Incidental Mutation 'R9718:Shprh'
ID 730614
Institutional Source Beutler Lab
Gene Symbol Shprh
Ensembl Gene ENSMUSG00000090112
Gene Name SNF2 histone linker PHD RING helicase
Synonyms 2610103K11Rik, D230017O13Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9718 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 11025171-11093339 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 11089248 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1662 (L1662P)
Ref Sequence ENSEMBL: ENSMUSP00000039422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541]
AlphaFold Q7TPQ3
Predicted Effect probably damaging
Transcript: ENSMUST00000044053
AA Change: L1662P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: L1662P

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
Pfam:Helicase_C 1500 1613 1.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054814
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159541
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik A C 2: 32,465,247 (GRCm39) probably benign Het
Acvr1c A T 2: 58,206,007 (GRCm39) D34E probably benign Het
Arhgef19 T C 4: 140,976,603 (GRCm39) V455A probably damaging Het
Cbfa2t3 T A 8: 123,364,936 (GRCm39) D282V probably benign Het
Ccl9 T A 11: 83,466,238 (GRCm39) N114I probably benign Het
Cdan1 G T 2: 120,554,650 (GRCm39) A875E probably damaging Het
Celf2 A T 2: 6,726,349 (GRCm39) F61L probably damaging Het
Chd9 T C 8: 91,712,801 (GRCm39) Y875H unknown Het
Ckap5 A T 2: 91,379,177 (GRCm39) K39M probably benign Het
Clcn3 T C 8: 61,390,434 (GRCm39) H169R possibly damaging Het
Csmd3 C A 15: 47,560,083 (GRCm39) V1416F Het
Cyp4v3 A T 8: 45,773,703 (GRCm39) H155Q probably damaging Het
Dhx36 A G 3: 62,379,466 (GRCm39) F874S possibly damaging Het
Dnah14 A T 1: 181,450,544 (GRCm39) Q719L probably benign Het
Evi2 C T 11: 79,406,583 (GRCm39) V331M probably damaging Het
Fcgrt T G 7: 44,744,853 (GRCm39) E205A possibly damaging Het
Fkrp G T 7: 16,545,112 (GRCm39) T250N probably benign Het
Ftdc1 A G 16: 58,434,974 (GRCm39) L117S probably benign Het
Galc G A 12: 98,225,573 (GRCm39) P6S Het
Gm5134 A T 10: 75,828,331 (GRCm39) M304L possibly damaging Het
Haao T C 17: 84,142,215 (GRCm39) E208G probably damaging Het
Hook1 T A 4: 95,904,678 (GRCm39) H553Q probably benign Het
Igdcc3 A G 9: 65,090,280 (GRCm39) probably null Het
Ighv10-3 C T 12: 114,487,254 (GRCm39) V56I probably benign Het
Ighv1-62-1 G T 12: 115,350,705 (GRCm39) A15E probably benign Het
Krtap24-1 T C 16: 88,408,378 (GRCm39) *249W probably null Het
Ktn1 T G 14: 47,910,508 (GRCm39) I318R probably damaging Het
L3mbtl2 A G 15: 81,572,123 (GRCm39) T710A unknown Het
Ldha A T 7: 46,504,456 (GRCm39) Q326L possibly damaging Het
Map4 G A 9: 109,901,774 (GRCm39) probably null Het
Mdfic T A 6: 15,770,514 (GRCm39) H173Q probably damaging Het
Noxred1 T A 12: 87,271,692 (GRCm39) Q159L possibly damaging Het
Omd T C 13: 49,743,336 (GRCm39) S129P probably damaging Het
Or14j3 C T 17: 37,900,914 (GRCm39) G110D probably benign Het
Or52r1c T C 7: 102,735,196 (GRCm39) V152A probably benign Het
Parp16 A G 9: 65,141,009 (GRCm39) Y193C probably damaging Het
Pdzk1 A G 3: 96,763,174 (GRCm39) T201A Het
Phldb2 T A 16: 45,601,756 (GRCm39) H728L possibly damaging Het
Prrt1b A T 2: 29,637,548 (GRCm39) L42Q probably damaging Het
Ptchd4 C T 17: 42,813,641 (GRCm39) T514I probably damaging Het
Pusl1 T C 4: 155,976,094 (GRCm39) D24G probably benign Het
Rai1 G A 11: 60,080,165 (GRCm39) A1410T probably benign Het
Rint1 T A 5: 24,005,721 (GRCm39) H134Q possibly damaging Het
Rnf170 A G 8: 26,619,243 (GRCm39) S156G unknown Het
Rtf1 A G 2: 119,535,986 (GRCm39) D180G possibly damaging Het
Sectm1a G T 11: 120,960,490 (GRCm39) D108E probably damaging Het
Senp7 T A 16: 55,944,277 (GRCm39) D200E probably damaging Het
Sfswap A G 5: 129,616,848 (GRCm39) S431G probably benign Het
Sh3bp4 T A 1: 89,073,472 (GRCm39) D773E probably damaging Het
Slx4 G T 16: 3,804,328 (GRCm39) P829T possibly damaging Het
Snapc4 A T 2: 26,268,533 (GRCm39) S43T probably damaging Het
Ssh3 C T 19: 4,312,437 (GRCm39) R636Q probably benign Het
Strn4 G A 7: 16,572,496 (GRCm39) V679M probably damaging Het
Tas2r121 T G 6: 132,677,765 (GRCm39) Y69S probably benign Het
Tcerg1 C T 18: 42,663,836 (GRCm39) T341M unknown Het
Tjp2 A C 19: 24,078,207 (GRCm39) S895R probably damaging Het
Tmem220 G T 11: 66,916,086 (GRCm39) A28S probably damaging Het
Trdv1 G A 14: 54,119,663 (GRCm39) C109Y probably damaging Het
Trpc6 A G 9: 8,634,190 (GRCm39) Y423C probably damaging Het
Ttn T C 2: 76,625,027 (GRCm39) M15184V possibly damaging Het
Ugt2b37 T A 5: 87,390,802 (GRCm39) Y355F probably benign Het
Vnn3 C T 10: 23,745,454 (GRCm39) R468* probably null Het
Washc5 T A 15: 59,217,192 (GRCm39) T792S probably benign Het
Wdfy4 T C 14: 32,847,893 (GRCm39) M820V Het
Zfp961 T A 8: 72,721,933 (GRCm39) C149S possibly damaging Het
Zmat4 G A 8: 24,238,507 (GRCm39) V30M probably damaging Het
Other mutations in Shprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Shprh APN 10 11,063,902 (GRCm39) missense probably damaging 1.00
IGL00583:Shprh APN 10 11,063,764 (GRCm39) missense probably benign 0.37
IGL00684:Shprh APN 10 11,038,781 (GRCm39) missense probably benign 0.11
IGL01295:Shprh APN 10 11,059,612 (GRCm39) missense probably damaging 0.96
IGL01387:Shprh APN 10 11,045,998 (GRCm39) missense probably damaging 1.00
IGL01635:Shprh APN 10 11,045,763 (GRCm39) nonsense probably null
IGL01833:Shprh APN 10 11,066,806 (GRCm39) missense probably damaging 1.00
IGL02013:Shprh APN 10 11,057,246 (GRCm39) splice site probably benign
IGL02502:Shprh APN 10 11,070,101 (GRCm39) missense possibly damaging 0.66
IGL02819:Shprh APN 10 11,030,509 (GRCm39) missense possibly damaging 0.93
PIT4581001:Shprh UTSW 10 11,068,238 (GRCm39) frame shift probably null
R0010:Shprh UTSW 10 11,027,675 (GRCm39) missense probably benign
R0010:Shprh UTSW 10 11,027,675 (GRCm39) missense probably benign
R0053:Shprh UTSW 10 11,070,116 (GRCm39) splice site probably null
R0053:Shprh UTSW 10 11,070,116 (GRCm39) splice site probably null
R0255:Shprh UTSW 10 11,062,135 (GRCm39) missense possibly damaging 0.92
R0325:Shprh UTSW 10 11,045,853 (GRCm39) missense probably benign 0.00
R0331:Shprh UTSW 10 11,069,914 (GRCm39) splice site probably benign
R0494:Shprh UTSW 10 11,032,935 (GRCm39) missense probably damaging 1.00
R0532:Shprh UTSW 10 11,038,556 (GRCm39) missense possibly damaging 0.90
R0546:Shprh UTSW 10 11,059,631 (GRCm39) splice site probably benign
R0574:Shprh UTSW 10 11,038,821 (GRCm39) unclassified probably benign
R0605:Shprh UTSW 10 11,082,856 (GRCm39) missense probably damaging 1.00
R0662:Shprh UTSW 10 11,062,591 (GRCm39) missense probably damaging 1.00
R1148:Shprh UTSW 10 11,089,226 (GRCm39) missense possibly damaging 0.95
R1148:Shprh UTSW 10 11,089,226 (GRCm39) missense possibly damaging 0.95
R1263:Shprh UTSW 10 11,035,274 (GRCm39) missense probably damaging 1.00
R1588:Shprh UTSW 10 11,040,488 (GRCm39) missense probably damaging 1.00
R1638:Shprh UTSW 10 11,032,822 (GRCm39) missense probably benign
R1830:Shprh UTSW 10 11,062,655 (GRCm39) splice site probably null
R1898:Shprh UTSW 10 11,062,613 (GRCm39) missense probably damaging 1.00
R1903:Shprh UTSW 10 11,059,541 (GRCm39) nonsense probably null
R2060:Shprh UTSW 10 11,027,864 (GRCm39) missense probably benign 0.03
R2225:Shprh UTSW 10 11,037,979 (GRCm39) unclassified probably benign
R2363:Shprh UTSW 10 11,047,697 (GRCm39) missense probably damaging 1.00
R2509:Shprh UTSW 10 11,042,468 (GRCm39) missense probably damaging 1.00
R2891:Shprh UTSW 10 11,040,100 (GRCm39) missense probably damaging 1.00
R3077:Shprh UTSW 10 11,046,157 (GRCm39) missense probably damaging 1.00
R3150:Shprh UTSW 10 11,045,774 (GRCm39) missense probably damaging 0.97
R3796:Shprh UTSW 10 11,054,501 (GRCm39) missense possibly damaging 0.89
R4196:Shprh UTSW 10 11,083,604 (GRCm39) utr 3 prime probably benign
R4423:Shprh UTSW 10 11,062,262 (GRCm39) missense possibly damaging 0.82
R4488:Shprh UTSW 10 11,036,215 (GRCm39) missense probably benign 0.17
R4748:Shprh UTSW 10 11,046,220 (GRCm39) missense probably damaging 1.00
R4768:Shprh UTSW 10 11,057,284 (GRCm39) missense probably damaging 0.96
R4867:Shprh UTSW 10 11,040,301 (GRCm39) missense probably benign 0.00
R4937:Shprh UTSW 10 11,032,863 (GRCm39) missense probably benign
R5140:Shprh UTSW 10 11,030,449 (GRCm39) missense probably benign 0.03
R5318:Shprh UTSW 10 11,042,301 (GRCm39) missense probably benign 0.04
R5323:Shprh UTSW 10 11,046,041 (GRCm39) splice site probably null
R5450:Shprh UTSW 10 11,088,074 (GRCm39) missense possibly damaging 0.70
R5872:Shprh UTSW 10 11,063,817 (GRCm39) missense probably damaging 1.00
R6030:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign 0.37
R6030:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign 0.37
R6392:Shprh UTSW 10 11,054,485 (GRCm39) nonsense probably null
R6416:Shprh UTSW 10 11,043,617 (GRCm39) missense probably damaging 1.00
R6470:Shprh UTSW 10 11,047,681 (GRCm39) missense probably damaging 0.98
R6513:Shprh UTSW 10 11,062,637 (GRCm39) missense probably damaging 1.00
R6530:Shprh UTSW 10 11,070,011 (GRCm39) missense probably benign 0.02
R6678:Shprh UTSW 10 11,042,289 (GRCm39) missense probably benign 0.16
R6757:Shprh UTSW 10 11,057,252 (GRCm39) splice site probably null
R6971:Shprh UTSW 10 11,042,437 (GRCm39) missense probably damaging 1.00
R7158:Shprh UTSW 10 11,042,474 (GRCm39) missense probably damaging 0.98
R7582:Shprh UTSW 10 11,040,449 (GRCm39) missense probably benign
R7757:Shprh UTSW 10 11,037,924 (GRCm39) missense probably benign 0.30
R7812:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign
R7998:Shprh UTSW 10 11,061,085 (GRCm39) missense probably damaging 1.00
R8061:Shprh UTSW 10 11,088,077 (GRCm39) missense possibly damaging 0.71
R8082:Shprh UTSW 10 11,027,555 (GRCm39) missense probably benign 0.22
R8116:Shprh UTSW 10 11,089,205 (GRCm39) missense probably damaging 0.99
R8390:Shprh UTSW 10 11,063,727 (GRCm39) missense possibly damaging 0.92
R8445:Shprh UTSW 10 11,057,313 (GRCm39) missense possibly damaging 0.92
R8530:Shprh UTSW 10 11,027,678 (GRCm39) missense probably benign 0.37
R8759:Shprh UTSW 10 11,032,908 (GRCm39) missense possibly damaging 0.92
R8937:Shprh UTSW 10 11,061,181 (GRCm39) missense possibly damaging 0.60
R8995:Shprh UTSW 10 11,040,574 (GRCm39) nonsense probably null
R9053:Shprh UTSW 10 11,030,446 (GRCm39) missense probably benign 0.04
R9131:Shprh UTSW 10 11,038,589 (GRCm39) missense possibly damaging 0.58
R9176:Shprh UTSW 10 11,036,320 (GRCm39) missense probably benign 0.02
R9391:Shprh UTSW 10 11,038,633 (GRCm39) missense probably benign 0.05
R9423:Shprh UTSW 10 11,081,007 (GRCm39) missense probably damaging 1.00
R9563:Shprh UTSW 10 11,042,235 (GRCm39) nonsense probably null
R9668:Shprh UTSW 10 11,082,076 (GRCm39) missense probably damaging 0.97
R9709:Shprh UTSW 10 11,038,574 (GRCm39) missense possibly damaging 0.91
R9750:Shprh UTSW 10 11,040,204 (GRCm39) missense probably damaging 0.98
RF012:Shprh UTSW 10 11,040,585 (GRCm39) missense probably benign 0.02
V8831:Shprh UTSW 10 11,062,606 (GRCm39) missense probably damaging 1.00
Z1176:Shprh UTSW 10 11,062,191 (GRCm39) missense probably damaging 1.00
Z1176:Shprh UTSW 10 11,040,297 (GRCm39) missense probably benign
Z1177:Shprh UTSW 10 11,027,506 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACTGTCTACTTGTGGCTCAGTG -3'
(R):5'- TCGGTATAGTGAAAAGGAACCAATTGC -3'

Sequencing Primer
(F):5'- ACTTGTGGCTCAGTGATGACCAC -3'
(R):5'- GAACCAATTGCCAATTATTACTAGGC -3'
Posted On 2022-10-06