Mutagenetix > Incidental Mutation

Incidental Mutation 'R9718:Trpc6'

730610

Institutional Source

Beutler Lab

Gene Symbol

Trpc6

Ensembl Gene

ENSMUSG00000031997

Gene Name

transient receptor potential cation channel, subfamily C, member 6

Synonyms

mtrp6, Trrp6

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9718 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

8544142-8680741 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 8634189 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 423 (Y423C)

Ref Sequence

ENSEMBL: ENSMUSP00000057965 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050433] [ENSMUST00000214596]

AlphaFold

Q61143

Predicted Effect

probably damaging
Transcript: ENSMUST00000050433
AA Change: Y423C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000057965
Gene: ENSMUSG00000031997
AA Change: Y423C

Domain	Start	End	E-Value	Type
low complexity region	37	54	N/A	INTRINSIC
ANK	96	125	4.73e2	SMART
ANK	131	159	3.49e0	SMART
ANK	217	246	6.61e-1	SMART
Pfam:TRP_2	252	314	4e-29	PFAM
transmembrane domain	406	427	N/A	INTRINSIC
Pfam:Ion_trans	442	738	4.2e-38	PFAM
Pfam:PKD_channel	477	733	3.1e-16	PFAM
low complexity region	770	781	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000214596
AA Change: Y423C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a receptor-activated calcium channel in the cell membrane. The channel is activated by diacylglycerol and is thought to be under the control of a phosphatidylinositol second messenger system. Activation of this channel occurs independently of protein kinase C and is not triggered by low levels of intracellular calcium. Defects in this gene are a cause of focal segmental glomerulosclerosis 2 (FSGS2). [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for one null targeted mutation are viable and fertile and exhibit no overt abnormal phenotype. Another knockout results in an increase in thermal nociceptive response latency. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430097D07Rik	A	C	2: 32,575,235		probably benign	Het
Acvr1c	A	T	2: 58,315,995	D34E	probably benign	Het
Arhgef19	T	C	4: 141,249,292	V455A	probably damaging	Het
Cbfa2t3	T	A	8: 122,638,197	D282V	probably benign	Het
Ccl9	T	A	11: 83,575,412	N114I	probably benign	Het
Cdan1	G	T	2: 120,724,169	A875E	probably damaging	Het
Celf2	A	T	2: 6,721,538	F61L	probably damaging	Het
Chd9	T	C	8: 90,986,173	Y875H	unknown	Het
Ckap5	A	T	2: 91,548,832	K39M	probably benign	Het
Clcn3	T	C	8: 60,937,400	H169R	possibly damaging	Het
Csmd3	C	A	15: 47,696,687	V1416F		Het
Cyp4v3	A	T	8: 45,320,666	H155Q	probably damaging	Het
Dhx36	A	G	3: 62,472,045	F874S	possibly damaging	Het
Dnah14	A	T	1: 181,622,979	Q719L	probably benign	Het
Evi2	C	T	11: 79,515,757	V331M	probably damaging	Het
Fcgrt	T	G	7: 45,095,429	E205A	possibly damaging	Het
Fkrp	G	T	7: 16,811,187	T250N	probably benign	Het
Galc	G	A	12: 98,259,314	P6S		Het
Gm13420	A	T	2: 29,747,536	L42Q	probably damaging	Het
Gm5134	A	T	10: 75,992,497	M304L	possibly damaging	Het
Gm813	A	G	16: 58,614,611	L117S	probably benign	Het
Haao	T	C	17: 83,834,786	E208G	probably damaging	Het
Hook1	T	A	4: 96,016,441	H553Q	probably benign	Het
Igdcc3	A	G	9: 65,182,998		probably null	Het
Ighv10-3	C	T	12: 114,523,634	V56I	probably benign	Het
Ighv1-62-1	G	T	12: 115,387,085	A15E	probably benign	Het
Krtap24-1	T	C	16: 88,611,490	*249W	probably null	Het
Ktn1	T	G	14: 47,673,051	I318R	probably damaging	Het
L3mbtl2	A	G	15: 81,687,922	T710A	unknown	Het
Ldha	A	T	7: 46,855,032	Q326L	possibly damaging	Het
Map4	G	A	9: 110,072,706		probably null	Het
Mdfic	T	A	6: 15,770,515	H173Q	probably damaging	Het
Noxred1	T	A	12: 87,224,918	Q159L	possibly damaging	Het
Olfr114	C	T	17: 37,590,023	G110D	probably benign	Het
Olfr584	T	C	7: 103,085,989	V152A	probably benign	Het
Omd	T	C	13: 49,589,860	S129P	probably damaging	Het
Parp16	A	G	9: 65,233,727	Y193C	probably damaging	Het
Pdzk1	A	G	3: 96,855,858	T201A		Het
Phldb2	T	A	16: 45,781,393	H728L	possibly damaging	Het
Ptchd4	C	T	17: 42,502,750	T514I	probably damaging	Het
Pusl1	T	C	4: 155,891,637	D24G	probably benign	Het
Rai1	G	A	11: 60,189,339	A1410T	probably benign	Het
Rint1	T	A	5: 23,800,723	H134Q	possibly damaging	Het
Rnf170	A	G	8: 26,129,215	S156G	unknown	Het
Rtf1	A	G	2: 119,705,505	D180G	possibly damaging	Het
Sectm1a	G	T	11: 121,069,664	D108E	probably damaging	Het
Senp7	T	A	16: 56,123,914	D200E	probably damaging	Het
Sfswap	A	G	5: 129,539,784	S431G	probably benign	Het
Sh3bp4	T	A	1: 89,145,750	D773E	probably damaging	Het
Shprh	T	C	10: 11,213,504	L1662P	probably damaging	Het
Slx4	G	T	16: 3,986,464	P829T	possibly damaging	Het
Snapc4	A	T	2: 26,378,521	S43T	probably damaging	Het
Ssh3	C	T	19: 4,262,409	R636Q	probably benign	Het
Strn4	G	A	7: 16,838,571	V679M	probably damaging	Het
Tas2r121	T	G	6: 132,700,802	Y69S	probably benign	Het
Tcerg1	C	T	18: 42,530,771	T341M	unknown	Het
Tjp2	A	C	19: 24,100,843	S895R	probably damaging	Het
Tmem220	G	T	11: 67,025,260	A28S	probably damaging	Het
Trdv1	G	A	14: 53,882,206	C109Y	probably damaging	Het
Ttn	T	C	2: 76,794,683	M15184V	possibly damaging	Het
Ugt2b37	T	A	5: 87,242,943	Y355F	probably benign	Het
Vnn3	C	T	10: 23,869,556	R468*	probably null	Het
Washc5	T	A	15: 59,345,343	T792S	probably benign	Het
Wdfy4	T	C	14: 33,125,936	M820V		Het
Zfp961	T	A	8: 71,968,089	C149S	possibly damaging	Het
Zmat4	G	A	8: 23,748,491	V30M	probably damaging	Het

Other mutations in Trpc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Trpc6	APN	9	8680438	missense	probably damaging	1.00
IGL00469:Trpc6	APN	9	8626701	missense	probably benign
IGL00970:Trpc6	APN	9	8653151	missense	probably damaging	1.00
IGL01299:Trpc6	APN	9	8653061	missense	probably damaging	1.00
IGL01563:Trpc6	APN	9	8656603	missense	probably damaging	1.00
IGL01578:Trpc6	APN	9	8634057	missense	probably damaging	1.00
IGL02657:Trpc6	APN	9	8643601	missense	possibly damaging	0.94
IGL02735:Trpc6	APN	9	8655338	missense	probably damaging	1.00
IGL03102:Trpc6	APN	9	8649301	missense	probably benign	0.07
P0038:Trpc6	UTSW	9	8649511	missense	possibly damaging	0.52
PIT4531001:Trpc6	UTSW	9	8610148	missense	probably benign	0.14
R0100:Trpc6	UTSW	9	8653034	missense	probably damaging	1.00
R0100:Trpc6	UTSW	9	8653034	missense	probably damaging	1.00
R0323:Trpc6	UTSW	9	8610275	missense	probably damaging	1.00
R0323:Trpc6	UTSW	9	8643536	missense	probably damaging	1.00
R0334:Trpc6	UTSW	9	8610343	missense	probably damaging	1.00
R0665:Trpc6	UTSW	9	8634122	missense	probably benign	0.11
R0948:Trpc6	UTSW	9	8610415	missense	possibly damaging	0.60
R1177:Trpc6	UTSW	9	8658304	missense	probably benign	0.04
R1217:Trpc6	UTSW	9	8658286	splice site	probably null
R1445:Trpc6	UTSW	9	8680537	missense	probably benign	0.00
R1452:Trpc6	UTSW	9	8653147	missense	probably damaging	0.99
R1494:Trpc6	UTSW	9	8658304	missense	probably benign	0.04
R1501:Trpc6	UTSW	9	8610169	missense	probably damaging	0.99
R1933:Trpc6	UTSW	9	8656545	missense	probably damaging	1.00
R2112:Trpc6	UTSW	9	8656612	missense	probably damaging	1.00
R2164:Trpc6	UTSW	9	8610465	nonsense	probably null
R2921:Trpc6	UTSW	9	8653033	missense	possibly damaging	0.94
R2995:Trpc6	UTSW	9	8544466	missense	probably benign	0.30
R3821:Trpc6	UTSW	9	8610278	missense	probably damaging	1.00
R3965:Trpc6	UTSW	9	8626621	missense	probably damaging	1.00
R4360:Trpc6	UTSW	9	8610266	missense	probably benign	0.10
R4625:Trpc6	UTSW	9	8677962	missense	probably benign	0.40
R4691:Trpc6	UTSW	9	8652978	missense	probably damaging	1.00
R4736:Trpc6	UTSW	9	8609870	missense	probably damaging	1.00
R4767:Trpc6	UTSW	9	8643686	missense	probably damaging	1.00
R4773:Trpc6	UTSW	9	8609851	missense	possibly damaging	0.78
R4792:Trpc6	UTSW	9	8626614	missense	probably benign	0.00
R5105:Trpc6	UTSW	9	8649470	missense	probably benign
R5319:Trpc6	UTSW	9	8609921	missense	probably damaging	1.00
R5429:Trpc6	UTSW	9	8634074	nonsense	probably null
R5505:Trpc6	UTSW	9	8626735	missense	probably damaging	1.00
R5657:Trpc6	UTSW	9	8609807	missense	probably benign	0.11
R5684:Trpc6	UTSW	9	8653128	missense	probably damaging	1.00
R5722:Trpc6	UTSW	9	8680549	missense	possibly damaging	0.88
R6210:Trpc6	UTSW	9	8656730	missense	probably benign	0.42
R6284:Trpc6	UTSW	9	8643600	missense	possibly damaging	0.93
R6773:Trpc6	UTSW	9	8634057	missense	probably damaging	1.00
R6874:Trpc6	UTSW	9	8680438	missense	probably damaging	1.00
R7032:Trpc6	UTSW	9	8609950	missense	probably damaging	1.00
R7142:Trpc6	UTSW	9	8653016	nonsense	probably null
R7489:Trpc6	UTSW	9	8656544	missense	probably benign	0.00
R7631:Trpc6	UTSW	9	8626701	missense	probably benign
R7762:Trpc6	UTSW	9	8653149	missense	possibly damaging	0.91
R7872:Trpc6	UTSW	9	8609909	missense	probably damaging	1.00
R7895:Trpc6	UTSW	9	8655218	missense	probably damaging	1.00
R7911:Trpc6	UTSW	9	8656704	missense	probably benign
R8115:Trpc6	UTSW	9	8609981	missense	probably damaging	1.00
R8183:Trpc6	UTSW	9	8653149	missense	possibly damaging	0.91
R8435:Trpc6	UTSW	9	8610440	missense	probably damaging	1.00
R8929:Trpc6	UTSW	9	8643410	intron	probably benign
R9355:Trpc6	UTSW	9	8649472	missense	probably benign
R9511:Trpc6	UTSW	9	8680418	missense	probably benign	0.17
R9572:Trpc6	UTSW	9	8656621	missense	possibly damaging	0.93
R9752:Trpc6	UTSW	9	8643640	missense	probably benign	0.03
Z1176:Trpc6	UTSW	9	8655213	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- CAAATCATTCTGTGTGCTGTCTC -3'
(R):5'- AACGTTTATGGCACTGTGGAGT -3'

Sequencing Primer
(F):5'- GTGTGCTGTCTCACCCCTAG -3'
(R):5'- CAGGCTTTTCTAGACATGACCAGG -3'

Posted On

2022-10-06