Incidental Mutation 'R9718:Shprh'
ID 730614
Institutional Source Beutler Lab
Gene Symbol Shprh
Ensembl Gene ENSMUSG00000090112
Gene Name SNF2 histone linker PHD RING helicase
Synonyms 2610103K11Rik, D230017O13Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9718 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 11149427-11217595 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 11213504 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1662 (L1662P)
Ref Sequence ENSEMBL: ENSMUSP00000039422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541]
AlphaFold Q7TPQ3
Predicted Effect probably damaging
Transcript: ENSMUST00000044053
AA Change: L1662P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: L1662P

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
Pfam:Helicase_C 1500 1613 1.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054814
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159541
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik A C 2: 32,575,235 probably benign Het
Acvr1c A T 2: 58,315,995 D34E probably benign Het
Arhgef19 T C 4: 141,249,292 V455A probably damaging Het
Cbfa2t3 T A 8: 122,638,197 D282V probably benign Het
Ccl9 T A 11: 83,575,412 N114I probably benign Het
Cdan1 G T 2: 120,724,169 A875E probably damaging Het
Celf2 A T 2: 6,721,538 F61L probably damaging Het
Chd9 T C 8: 90,986,173 Y875H unknown Het
Ckap5 A T 2: 91,548,832 K39M probably benign Het
Clcn3 T C 8: 60,937,400 H169R possibly damaging Het
Csmd3 C A 15: 47,696,687 V1416F Het
Cyp4v3 A T 8: 45,320,666 H155Q probably damaging Het
Dhx36 A G 3: 62,472,045 F874S possibly damaging Het
Dnah14 A T 1: 181,622,979 Q719L probably benign Het
Evi2 C T 11: 79,515,757 V331M probably damaging Het
Fcgrt T G 7: 45,095,429 E205A possibly damaging Het
Fkrp G T 7: 16,811,187 T250N probably benign Het
Galc G A 12: 98,259,314 P6S Het
Gm13420 A T 2: 29,747,536 L42Q probably damaging Het
Gm5134 A T 10: 75,992,497 M304L possibly damaging Het
Gm813 A G 16: 58,614,611 L117S probably benign Het
Haao T C 17: 83,834,786 E208G probably damaging Het
Hook1 T A 4: 96,016,441 H553Q probably benign Het
Igdcc3 A G 9: 65,182,998 probably null Het
Ighv10-3 C T 12: 114,523,634 V56I probably benign Het
Ighv1-62-1 G T 12: 115,387,085 A15E probably benign Het
Krtap24-1 T C 16: 88,611,490 *249W probably null Het
Ktn1 T G 14: 47,673,051 I318R probably damaging Het
L3mbtl2 A G 15: 81,687,922 T710A unknown Het
Ldha A T 7: 46,855,032 Q326L possibly damaging Het
Map4 G A 9: 110,072,706 probably null Het
Mdfic T A 6: 15,770,515 H173Q probably damaging Het
Noxred1 T A 12: 87,224,918 Q159L possibly damaging Het
Olfr114 C T 17: 37,590,023 G110D probably benign Het
Olfr584 T C 7: 103,085,989 V152A probably benign Het
Omd T C 13: 49,589,860 S129P probably damaging Het
Parp16 A G 9: 65,233,727 Y193C probably damaging Het
Pdzk1 A G 3: 96,855,858 T201A Het
Phldb2 T A 16: 45,781,393 H728L possibly damaging Het
Ptchd4 C T 17: 42,502,750 T514I probably damaging Het
Pusl1 T C 4: 155,891,637 D24G probably benign Het
Rai1 G A 11: 60,189,339 A1410T probably benign Het
Rint1 T A 5: 23,800,723 H134Q possibly damaging Het
Rnf170 A G 8: 26,129,215 S156G unknown Het
Rtf1 A G 2: 119,705,505 D180G possibly damaging Het
Sectm1a G T 11: 121,069,664 D108E probably damaging Het
Senp7 T A 16: 56,123,914 D200E probably damaging Het
Sfswap A G 5: 129,539,784 S431G probably benign Het
Sh3bp4 T A 1: 89,145,750 D773E probably damaging Het
Slx4 G T 16: 3,986,464 P829T possibly damaging Het
Snapc4 A T 2: 26,378,521 S43T probably damaging Het
Ssh3 C T 19: 4,262,409 R636Q probably benign Het
Strn4 G A 7: 16,838,571 V679M probably damaging Het
Tas2r121 T G 6: 132,700,802 Y69S probably benign Het
Tcerg1 C T 18: 42,530,771 T341M unknown Het
Tjp2 A C 19: 24,100,843 S895R probably damaging Het
Tmem220 G T 11: 67,025,260 A28S probably damaging Het
Trdv1 G A 14: 53,882,206 C109Y probably damaging Het
Trpc6 A G 9: 8,634,189 Y423C probably damaging Het
Ttn T C 2: 76,794,683 M15184V possibly damaging Het
Ugt2b37 T A 5: 87,242,943 Y355F probably benign Het
Vnn3 C T 10: 23,869,556 R468* probably null Het
Washc5 T A 15: 59,345,343 T792S probably benign Het
Wdfy4 T C 14: 33,125,936 M820V Het
Zfp961 T A 8: 71,968,089 C149S possibly damaging Het
Zmat4 G A 8: 23,748,491 V30M probably damaging Het
Other mutations in Shprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Shprh APN 10 11188158 missense probably damaging 1.00
IGL00583:Shprh APN 10 11188020 missense probably benign 0.37
IGL00684:Shprh APN 10 11163037 missense probably benign 0.11
IGL01295:Shprh APN 10 11183868 missense probably damaging 0.96
IGL01387:Shprh APN 10 11170254 missense probably damaging 1.00
IGL01635:Shprh APN 10 11170019 nonsense probably null
IGL01833:Shprh APN 10 11191062 missense probably damaging 1.00
IGL02013:Shprh APN 10 11181502 splice site probably benign
IGL02502:Shprh APN 10 11194357 missense possibly damaging 0.66
IGL02819:Shprh APN 10 11154765 missense possibly damaging 0.93
PIT4581001:Shprh UTSW 10 11192494 frame shift probably null
R0010:Shprh UTSW 10 11151931 missense probably benign
R0010:Shprh UTSW 10 11151931 missense probably benign
R0053:Shprh UTSW 10 11194372 splice site probably null
R0053:Shprh UTSW 10 11194372 splice site probably null
R0255:Shprh UTSW 10 11186391 missense possibly damaging 0.92
R0325:Shprh UTSW 10 11170109 missense probably benign 0.00
R0331:Shprh UTSW 10 11194170 splice site probably benign
R0494:Shprh UTSW 10 11157191 missense probably damaging 1.00
R0532:Shprh UTSW 10 11162812 missense possibly damaging 0.90
R0546:Shprh UTSW 10 11183887 splice site probably benign
R0574:Shprh UTSW 10 11163077 unclassified probably benign
R0605:Shprh UTSW 10 11207112 missense probably damaging 1.00
R0662:Shprh UTSW 10 11186847 missense probably damaging 1.00
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1263:Shprh UTSW 10 11159530 missense probably damaging 1.00
R1588:Shprh UTSW 10 11164744 missense probably damaging 1.00
R1638:Shprh UTSW 10 11157078 missense probably benign
R1830:Shprh UTSW 10 11186911 splice site probably null
R1898:Shprh UTSW 10 11186869 missense probably damaging 1.00
R1903:Shprh UTSW 10 11183797 nonsense probably null
R2060:Shprh UTSW 10 11152120 missense probably benign 0.03
R2225:Shprh UTSW 10 11162235 unclassified probably benign
R2363:Shprh UTSW 10 11171953 missense probably damaging 1.00
R2509:Shprh UTSW 10 11166724 missense probably damaging 1.00
R2891:Shprh UTSW 10 11164356 missense probably damaging 1.00
R3077:Shprh UTSW 10 11170413 missense probably damaging 1.00
R3150:Shprh UTSW 10 11170030 missense probably damaging 0.97
R3796:Shprh UTSW 10 11178757 missense possibly damaging 0.89
R4196:Shprh UTSW 10 11207860 utr 3 prime probably benign
R4423:Shprh UTSW 10 11186518 missense possibly damaging 0.82
R4488:Shprh UTSW 10 11160471 missense probably benign 0.17
R4748:Shprh UTSW 10 11170476 missense probably damaging 1.00
R4768:Shprh UTSW 10 11181540 missense probably damaging 0.96
R4867:Shprh UTSW 10 11164557 missense probably benign 0.00
R4937:Shprh UTSW 10 11157119 missense probably benign
R5140:Shprh UTSW 10 11154705 missense probably benign 0.03
R5318:Shprh UTSW 10 11166557 missense probably benign 0.04
R5323:Shprh UTSW 10 11170297 splice site probably null
R5450:Shprh UTSW 10 11212330 missense possibly damaging 0.70
R5872:Shprh UTSW 10 11188073 missense probably damaging 1.00
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6392:Shprh UTSW 10 11178741 nonsense probably null
R6416:Shprh UTSW 10 11167873 missense probably damaging 1.00
R6470:Shprh UTSW 10 11171937 missense probably damaging 0.98
R6513:Shprh UTSW 10 11186893 missense probably damaging 1.00
R6530:Shprh UTSW 10 11194267 missense probably benign 0.02
R6678:Shprh UTSW 10 11166545 missense probably benign 0.16
R6757:Shprh UTSW 10 11181508 splice site probably null
R6971:Shprh UTSW 10 11166693 missense probably damaging 1.00
R7158:Shprh UTSW 10 11166730 missense probably damaging 0.98
R7582:Shprh UTSW 10 11164705 missense probably benign
R7757:Shprh UTSW 10 11162180 missense probably benign 0.30
R7812:Shprh UTSW 10 11151991 missense probably benign
R7998:Shprh UTSW 10 11185341 missense probably damaging 1.00
R8061:Shprh UTSW 10 11212333 missense possibly damaging 0.71
R8082:Shprh UTSW 10 11151811 missense probably benign 0.22
R8116:Shprh UTSW 10 11213461 missense probably damaging 0.99
R8390:Shprh UTSW 10 11187983 missense possibly damaging 0.92
R8445:Shprh UTSW 10 11181569 missense possibly damaging 0.92
R8530:Shprh UTSW 10 11151934 missense probably benign 0.37
R8759:Shprh UTSW 10 11157164 missense possibly damaging 0.92
R8937:Shprh UTSW 10 11185437 missense possibly damaging 0.60
R8995:Shprh UTSW 10 11164830 nonsense probably null
R9053:Shprh UTSW 10 11154702 missense probably benign 0.04
R9131:Shprh UTSW 10 11162845 missense possibly damaging 0.58
R9176:Shprh UTSW 10 11160576 missense probably benign 0.02
R9391:Shprh UTSW 10 11162889 missense probably benign 0.05
R9423:Shprh UTSW 10 11205263 missense probably damaging 1.00
R9563:Shprh UTSW 10 11166491 nonsense probably null
R9668:Shprh UTSW 10 11206332 missense probably damaging 0.97
R9709:Shprh UTSW 10 11162830 missense possibly damaging 0.91
R9750:Shprh UTSW 10 11164460 missense probably damaging 0.98
RF012:Shprh UTSW 10 11164841 missense probably benign 0.02
V8831:Shprh UTSW 10 11186862 missense probably damaging 1.00
Z1176:Shprh UTSW 10 11164553 missense probably benign
Z1176:Shprh UTSW 10 11186447 missense probably damaging 1.00
Z1177:Shprh UTSW 10 11151762 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACTGTCTACTTGTGGCTCAGTG -3'
(R):5'- TCGGTATAGTGAAAAGGAACCAATTGC -3'

Sequencing Primer
(F):5'- ACTTGTGGCTCAGTGATGACCAC -3'
(R):5'- GAACCAATTGCCAATTATTACTAGGC -3'
Posted On 2022-10-06