8	91035054	missense	probably benign	0.17
R2027:Chd9	UTSW	8	90907991	unclassified	probably benign
R2098:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2099:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2100:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2101:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2224:Chd9	UTSW	8	91011285	missense	probably benign	0.04
R2276:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2278:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2316:Chd9	UTSW	8	91051128	missense	probably damaging	0.99
R2507:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2508:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2988:Chd9	UTSW	8	91030460	splice site	probably null
R3418:Chd9	UTSW	8	91036591	missense	probably damaging	1.00
R3817:Chd9	UTSW	8	90984265	splice site	probably benign
R3923:Chd9	UTSW	8	90933519	missense	probably benign	0.16
R4001:Chd9	UTSW	8	90956557	missense	probably damaging	1.00
R4003:Chd9	UTSW	8	90956557	missense	probably damaging	1.00
R4006:Chd9	UTSW	8	90933560	missense	probably benign	0.12
R4013:Chd9	UTSW	8	90973169	missense	possibly damaging	0.82
R4067:Chd9	UTSW	8	91023574	missense	possibly damaging	0.53
R4108:Chd9	UTSW	8	91010676	missense	probably benign	0.04
R4125:Chd9	UTSW	8	91051284	missense	probably damaging	0.99
R4126:Chd9	UTSW	8	91051284	missense	probably damaging	0.99
R4452:Chd9	UTSW	8	90977680	missense	probably damaging	0.99
R4463:Chd9	UTSW	8	90978999	missense	probably benign	0.01
R4478:Chd9	UTSW	8	91034031	utr 3 prime	probably benign
R4587:Chd9	UTSW	8	91036506	missense	possibly damaging	0.95
R4628:Chd9	UTSW	8	90983463	missense	probably benign	0.05
R4667:Chd9	UTSW	8	91033800	missense	possibly damaging	0.73
R4908:Chd9	UTSW	8	91015249	missense	possibly damaging	0.50
R4912:Chd9	UTSW	8	91034230	missense	possibly damaging	0.84
R4977:Chd9	UTSW	8	91033708	missense	possibly damaging	0.96
R5016:Chd9	UTSW	8	91006626	nonsense	probably null
R5083:Chd9	UTSW	8	90984374	missense	probably damaging	1.00
R5088:Chd9	UTSW	8	90977519	missense	possibly damaging	0.94
R5090:Chd9	UTSW	8	91026834	nonsense	probably null
R5307:Chd9	UTSW	8	90997149	missense	probably damaging	1.00
R5541:Chd9	UTSW	8	91051504	missense	probably benign	0.09
R5559:Chd9	UTSW	8	91015925	critical splice donor site	probably null
R5638:Chd9	UTSW	8	91011450	missense	possibly damaging	0.67
R5640:Chd9	UTSW	8	91036562	missense	probably damaging	1.00
R5793:Chd9	UTSW	8	91001756	missense	probably damaging	1.00
R5827:Chd9	UTSW	8	90989450	missense	probably damaging	1.00
R5834:Chd9	UTSW	8	90997164	missense	probably damaging	1.00
R5875:Chd9	UTSW	8	91051836	missense	probably damaging	0.99
R6002:Chd9	UTSW	8	90978887	missense	probably damaging	1.00
R6091:Chd9	UTSW	8	91035063	missense	probably damaging	1.00
R6185:Chd9	UTSW	8	91049137	missense	probably damaging	1.00
R6246:Chd9	UTSW	8	90932417	missense	probably damaging	1.00
R6292:Chd9	UTSW	8	90932922	missense	probably benign	0.05
R6305:Chd9	UTSW	8	91030546	missense	possibly damaging	0.93
R6348:Chd9	UTSW	8	91011275	missense	possibly damaging	0.95
R6438:Chd9	UTSW	8	90998521	missense	probably benign	0.02
R6470:Chd9	UTSW	8	90932798	missense	probably damaging	1.00
R6798:Chd9	UTSW	8	91051554	missense	possibly damaging	0.56
R6902:Chd9	UTSW	8	91042951	missense	probably damaging	1.00
R6908:Chd9	UTSW	8	90956416	missense	probably benign	0.02
R6929:Chd9	UTSW	8	91042945	missense	probably damaging	1.00
R6969:Chd9	UTSW	8	90978914	missense	probably benign	0.34
R7043:Chd9	UTSW	8	91034215	utr 3 prime	probably benign
R7094:Chd9	UTSW	8	90989561	missense	unknown
R7126:Chd9	UTSW	8	91015225	missense	unknown
R7182:Chd9	UTSW	8	91006622	missense	unknown
R7219:Chd9	UTSW	8	91001766	missense	unknown
R7260:Chd9	UTSW	8	90994543	missense	unknown
R7293:Chd9	UTSW	8	91034079	missense	unknown
R7303:Chd9	UTSW	8	91051904	missense	unknown
R7358:Chd9	UTSW	8	90983487	missense	unknown
R7358:Chd9	UTSW	8	91034218	missense	unknown
R7451:Chd9	UTSW	8	91033790	frame shift	probably null
R7451:Chd9	UTSW	8	91033818	missense	probably benign	0.27
R7456:Chd9	UTSW	8	90932525	nonsense	probably null
R7481:Chd9	UTSW	8	90956438	missense	unknown
R7532:Chd9	UTSW	8	90994565	missense	unknown
R7570:Chd9	UTSW	8	90994580	missense	unknown
R7611:Chd9	UTSW	8	91036389	missense	probably damaging	1.00
R7673:Chd9	UTSW	8	91051697	missense	probably damaging	0.96
R7723:Chd9	UTSW	8	91015209	missense	unknown
R7739:Chd9	UTSW	8	91035025	missense	probably damaging	1.00
R7759:Chd9	UTSW	8	90977550	critical splice donor site	probably null
R7916:Chd9	UTSW	8	91035056	nonsense	probably null
R7921:Chd9	UTSW	8	91042281	critical splice donor site	probably null
R7957:Chd9	UTSW	8	91051698	missense	probably damaging	0.99
R7972:Chd9	UTSW	8	91005767	missense	unknown
R8108:Chd9	UTSW	8	90933224	missense	unknown
R8115:Chd9	UTSW	8	91036332	missense	probably damaging	0.99
R8165:Chd9	UTSW	8	91041141	missense	probably damaging	1.00
R8171:Chd9	UTSW	8	91025387	missense	possibly damaging	0.92
R8186:Chd9	UTSW	8	90998605	missense	unknown
R8208:Chd9	UTSW	8	91037263	splice site	probably null
R8256:Chd9	UTSW	8	90933501	missense	unknown
R8281:Chd9	UTSW	8	91036597	missense	probably damaging	1.00
R8504:Chd9	UTSW	8	90996844	missense	unknown
R8836:Chd9	UTSW	8	91041184	missense	probably damaging	0.99
R8892:Chd9	UTSW	8	90933840	missense	unknown
R8985:Chd9	UTSW	8	90994473	missense	unknown
R9029:Chd9	UTSW	8	90956570	missense	unknown
R9030:Chd9	UTSW	8	90956570	missense	unknown
R9038:Chd9	UTSW	8	90989605	missense	unknown
R9081:Chd9	UTSW	8	90977516	nonsense	probably null
R9134:Chd9	UTSW	8	90933126	missense	unknown
R9205:Chd9	UTSW	8	91030642	missense	probably benign	0.01
R9309:Chd9	UTSW	8	91006691	missense	unknown
R9375:Chd9	UTSW	8	90998707	critical splice donor site	probably null
R9449:Chd9	UTSW	8	90932546	missense	unknown
R9547:Chd9	UTSW	8	90956558	missense	unknown
R9573:Chd9	UTSW	8	90977674	missense	unknown
R9576:Chd9	UTSW	8	90932666	missense	unknown
R9601:Chd9	UTSW	8	91005732	nonsense	probably null
R9613:Chd9	UTSW	8	90956522	nonsense	probably null
R9639:Chd9	UTSW	8	91034212	missense	probably null
R9746:Chd9	UTSW	8	91011435	missense	unknown
R9762:Chd9	UTSW	8	90986113	missense	unknown
R9764:Chd9	UTSW	8	90994592	missense	unknown
R9790:Chd9	UTSW	8	91033789	missense	possibly damaging	0.82
R9791:Chd9	UTSW	8	91033789	missense	possibly damaging	0.82
RF007:Chd9	UTSW	8	91033950	missense	possibly damaging	0.66
X0065:Chd9	UTSW	8	91036572	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGTGTGCTTCAGCTTCTAGG -3'
(R):5'- AGCAAAGGTAAAACTGGCATCC -3'

Sequencing Primer
(F):5'- CCATGAGTAGTTGTATGGAAGATCC -3'
(R):5'- AACTGGCATCCAAAATTATAATTCAC -3'

Posted On

2022-10-06